Hum Genet (1991) 88 : 231-232
9 Springer-Verlag 1991
An R N A splice site mutation in the Cl-inhibitor gene causes type I hereditary angio-oedema Z. Siddique, A.R.McPhaden, D. F. Lappin, and K.Whaley* University Department of Pathology. Western Infirmary, Glasgow G 11 6NT. UK Received July 1. 1991
Summary. Restriction fragment length polymorphism analysis, the polymerase chain reaction and nucleotide sequencing have been used to characterise a single base substitution (G---~T) at nucleotide 8863 in the C 1-inhibitor gene. This destroys the 5' donor splice site recognition motif of the sixth intron. Family studies suggest that the mutation is responsible for type I hereditary angio-oedema in a studied kindred.
Introduction The C 1-inhibitor is an important inhibitor of the complement system of proteins and of other serine-protease-dependent plasma mediator systems (Davis 1988). Hereditary Cl-inhibitor deficiency or hereditary angio-oedema ( H A E ) is an autosomal dominant disease that is characterised by recurrent episodes of subcutaneous and submucous o e d e m a (Cicardi et al. 1982). Biochemically, H A E can be subdivided into type I H A E in which there are low serum levels of functionally normal Cl-inhibitor, and type II H A E with normal or elevated serum levels mainly of a dysfunctional C 1-inhibitor protein (Kerr and Yeung-Laiwah 1987). Recently, a limited number of gene mutations responsible for type I H A E have been described comprising exon deletions (Stoppa-Lyonnet et al. 1990) and a single base deletion creating a p r e m a t u r e translation termination codon (Siddique et al. unpublished). This report describes the characterisation of a further category of Cl-inhibitor gene mutation responsible for type I H A E .
Materials and methods Restriction fragment length polymorphism (RFLP) analysis using the enzyme SO'I and high molecular weight leukocyte D N A previously identified a mutation on one allele of the Cl-inhibitor gene in a kindred with type I H A E (McPhaden et al. 1991). Analysis of the Styl RFLP's in 23 family members showed that ~he mutation co-segregated with the disease and allowed Iocalisation of the mutation to the extreme 3' end of the sixth exon.
* Present address and address for offprint requests: Department of Immunology. Leicester Royal Infirmary. Leicester LE2 7LX. UK
In order to characterise the mutation further, polymerase chain reaction (PCR) amplification of the abnormal area was carried out generating a 417-bp fragment. The oligonucleotide primers used to direct the amplification were 5' TCGGATCTCAATGTCCCTGC 3' (Cl-inhibitor gene nucleotides 8618-8637) and 5' TTGGCCAAGGCTAGAGAAAGG 3' (nucleotides 9015-9035). The numbering of the nucleotide sequence was defined using the first nucleotide of exon 1 as nucleotide 1 (Carter et al. 1991) (the Cl-inhibitor gene EMBL sequence bank accession number is X54486). PCR was performed using I gg leukocyte genomic DNA. 2.5 units Taq polymerase (Perkin-Elmer/Cetus, Emeryville, California. USA) and 0.5 ~tM oligonucteotide primers in a 100-1,11reaction mixture containing 50mM KCI, 10mM TRIS-HCI (pH 8.8). 1.5raM MgCI_,and 0.1% (v/v) Triton X-100 (Saiki et al. 1988). Twenty-five cycles of amplification in an automatic Techne PHC-I thermocycler were used, each cycle comprising 1 rain heat denaturation at 94~ 2rain annealing at 60~ and 1.7min extension at 72~ Thereafter. the PCR products were purified by phenol/chloroform extraction and ammonium acetate/ethanol precipitation. Blunt end ligation of the PCR products into M13mpl9 was then carried out before nucleotide sequencing by a standard dideoxynucleotide chain termination technique using the Sequenase enzyme (Tabor and Richardson 1987).
