Analyses of genetic and pathogenic variability among Botrytis cinerea isolates.

G Model MICRES-25664; No. of Pages 11

ARTICLE IN PRESS Microbiological Research xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Microbiological Research journal homepage: www.elsevier.com/locate/micres

Analyses of genetic and pathogenic variability among Botrytis cinerea isolates Sarita Kumari ∗ , Pamil Tayal, Esha Sharma, Rupam Kapoor Applied Mycology Laboratory, Department of Botany, University of Delhi, Delhi 110 007, India

a r t i c l e

i n f o

Article history: Received 25 July 2013 Received in revised form 23 February 2014 Accepted 25 February 2014 Available online xxx Keywords: Botrytis cinerea Fungicides MAT loci Oxalic acid Transposable elements

a b s t r a c t Seventy nine isolates of Botrytis cinerea were collected from different host plants and different locations of India and Nepal. All the isolates were identified as B. cinerea based on morphological features and were confirmed using B. cinerea specific primers. Differentiation among the isolates was assessed using morphological, genetic and biochemical approaches. To analyze morphological variability, differences in conidial size, presence or absence of sclerotia and their arrangement were observed. Genetic variability was characterized using RAPD analysis, presence or absence of transposons and mating type genes. Cluster analysis based on RAPD markers was used for defining groups on the basis of geographical region and host. The biochemical approach included determining differences in concentration of oxalic acid and activity of lytic enzymes. All the isolates were categorized into different pathogenic groups on the basis their variable reaction towards chickpea plants. Isolates with higher concentration of oxalic acid and greater activity of lytic enzymes were generally more pathogenic. Pathogenicity was also correlated to transposons. Isolates containing transposa group showed some degree of correlation with pathogenic behavior. However, isolates could not be grouped on the basis of a single approach which provides evidence of their wide diversity and high evolution potential. Sensitivity of sampled isolates was also tested against five botryticides. Most of the isolates from same region were inhibited by a particular fungicide. This feature provided interesting cues and would assist in devising novel and more effective measures for managing the disease. © 2014 Elsevier GmbH. All rights reserved.

1. Introduction Botrytis cinerea the causal agent of grey mould disease is a phytopathogenic fungus with necrotrophic lifestyle (Fekete et al. 2011). It causes extensive damage under pre- and post harvest conditions and has been known to infect over 200 plant species worldwide (Williamson et al. 2007). B. cinerea is not host specific and virulence varies among different plant hosts (Derckel et al. 1999; Mirzaei et al. 2009). The broad spectrum and wide adaptability of this pathogen has stirred great interest in researchers to unravel its complexity. Due to its great economic impact it is widely adopted as a molecular model organism and has been rated as the second most important fungal pathogen (Dean et al. 2012). Morphological traits such as mycelia, conidia, structure of conidiophores, size and form of sclerotia are useful in demarcating some species of Botrytis. Though, it is time consuming requires expertise

∗ Corresponding author. Tel.: +91 9717565751. E-mail addresses: [email protected], [email protected] (S. Kumari).

and cannot suffice for complete identification of the pathogen. Nevertheless, growing conditions are known to significantly influence variation (Beever and Weeds 2004). In recent past, the development of specific primers against B. cinerea has allowed easy detection at the species level (Riggotti et al. 2002; González et al. 2009; Karakaya and Bayraktar 2009; Tomlinson et al. 2010). B. cinerea is complex due to its great flexibility in adapting to various environmental conditions. This variability is manifested in its phenotypic instability (Yourman et al. 2000), ploidy (Büttner et al. 1994), morphology (Chardonnet et al. 2000), pathogenicity (Van der Vlugt-Bergmans ˜ 1996) and DNA polymorphism (Alfonso et al. 2000; Munoz et al. 2002; Moyano et al. 2003). Genetic variability of B. cinerea has been studied using molecular tools such as restriction fragment length polymorphism (Giraud et al. 1997), presence and absence of transposable elements i.e. boty and flipper (Diolez et al. 1995; Levis et al. 1997), random amplified polymorphic DNA fingerprinting (Kerssies et al.1997; Van der Vlugt-Bergmans et al. 1993), fingerprinting of repetitive sequences (Ma and Michailides 2005), amplified fragment length polymorphism (Moyano et al. 2003) and microsatellite typing (Fournier et al. 2002). This has made a

http://dx.doi.org/10.1016/j.micres.2014.02.012 0944-5013/© 2014 Elsevier GmbH. All rights reserved.