Results and discussion The StyI R F L P shown in Fig. 1 indicates the loss of the StyI recognition site at the 3' end of the sixth exon of one allele of the C 1-inhibitor gene without apparent deletion of D N A . P C R amplification of this mutated area generates the 417-bp fragment seen in Fig. 2; the fragments derived from the mutant allele are resistant to StyI cleavage as shown. Nucleotide sequencing of the cloned P C R product from the mutant allele demonstrates a single base mutation in the StyI recognition motif ( C C A A G G ---~CCAAGT), which lies at the extreme 3' end of the sixth exon (-Fig. 3). The mutated G residue is the first nucleotide of the sixth intron and, as such, constitutes part of the G T 5' donor splice site recognition motif essential for excision of the sixth intron during C 1-inhibitor m R N A processing. Mutation of this donor splice site ( G T - - , T T ) destroys its function, thereby inhibiting normal m R N A processing from this Cl-inhibitor allele and producing type I H A E . In order to establish whether an abnormal m R N A species was generated from the mutated allele, patient
232
Fig. 1. Lanes l and 2 represent Styl-digested patient DNA and control DNA, respectively. An additional 1. l-kb band is present in lane 1 with a 50% reduction in the intensity of the 0.9-kb band
m o n o c y t e m R N A was used as a t e m p l a t e for r e v e r s e t r a n s c r i p t a s e ( R T ) to p r o d u c e first s t r a n d c D N A c o p i e s ( c D N A cycle kit for R T - P C R , I n v i t r o g e n C o r p o r a t i o n , San D i e g o , C a l i f o r n i a ) : t h e r e a f t e r , P C R a m p l i f i c a t i o n of the C l - i n h i b i t o r c D N A thus g e n e r a t e d was c a r r i e d o u t using the e x o n 6 p r i m e r 5 ' T A C C C T G T G G C C C A T T T C A T 3' (nt 8 8 2 1 - n t 8840) and the e x o n 7 p r i m e r 5' G A CGATGTTTCAGGTTCTGG 3' (nt 1 4 0 8 1 - n t 14100) f o l l o w e d by d i r e c t n u c l e o t i d e s e q u e n c i n g of the l l 2 - b p P C R p r o d u c t . W e did n o t d e t e c t an a b n o r m a l P C R p r o duct following a g a r o s e gel e l e c t r o p h o r e s i s , StyI d i g e s t i o n o r n u c l e o t i d e s e q u e n c i n g , and the C l - i n h i b i t o r m R N A was n o r m a l in size a n d p r e s e n t with a relative a b u n d a n c e o f 50% on N o r t h e r n blot analysis of m o n o c y t e R N A ( d a t a not s h o w n ) . W e have t h e r e f o r e c o n c l u d e d that t h e r e is no d e t e c t a b l e a b n o r m a l m R N A species, a n d that t h e t r a n s c r i p t of the m u t a n t allele is p r o b a b l y d e g r a d e d rapidly. The m R N A splice site m u t a t i o n d e s c r i b e d in this study r e p r e s e n t s the first r e p o r t of such a m u t a t i o n in t y p e I H A E . This f o r m o f m u t a t i o n is, h o w e v e r , well r e c o g nised as a cause o f o t h e r g e n e t i c diseases, including [3t h a l a s s a e m i a ( K a z a z i a n a n d B o e h m 1988), h a e m o p h i l i a B ( G r e e n et la. 1989) a n d T a y - S a c h s d i s e a s e ( M y e r o w i t z 1988). Acknowledgements. This work was supported by grant 960 from the Scottish Hospital Endowment Research Trust and the Wellcome Trust.