Please cite this article in press as: Kumari S, et al. Analyses of genetic and pathogenic variability among Botrytis cinerea isolates. Microbiol Res (2014), http://dx.doi.org/10.1016/j.micres.2014.02.012


ARTICLE IN PRESS S. Kumari et al. / Microbiological Research xxx (2014) xxx–xxx

2

significant impact on fungal species identification, phylogenetic (Fournier et al. 2005) and taxonomic studies, including the differentiation of intraspecific groupings or between very closely related species, aided in genetic mapping studies (Pande et al. 2010), and has defined pattern of mating type distribution among the population of the fungus from same region, different hosts and vice versa. Mating type distribution within a pathogen is the simplest way to determine the potential for sexual recombination and thus evolutionary potential. It is assumed that when a 1:1 ratio between mating types within a population is observed, they are randomly mating because there appears to be frequency dependent selection of each type. In spite of large number of studies, a regular trend and positive correlation between biological and ecological characteristics has not been established (Alfonso et al. 2000; Mirzaei et al. 2009) which may be due to the evolutionary potential of this fungus. Due to high genetic plasticity, development of resistant strains makes it difficult for farmers to adopt an antifungal compound which can totally eradicate grey mould disease. Researchers have tried to evaluate the potential of some fungicides on the basis of phenotypic and genetic similarity among the strains (Ahmed and Hamada 2005; Tanovic et al. 2009). However, these studies are affected by environmental factors and more evaluation is needed to come to a conclusion. Even though, there is a vast literature on account of genetic diversity from different parts of the world, only a handful of studies from India and Nepal (Isenegger et al. 2008; Pande et al. 2010) have taken into account the diverse nature of this pathogen. Therefore, the aim of the present investigation was to (i) characterize the B. cinerea strains collected from India and Nepal on the basis of their morphological, biochemical, molecular and pathogenic traits; (ii) combine morphological and molecular data to generate a robust characterization of isolates associated with botrytis grey mould; (iii) determine the phylogenetic relationships among isolates of B. cinerea with respect to hosts, as well as geographic origin; and (iv) to analyze sensitivity of B. cinerea strains towards different classes of fungicides which are frequently used for the control of this species. The data provided by this study will be valuable to expand knowledge of the genetic variability among B. cinerea isolates and, ideally, will improve disease management practices by identifying sources of inoculum and isolate characteristics.

2. Materials and methods 2.1. Fungal sampling and initial species identification based on morphological features B. cinerea isolates were collected different regions of India and Nepal. The collection was made from different hosts in order to ensure its eclectic diversity (Table 1). Within a particular region sample sites were about 3 km apart. Isolates were recovered from different plant organs such as leaves, fruits and flowers. Small plant tissue pieces (∼2 cm) from lesions were surface sterilized in 1% sodium hypochlorite for 3 min followed by 70% ethanol treatment for 5 min. The host tissues were finally washed 3–4 times in autoclaved distilled water. All the washing steps were performed in laminar hood under aseptic conditions. The host tissues were inoculated onto potato dextrose agar (PDA) medium. Plates were incubated at 20 ◦ C for four days. Fungal samples were examined under the microscope to observe the characteristics of mycelial growth and conidiophores. Small hyaline spores or fungal hyphae were transferred to a fresh PDA plate. Regular sub-culturing of confirmed fungal colonies was performed. Pure cultures of B. cinerea were maintained on PDA slants and stored in 15% glycerol stocks at −20 ◦ C.

2.2. DNA extraction DNA was extracted from aerial mycelium of B. cinerea strains grown in 15 ml of potato dextrose broth (PDB) for 10 days at 20 ◦ C. The extraction was performed following the protocol of Das et al. (2009). The concentration of DNA was determined by measuring absorbance at 260 nm using a UV spectrophotometer. DNA pellets were dissolved in 50 ␮l of distilled water and stored at −20 ◦ C. 2.3. Confirmation of B. cinerea isolates by molecular methods Isolates identified on the basis of colony morphology and microscopic observations were subjected to molecular identification using B. cinerea specific primer pair C729+/729− (Riggotti et al. 2002) that amplify a 700 bp product. Master mix (25 ␮l) for PCR reaction contained 2 ␮l template (∼100 ng), 2 mM MgCl2 , 10 mM of each dNTP’s, 0.5 mM of each primer and 2.0 U of Taq polymerase. Template was denaturated at 94 ◦ C for 5 min followed by 35 cycles: denaturation at 94 ◦ C for 30 s, annealing at 48.5 ◦ C for 45 s, extension at 72 ◦ C for 1 min followed by a final extension of 7 min at 72 ◦ C. PCR products were resolved on 1% agarose in TAE buffer containing 10 mg/ml ethidium bromide. 2.4. Cultural and morphological studies Cultural characteristics (color and texture of colony) were distinguished on PDA medium after three days of incubation at 20 ◦ C. Sclerotia production and their arrangement were also observed. Conidial length and breadth were examined following Khazaeli et al. (2010). Length and width of 20 conidia from each isolate were measured at 100× magnification using Nikon Eclipse 80i microscope. 2.5. Detection of transposable elements: boty and flipper Isolates were tested for the presence or absence of transposable elements using primer pair BotySF (5 GAAGGCAAGATGCCTGTGCACACC3 ) and Boty-SR (5 GACAACACATTGTTCATAAGCCTCA3 ) for boty element. Primers were designed using Primer 3.0 software based on Genbank sequence (accession no. X81791). The primers used for detection of flipper element were F300 and F1550 developed by Levis et al. (1997). The reactions were prepared and conducted as explained in Section 2.3, except that for boty amplification annealing temperature was set to 55 ◦ C and for flipper to 44 ◦ C. Amplified products were resolved on 1% agarose containing 10 mg/ml ethidium bromide. 2.6. Mating type determination The distribution of two mating types (MAT1-1 and MAT1-2) was determined by using primers developed by van Kan et al. (2010). Each reaction contained 100 ng of DNA, 0.4 ␮M of each primer, 0.24 mM of dNTP’s each, 1.5 mM MgCl2 , 1× reaction buffer and 1 U Taq polymerase. PCR was performed using the following conditions; an initial denaturing step of 1 min at 94 ◦ C, 32 cycles: denaturation for 40 s at 94 ◦ C, annealing for 1 min 30 s at 58 ◦ C and extension for 1 min at 72 ◦ C; followed by final extension at 72 ◦ C for 10 min. Amplified products were resolved on 1% agarose containing 10 mg/ml ethidium bromide. 2.7. Random amplification of polymorphic DNA (RAPD) Genetic variability among isolates of B. cinerea was assessed by ˜ RAPD analyses using 23 decamers following Munoz et al. (2002) and Alfonso et al. (2000). Amplification reactions were performed




3

Table 1 List of isolates procured/collected from various geographical locations of India and Nepal. S. no.