References Fig. 2. StyI RFLP analysis of PCR-amplified exon 6 genomic DNA. Aliquots of PCR products were digested with Styl at 37~ for 3 h and then analysed by electrophoresis on a 1.5% (w/v) agarose gel containing ethidium bromide ( 1 ~tg/ml). Lalles 1.6 Molecular weight marker. HaeIII digest of pBR322: lanes 2, 4 patient DNA: lanes 3, 5 control DNA: lanes 2 . 3 show normal size (417 bp) exon amplified products: lanes 4, 5 StyI digests of amplified products. Normal DNA was digested completely to give two bands (247bp and 166 bp). A 9-bp fragment, generated by cleavage of a second Styl site is not seen. Lane 4 shows a partial digest of patient DNA. This pattern was seen on repeat digestion of this sample, and on digestion of the exon 6 amplified products of two other patients in this kindred
Fig.3. DNA sequence of the PCR-amplified DNA around the exon 6/intron 6 boundary. A comparison of the patient DNA and control DNA reveals a single base substitution (G-+T) as indicated: this results in the loss of the normal GT 5' donor splice site at position 8863
Carter PE. Duponchel C, Tosi M, Fothergill JE (1991) Complete nucleotide sequence of the gene for human Cl-inhibitor with an unusually high density of Alu elements. Eur J Biochem 197:301-308 Cicardi M, Bergamaschini L, Marasini B, Boccassini G, Tucci A, Agostini A (1982) Hereditary angio-oedema: an appraisal of 104 cases. Am J Med Sci 284: 2-9 Davis AE III (1988) CI-inhibitor and hereditary angio-neurotic oedema. Annu Rev Immunol 6:595-628 Green PM, Bentley DR, Mibashan RS, Nilsson IM, Gianelli F (1989) Molecular pathology of haemophilia B. EMBO J 8: 1067-1072 Kazazian HH Jr. Boehm CD (1988) Molecular basis and prenatal diagnosis of [3-thalassaemia. Blood 72 : 1107-1116 Kerr MA, Yeung-Laiwah AAC (1987) C l-inhibitor deficiency and angio-oedema. In: Whaley K (ed) Complement in health and disease. MTP Press. Lancaster. pp 53-78 McPhaden AR, Birnie GD, Whaley K (1991) Restriction fragment length polymorphism analysis of the Cl-inhibitor gene in hereditary C l-inhibitor deficiency. Clin Genet 39: t61-171 Myerowitz R (1988) Splice junction mutation in some Askenazi Jews with Tay-Sachs disease: evidence against a single defect within this ethnic group. Proc Natl Acad Sci USA 85:39553959 Saiki RK, Gyllensten VB, Erlich HA (1988) The polymerase chain reaction. In: Davies KE (ed) Genome analysis. A practical approachl IRL Press, Oxford, pp 141-152 Stoppa-Lyonnet D, Carter PE, Meo T, Tosi M (1990) Clusters of intragenic Alu repeats predispose the human Cl-inhibitor locus to deleterious rearrangements. Proc Nat] Acad Sci USA 87 : 1551-1555 Tabor S, Richardson CC (1987) DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. Proc Natl Acad Sci USA 84:4767-4771
9 Springer-Verlag 1991
An R N A splice site mutation in the Cl-inhibitor gene causes type I hereditary angio-oedema Z. Siddique, A.R.McPhaden, D. F. Lappin, and K.Whaley* University Department of Pathology. Western Infirmary, Glasgow G 11 6NT. UK Received July 1. 1991
Summary. Restriction fragment length polymorphism analysis, the polymerase chain reaction and nucleotide sequencing have been used to characterise a single base substitution (G---~T) at nucleotide 8863 in the C 1-inhibitor gene. This destroys the 5' donor splice site recognition motif of the sixth intron. Family studies suggest that the mutation is responsible for type I hereditary angio-oedema in a studied kindred.
Introduction The C 1-inhibitor is an important inhibitor of the complement system of proteins and of other serine-protease-dependent plasma mediator systems (Davis 1988). Hereditary Cl-inhibitor deficiency or hereditary angio-oedema ( H A E ) is an autosomal dominant disease that is characterised by recurrent episodes of subcutaneous and submucous o e d e m a (Cicardi et al. 1982). Biochemically, H A E can be subdivided into type I H A E in which there are low serum levels of functionally normal Cl-inhibitor, and type II H A E with normal or elevated serum levels mainly of a dysfunctional C 1-inhibitor protein (Kerr and Yeung-Laiwah 1987). Recently, a limited number of gene mutations responsible for type I H A E have been described comprising exon deletions (Stoppa-Lyonnet et al. 1990) and a single base deletion creating a p r e m a t u r e translation termination codon (Siddique et al. unpublished). This report describes the characterisation of a further category of Cl-inhibitor gene mutation responsible for type I H A E .
Materials and methods Restriction fragment length polymorphism (RFLP) analysis using the enzyme SO'I and high molecular weight leukocyte D N A previously identified a mutation on one allele of the Cl-inhibitor gene in a kindred with type I H A E (McPhaden et al. 1991). Analysis of the Styl RFLP's in 23 family members showed that ~he mutation co-segregated with the disease and allowed Iocalisation of the mutation to the extreme 3' end of the sixth exon.