Isolate

Research institute

BGMa -01 ICRISATa , Hyderabad 1 BGM-02 ICRISAT, Hyderabad 2 3 BGM-03 ICRISAT, Hyderabad 4 BGM-04 ICRISAT, Hyderabad BGM-05 ICRISAT, Hyderabad 5 6 BGM-06 ICRISAT, Hyderabad BGM-07 ICRISAT, Hyderabad 7 BGM-08 ICRISAT, Hyderabad 8 BGM-09 ICRISAT, Hyderabad 9 10 BGM-10 ICRISAT, Hyderabad BGM-11 ICRISAT, Hyderabad 11 BGM-12 ICRISAT, Hyderabad 12 BGM-13 ICRISAT, Hyderabad 13 BGM-14 ICRISAT, Hyderabad 14 BGM-15 ICRISAT, Hyderabad 15 BGM-16 ICRISAT, Hyderabad 16 BGM-17 ICRISAT, Hyderabad 17 BGM-18 ICRISAT, Hyderabad 18 BGM-19 ICRISAT, Hyderabad 19 BGM-20 ICRISAT, Hyderabad 20 21 BGM-21 ICRISAT, Hyderabad BGM-22 ICRISAT, Hyderabad 22 BGM-23 ICRISAT, Hyderabad 23 BGM-24 ICRISAT, Hyderabad 24 BGM-25 ICRISAT, Hyderabad 25 26 BGM-26 ICRISAT, Hyderabad BGM-27 ICRISAT, Hyderabad 27 28 BGM-28 ICRISAT, Hyderabad 29 BGM-29 ICRISAT, Hyderabad 30 BGM-30 ICRISAT, Hyderabad 31 BGM-31 ITCC, IARIa 32 BGM-32 ITCC,IARI 33 BGM-37 ITCC, IARI 34 BGM-38 G.B.P.Ua , Pantnagar 35 BGM-36 ARIa – Pune BGM-33 MTCCa , Chandigarh 36 BGM-34 MTCC, Chandigarh 37 38 BGM-35 MTCC, Chandigarh 39 BGM-39 MTCC, Chandigarh 40 BGM-40 MTCC, Chandigarh BGM-41 MTCC, Chandigarh 41 42 BGM-43 MTCC, Chandigarh Isolates collected from G.B.P.U. Pantnagar, India 43 BGM-45 – 44 BGM-49 – BGM-54 – 45 46 BGM-63 – BGM-69 – 47 BGM-70 – 48 BGM-47 – 49 BGM-58 – 50 BGM-73 – 51 BGM-57 – 52 BGM-72 – 53 BGM-76 – 54 BGM-48 – 55 BGM-55 – 56 BGM-59 – 57 BGM-66 – 58 BGM-46 – 59 BGM-50 – 60 BGM-79 – 61 BGM-62 – 62 BGM-71 – 63 BGM-78 – 64 Isolates collected from Katgodham, Uttarakhand, India 65. BGM-51 – BGM-56 – 66. BGM-67 – 67. BGM-68 – 68. BGM-74 – 69. 70. BGM-75 – BGM-77 – 71. BGM-80 – 72.

Host

Location/country

Geographical coordinates

Chickpea Lentil Chickpea Chickpea Marigold Chickpea Lentil Grass pea Chickpea Chickpea Lentil Lentil Chickpea Lentil Chickpea Chickpea Chickpea Chickpea Chickpea Chickpea Chickpea Chickpea Chickpea Chickpea Chickpea Chickpea Chickpea Chickpea Chickpea Chickpea Apple Strawberry Strawberry Chickpea – – – – – – – –

Barbidas, Nepal Lalbandi, Nepal Lalbandi, Nepal Nawalpur, Nepal Kathmandu, Nepal Rampur, Nepal Rampur, Nepal Rampur, Nepal Tarahara, Nepal Khajura, Nepal Kurbinpur, Nepal Khajura, Nepal Khumaltar, Nepal Khumaltar, Nepal Malda, India Bareilly, India Pantnagar, India Medinipur, India Kolkata, India Meerut, India Nautanwa, Nepal Barhani, Nepal Bhairahawa, Nepal Gardi, Nepal Birganj, Nepal Ludhiana, India Pantnagar, India Ludhiana, India Ludhiana, India Ludhiana, India – – – – – – – – – – – –

26◦ 58 N, 85◦ 54 E 27◦ 3 N, 85◦ 38 E 27◦ 3 N, 85◦ 38 E 27◦ 48 N, 85◦ 37 E 27◦ 42 N, 85◦ 20 E 27◦ 5 N, 86◦ 34 E 27◦ 5 N, 86◦ 34 E 27◦ 5 N, 86◦ 34 E 26 40 N, 87◦ 17 E 28◦ 1 N, 82◦ 1 E 28◦ 1 N, 82◦ 1 E 29◦ 1 N, 83◦ 1 E 27◦ 65 N, 85◦ 32 E 27◦ 65 N, 85◦ 32 E 24◦ 40 N, 88◦ 28 E 28◦ 57 N, 77◦ 45 E 28◦ 58 N, 79◦ 24 E 22◦ 87 N, 87◦ 32 E 22◦ 34 N, 88◦ 22 E 28◦ 21 N, 79◦ 24 E 26◦ 78 N, 85◦ 70 E 26◦ 50 N, 86◦ 47 E 26◦ 36 N, 87◦ 58 E 27◦ 49 N, 82◦ 88 E 27◦ 35 N, 84◦ 28 E 30◦ 54 N, 75◦ 51 E 28◦ 58 N, 79◦ 24 E 30◦ 54 N, 75◦ 51 E 30◦ 54 N, 75◦ 51 E 30◦ 54 N, 75◦ 51 E – – – – – – – – – – – –

Rose Chrysanthemum Marigold Marigold Rose Chrysanthemum Rose Chrysanthemum Marigold Rose Marigold Chrysanthemum Chrysanthemum Rose Rose Chickpea Rose Chrysanthemum Marigold Rose Marigold Rose

Farmer’s Guest house Farmer’s Guest house Farmer’s Guest house A.Ga . College A.G. College A.G. College Tarai bhawan Tarai bhawan Tarai bhawan International Guest house International Guest house International Guest house Quarter area Quarter area Farmer’s hostel Farmer’s hostel University library University library University library Gandhi auditorium Gandhi auditorium Golden Jubilee Hostel

28◦ 58 N, 79◦ 24 E 28◦ 58 N, 79◦ 24 E 28◦ 58 N, 79 24 E 28◦ 10 N, 78 24 E 28◦ 10 N, 78◦ 24 E 28◦ 10 N, 78◦ 24 E 28◦ 55 N, 79◦ 54 E 28◦ 55 N, 79◦ 54 E 28◦ 55 N, 79◦ 54 E 28◦ 65 N, 79◦ 12 E 28◦ 65 N, 79◦ 12 E 28◦ 65 N, 79◦ 12 E 28◦ 35 N, 78◦ 94 E 28◦ 35 N, 78◦ 94 E 29◦ 10 N, 79◦ 24 E 29◦ 10 N, 79◦ 24 E 28◦ 88 N, 79◦ 74 E 28◦ 88 N, 79◦ 74 E 28◦ 88 N, 79◦ 74 E 28◦ 10 N, 79◦ 94 E 28◦ 10 N, 79◦ 94 E 28◦ 88 N, 78◦ 94 E

Marigold Marigold Marigold Marigold Marigold Marigold Marigold Marigold

Post office Railway colony Himjoli Kumaon college of IT Inter college IT academy Gaula dam Railway crossing

29◦ 13 N, 79◦ 53 E 29◦ 23 N, 79◦ 57 E 29◦ 55 N, 79◦ 10 E 29◦ 53 N, 79◦ 85 E 29◦ 33 N, 80◦ 01 E 29◦ 13 N, 78◦ 99 E 29◦ 50 N, 79◦ 69 E 28◦ 99 N, 78◦ 53 E




4 Table 1 (Continued) S. no.

Isolate

Research institute

Isolates collected from Mota Haldi, Uttarakhand, India BGM-52 – 73. BGM-53 – 74. 75. BGM-60 – 76. BGM-61 – BGM-64 – 77. 78. BGM-65 – Isolate collected from Delhi, India as post-harvest pathogen BGM-81 – 79.

Host

Location/country

Geographical coordinates

Marigold Marigold Marigold Marigold Marigold Marigold

Railway crossing Haldwani bypass Naveen mandi Pilikothi road Sendiya Nursery Farm house

29◦ 01 N, 79◦ 51 E 29◦ 19 N, 79◦ 59 E 29◦ 99 N, 79◦ 71 E 29◦ 50 N, 79◦ 11 E 29◦ 48 N, 79◦ 42 E 29◦ 23 N, 79◦ 63 E

Strawberry

Delhi

28◦ 63 N, 77◦ 22 E

a BGM: Botrytis Grey Mould; ICRISAT: International Crops Research Institute for Semi-Arid Tropics, Patancheru, Hyderabad; ITCC, IARI: Indian Type Culture Collection Centre, Indian Agricultural Research Institute, New Delhi; G.B.P.U: Govind Ballabh Pant University, Pantnagar, Uttarakhand; ARI: Aghakar Research Institute, Pune; MTCC: Microbial Type Culture Collection and Gene Bank, Chandigarh; A.G. College: Agriculture College G.B.P.U.