* Present address and address for offprint requests: Department of Immunology. Leicester Royal Infirmary. Leicester LE2 7LX. UK
In order to characterise the mutation further, polymerase chain reaction (PCR) amplification of the abnormal area was carried out generating a 417-bp fragment. The oligonucleotide primers used to direct the amplification were 5' TCGGATCTCAATGTCCCTGC 3' (Cl-inhibitor gene nucleotides 8618-8637) and 5' TTGGCCAAGGCTAGAGAAAGG 3' (nucleotides 9015-9035). The numbering of the nucleotide sequence was defined using the first nucleotide of exon 1 as nucleotide 1 (Carter et al. 1991) (the Cl-inhibitor gene EMBL sequence bank accession number is X54486). PCR was performed using I gg leukocyte genomic DNA. 2.5 units Taq polymerase (Perkin-Elmer/Cetus, Emeryville, California. USA) and 0.5 ~tM oligonucteotide primers in a 100-1,11reaction mixture containing 50mM KCI, 10mM TRIS-HCI (pH 8.8). 1.5raM MgCI_,and 0.1% (v/v) Triton X-100 (Saiki et al. 1988). Twenty-five cycles of amplification in an automatic Techne PHC-I thermocycler were used, each cycle comprising 1 rain heat denaturation at 94~ 2rain annealing at 60~ and 1.7min extension at 72~ Thereafter. the PCR products were purified by phenol/chloroform extraction and ammonium acetate/ethanol precipitation. Blunt end ligation of the PCR products into M13mpl9 was then carried out before nucleotide sequencing by a standard dideoxynucleotide chain termination technique using the Sequenase enzyme (Tabor and Richardson 1987).
Results and discussion The StyI R F L P shown in Fig. 1 indicates the loss of the StyI recognition site at the 3' end of the sixth exon of one allele of the C 1-inhibitor gene without apparent deletion of D N A . P C R amplification of this mutated area generates the 417-bp fragment seen in Fig. 2; the fragments derived from the mutant allele are resistant to StyI cleavage as shown. Nucleotide sequencing of the cloned P C R product from the mutant allele demonstrates a single base mutation in the StyI recognition motif ( C C A A G G ---~CCAAGT), which lies at the extreme 3' end of the sixth exon (-Fig. 3). The mutated G residue is the first nucleotide of the sixth intron and, as such, constitutes part of the G T 5' donor splice site recognition motif essential for excision of the sixth intron during C 1-inhibitor m R N A processing. Mutation of this donor splice site ( G T - - , T T ) destroys its function, thereby inhibiting normal m R N A processing from this Cl-inhibitor allele and producing type I H A E . In order to establish whether an abnormal m R N A species was generated from the mutated allele, patient
232
Fig. 1. Lanes l and 2 represent Styl-digested patient DNA and control DNA, respectively. An additional 1. l-kb band is present in lane 1 with a 50% reduction in the intensity of the 0.9-kb band
m o n o c y t e m R N A was used as a t e m p l a t e for r e v e r s e t r a n s c r i p t a s e ( R T ) to p r o d u c e first s t r a n d c D N A c o p i e s ( c D N A cycle kit for R T - P C R , I n v i t r o g e n C o r p o r a t i o n , San D i e g o , C a l i f o r n i a ) : t h e r e a f t e r , P C R a m p l i f i c a t i o n of the C l - i n h i b i t o r c D N A thus g e n e r a t e d was c a r r i e d o u t using the e x o n 6 p r i m e r 5 ' T A C C C T G T G G C C C A T T T C A T 3' (nt 8 8 2 1 - n t 8840) and the e x o n 7 p r i m e r 5' G A CGATGTTTCAGGTTCTGG 3' (nt 1 4 0 8 1 - n t 14100) f o l l o w e d by d i r e c t n u c l e o t i d e s e q u e n c i n g of the l l 2 - b p P C R p r o d u c t . W e did n o t d e t e c t an a b n o r m a l P C R p r o duct following a g a r o s e gel e l e c t r o p h o r e s i s , StyI d i g e s t i o n o r n u c l e o t i d e s e q u e n c i n g , and the C l - i n h i b i t o r m R N A was n o r m a l in size a n d p r e s e n t with a relative a b u n d a n c e o f 50% on N o r t h e r n blot analysis of m o n o c y t e R N A ( d a t a not s h o w n ) . W e have t h e r e f o r e c o n c l u d e d that t h e r e is no d e t e c t a b l e a b n o r m a l m R N A species, a n d that t h e t r a n s c r i p t of the m u t a n t allele is p r o b a b l y d e g r a d e d rapidly. The m R N A splice site m u t a t i o n d e s c r i b e d in this study r e p r e s e n t s the first r e p o r t of such a m u t a t i o n in t y p e I H A E . This f o r m o f m u t a t i o n is, h o w e v e r , well r e c o g nised as a cause o f o t h e r g e n e t i c diseases, including [3t h a l a s s a e m i a ( K a z a z i a n a n d B o e h m 1988), h a e m o p h i l i a B ( G r e e n et la. 1989) a n d T a y - S a c h s d i s e a s e ( M y e r o w i t z 1988). Acknowledgements. This work was supported by grant 960 from the Scottish Hospital Endowment Research Trust and the Wellcome Trust.