in volume of 25 ␮l containing 100 ng of DNA, 0.4 ␮M of each primer, 0.24 mM of dNTP’s each, 1.5 mM MgCl2 , 1× reaction buffer and 1 U Taq polymerase. PCR reactions were performed in Eppendorf Thermal cycler with following conditions: one cycle at 95 ◦ C for 90 s, followed by 46 cycles at 95 ◦ C for 30 s, 36 ◦ C for 60 s and 72 ◦ C for 60 s; final extension for 7 min at 72 ◦ C followed by 15 ◦ C for 15 min. The amplicons were separated on 1.5% agarose in 1× TAE buffer and visualized under UV light after staining with ethidium bromide (10 mg/ml). A 100 bp ladder (Genei) was used as a molecular size standard for RAPD markers. Banding profile was scored ‘1 indicating the presence and ‘0 indicating the absence of a band to construct a binary qualitative data matrix. Pairwise comparison of genotypes was employed to calculate Jaccard’s similarity coefficient. A dendrogram was constructed using the unweighted pair group method with arithmetic average (UPGMA) and computation for multivariate analysis was done using the computer programme NTSYS-pc version 2.02e. Resolving power (Rp) of the primers i.e. the ability of a primer to distinguish between large numbers of genotypes was determined (Prevost and Wilkinson 1999). The polymorphism information content (PIC) expressing the discriminating power of the locus, taking into account not only the alleles that were expressed, but also relative frequencies and frequency of alleles per locus was calculated, expressed as: PIC = 1−Pi2 , where pi is the frequency of ith (presence) allele. 2.8. Biochemical studies Production and secretion of oxalic acid is associated with fungal pathogenesis and virulence. In order to check the variability in terms of production of oxalic acid (OA), isolates were grown in PDB for 10 days. Production of OA was quantified in the culture filtrate following Durman et al. (2005). The oxalic acid concentration was calculated by extrapolation from a standard curve and expressed as ␮g/ml. It is to be noted that secretion of cell wall degrading enzymes is favoured by acidic pH which is often associated with production of oxalic acid. Hence, variation in the pH was also determined in culture filtrates. For quantification of cell wall degrading enzymes, different isolates were grown in induction medium (0.5% polygalacturonic acid for polygalacturonase and 0.5% pectin for pectin methyl esterase) supplemented with appropriate substrates for either polygalacturonase or pectin methyl esterase assays for 10 days at 20 ◦ C. These culture filtrates were then used as enzyme extracts. 2.8.1. Polygalacturonase (PG) assay The polygalacturonase (PG) activity was determined spectrophotometrically using polygalacturonic acid as substrate enzyme extract (0.8 ml) was added to 2 ml of assay buffer (2 mg/ml polygalacturonic acid in 0.1 M citrate buffer, pH 5.0) and test tubes were incubated at 37 ◦ C for 1 h. To 1 ml of reaction mixture, 5.5 ml of phenol sulphuric acid reagent (PSA; 0.5 ml 80% phenol in 5 ml

sulphuric acid) was added. Absorbance was measured at 480 nm. One reducing group unit corresponded to 1 ␮M of reducing sugar liberated from substrate in 1 h at 37 ◦ C with a standard calibration curve obtained with galacturonic acid as reducing sugar. 2.8.2. Pectin methyl esterase (PME) assay Seven milliliters of assay buffer (10 mg/ml pectin in 0.02 M Tris–HCl buffer, pH 8.0) was added to 0.5 ml of enzyme extract. The pH of the reaction mixture was adjusted to 8.0 using 0.05 M NaOH. The reaction mixture was then incubated at 37 ◦ C in water bath for 1 h. After incubation the pH was checked and noted down as initial reading. Further, the pH was adjusted to 8.0 using titration against 0.02 N NaOH containing 5 mM sodium azide and noted down to bring back the initial pH of 8.0 as final reading. The amount of enzyme utilized was calculated as 1 ␮M/h NaOH to maintain the pH 8.0. Each biochemical assay was carried out in replicates of three and repeated twice. Induction media without fungal inoculation served as control. 2.9. Pathogenicity assay The pathogenicity of isolates was investigated on chickpea plants. Pathogenicity as say was carried out in growth chambers with Controlled Environmental Conditions at National Phytotron Facility, Indian Agricultural Research Institute (IARI), New Delhi. Five seedlings of susceptible chickpea (variety P-256) from preraised nursery were transferred to pots filled with autoclaved sand: vermiculite: peat (1:1:1) mixture. Plantlets were allowed to acclimatize for 24 h under controlled conditions. For inoculum preparation, each isolate was sub-cultured onto sucrose aided autoclaved marigold petals in test tubes and incubated for 10 days at 20 ◦ C. The test-tubes were flooded with sterile distilled water, vortexed vigorously and filtered through muslin cloth. The concentration of the conidial suspension of each isolate was estimated using haemocytometer (Neubauer Improved). Ten millilitres of spore suspension (1 × 105 conidia/ml) of different isolates of B. cinerea was spray inoculated on two week old chickpea seedlings. Plants sprayed with autoclaved double distilled water served as control. Pots were covered with transparent poly bag with a slit at one end in order to maintain high humidity along with aeration. In growth chamber, temperature was maintained at 18 ◦ C (night) – 22 ◦ C (day) with photoperiod of 10 h. Humidity was maintained at ∼90% with light intensity of 23,000 lux. Disease severity was calculated after 10 days. 2.10. Sensitivity to fungicides In vitro antifungal activity of five botryticides (fenhexamid, fluazinam, fludioxonil, carbendazim and thiram) was tested against




5

Fig. 1. Gel electrophoretic profile showing amplification for subset of isolates using specific primer pairs for C729+/− that amplify at 700 bp. (Numerals on the top of the gel represents the isolate number (BGM−); L: ladder). The position of amplified fragments is marked with arrow.

B. cinerea isolates. Plugs of mycelium of 6 mm diameter were inoculated onto PDA plates. After three days PDA plates were laden with sterile discs pre-soaked with varying concentrations of different fungicides (50, 100 and 200 ␮g/ml). One disc soaked with sterile water was placed onto each plate that served as control. Plates were incubated at 20 ◦ C for six days in the dark and zone of inhibition was measured to check the sensitivity of isolates towards different fungicides. All the tests were repeated twice.

3. Results 3.1. Generation of a collection of B. cinerea isolates from India and Nepal Isolates were collected from symptomatic plant tissue from different areas of India and Nepal (Table 1). Seventy-nine isolates were initially identified as B. cinerea on the basis of colony morphology and microscopic observations. Fungal colonies were initially white that turned grey on ageing. Hyphae were septate and hyaline bearing pseudo-dichotomously ramified conidiophores. Thereafter all 79 isolates were fully confirmed using B. cinerea specific primer pair C729+/729− and an expected amplicon of 700 bp was detected (Fig. 1) in all isolates.

3.2. Cultural and morphological variability studies B. cinerea isolates were categorized into two groups viz., mycelial and sclerotial on the basis of presence or absence of sclerotia formation under in vitro conditions. Thirty eight per cent of the isolates were mycelial type while sixty 2% produced sclerotia. Distribution of sclerotia also varied among isolates which included centrally placed large sclerotia, arranged in concentric rings, towards the periphery and sclerotia arranged irregularly (Fig. 2). Out of seventy nine isolates, no sclerotia formation was observed in 30 isolates. Sclerotia were found to be arranged in an irregular fashion in 28 isolates followed by sclerotia arranged in concentric rings in 11 isolates. Eight isolates showed centrally placed large sclerotial pattern and only two isolates had small sized sclerotia arranged on the periphery of the Petri plate. All the isolates demonstrated variation in their colony characteristics. Two distinct patterns of colony morphology were observed i.e. either cottony or matty. The length of conidia varied from 25.61 to 66.26 ␮m while breadth ranged from 12.89 to 34.34 ␮m. 3.3. Detection of transposable elements When the collection of isolates was considered as a whole the isolates were tested for presence or absence of transposable elements (TEs) using boty and flipper TE specific primers (Fig. 2A and

Fig. 2. Pattern of sclerotia distribution in different isolates of B. cinerea (A) sclerotia absent; (B) centrally placed large sclerotia; (C) sclerotia arranged in concentric rings; (D) sclerotia arranged on the periphery; (E) sclerotia arranged irregularly.