References Fig. 2. StyI RFLP analysis of PCR-amplified exon 6 genomic DNA. Aliquots of PCR products were digested with Styl at 37~ for 3 h and then analysed by electrophoresis on a 1.5% (w/v) agarose gel containing ethidium bromide ( 1 ~tg/ml). Lalles 1.6 Molecular weight marker. HaeIII digest of pBR322: lanes 2, 4 patient DNA: lanes 3, 5 control DNA: lanes 2 . 3 show normal size (417 bp) exon amplified products: lanes 4, 5 StyI digests of amplified products. Normal DNA was digested completely to give two bands (247bp and 166 bp). A 9-bp fragment, generated by cleavage of a second Styl site is not seen. Lane 4 shows a partial digest of patient DNA. This pattern was seen on repeat digestion of this sample, and on digestion of the exon 6 amplified products of two other patients in this kindred
Fig.3. DNA sequence of the PCR-amplified DNA around the exon 6/intron 6 boundary. A comparison of the patient DNA and control DNA reveals a single base substitution (G-+T) as indicated: this results in the loss of the normal GT 5' donor splice site at position 8863
Carter PE. Duponchel C, Tosi M, Fothergill JE (1991) Complete nucleotide sequence of the gene for human Cl-inhibitor with an unusually high density of Alu elements. Eur J Biochem 197:301-308 Cicardi M, Bergamaschini L, Marasini B, Boccassini G, Tucci A, Agostini A (1982) Hereditary angio-oedema: an appraisal of 104 cases. Am J Med Sci 284: 2-9 Davis AE III (1988) CI-inhibitor and hereditary angio-neurotic oedema. Annu Rev Immunol 6:595-628 Green PM, Bentley DR, Mibashan RS, Nilsson IM, Gianelli F (1989) Molecular pathology of haemophilia B. EMBO J 8: 1067-1072 Kazazian HH Jr. Boehm CD (1988) Molecular basis and prenatal diagnosis of [3-thalassaemia. Blood 72 : 1107-1116 Kerr MA, Yeung-Laiwah AAC (1987) C l-inhibitor deficiency and angio-oedema. In: Whaley K (ed) Complement in health and disease. MTP Press. Lancaster. pp 53-78 McPhaden AR, Birnie GD, Whaley K (1991) Restriction fragment length polymorphism analysis of the Cl-inhibitor gene in hereditary C l-inhibitor deficiency. Clin Genet 39: t61-171 Myerowitz R (1988) Splice junction mutation in some Askenazi Jews with Tay-Sachs disease: evidence against a single defect within this ethnic group. Proc Natl Acad Sci USA 85:39553959 Saiki RK, Gyllensten VB, Erlich HA (1988) The polymerase chain reaction. In: Davies KE (ed) Genome analysis. A practical approachl IRL Press, Oxford, pp 141-152 Stoppa-Lyonnet D, Carter PE, Meo T, Tosi M (1990) Clusters of intragenic Alu repeats predispose the human Cl-inhibitor locus to deleterious rearrangements. Proc Nat] Acad Sci USA 87 : 1551-1555 Tabor S, Richardson CC (1987) DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. Proc Natl Acad Sci USA 84:4767-4771