G Model

ARTICLE IN PRESS

MICRES-25664; No. of Pages 11

S. Kumari et al. / Microbiological Research xxx (2014) xxx–xxx

6

Table 2 Relative per cent distribution of MAT loci, molecular types and pathogenicity groups with respect to location. Location

North India East India Central Nepal South-east Nepal

MAT loci (%)

Molecular types (%)

Pathogenicity groups (%)

MAT1-1

MAT1-2

MAT1-1/2

None

B

F

T

V

H

M

L

34 0 43 75

40 100 43 17

13 0 14 8

13 0 0 0

27 0 100 34

31 33 0 58

27 0 0 0

15 67 0 8

67 0 0 17

15 0 0 25

18 100 100 58

(MAT: mating type; molecular types: B – only boty, F – only flipper, T – transposa and V – vacuma; pathogenicity groups: H – high, M – moderately and L – low.)

Table 3 Relative per cent distribution of MAT loci, molecular types and pathogenicity groups with respect to host. Host

Chickpea Marigold Rose Chrysanthemum Lentil Strawberry

MAT loci (%)

Molecular types (%)

Pathogenicity groups (%)

MAT1-1

MAT1-2

MAT1-1/2

None

B

F

T

V

H

M

L

52 34 45 50 0 33

44 34 11 33 80 67

4 14 22 0 20 0

0 14 22 17 0 0

16 29 45 33 0 0

60 19 33 17 80 100

8 33 22 17 0 0

16 19 0 33 20 0

12 81 89 50 0 34

12 14 11 50 20 33

76 5 0 0 80 33

(MAT: Mating type; Molecular types: B – only boty, F – only flipper, T – transposa and V – vacuma; Pathogenicity groups: H – high, M – moderately and L – low.)

B). Four molecular types were identified – transposa (containing both boty and flipper TE), boty (only boty TE), flipper (only flipper TE) and vacuma (lacking both boty and flipper TE). The frequencies of transposon distribution ranked from highest to lowest with boty (49%), transposa (23%), flipper (15%) and vacuma (13%). However, distribution of TEs presented characteristic features when investigated with respect to various hosts and location (Tables 2 and 3). Molecular types, flipper and transposa were absent in isolates collected from East India. 33% isolates contained boty and 67% were of vacuma type. Isolates from North India exhibited all molecular types (boty, 31%; flipper, 27%; transposa, 27% and vacuma, 15%). B. cinerea collected from Central Nepal constituted only boty molecular type, whereas, isolates from South East Nepal exhibited multiple molecular types with transposa (34%), boty (58%) and vacuma (8%). When analyzed according to host, isolates from chrysanthemum possessed transposa and vacuma (33%) as well as boty and flipper types in equal ratio (17%). Isolates from lentil did not possess flipper and transposa. However, 80% of the isolates constituted boty while only 20% possessed vacuma. All the isolates derived from strawberry belonged to boty molecular type. Isolates from rose were dominated by transposa type (45%); followed by boty (33%) and flipper (22%) whereas vacuma type was absent. 3.4. Mating type determination in B. cinerea population On amplifying MAT locus using specific primer pairs, a mixed population of heterothallic and homothallic isolates was found. In total, 39 isolates were MAT1-1 type, 38 isolates were MAT1-2 type while four contained MAT1-1/2 allele (Fig. 2C and D). Overall sampled population showed distribution of mating loci in ratio of 1:1; however, the ratio deviated when analyzed for sub-populations with respect to host and locations (Tables 2 and 3). When analyzed according to location, isolates collected from East India contained only MAT1-2 locus. MAT 1-1 and MAT 1-2 loci were equally distributed in the population from Central Nepal. In isolates collected from South-East Nepal, the number of MAT 1-1 containing population (75%) exceeded that of MAT 1-2 (17%) and MAT-1/2 (8%). This trend was, however, reverse in case of isolates from North India with higher number of population containing MAT1-2 loci. Fiftytwo percent of chickpea isolates displayed MAT1-1, 44% MAT1-2 loci and 4% showed the presence of both. In strawberry the population were dominated by MAT1-2 allele (67%) followed by MAT1-1 (33%). Marigold isolates showed almost equal distribution of MAT1-1 and

MAT1-2. Isolates sampled from rose demonstrated 45% MAT1-1, 11% MAT1-2 and 22% with both mating loci (Fig. 3).

3.5. Random amplification of polymorphic DNA RAPD analysis was carried out to evaluate the level of intraspecific variability among the 79 isolates of B. cinerea. The primers tested produced 80 polymorphic bands, ranging from 100 to 3000 bp in size. Each RAPD primer yielded 2–5 bands with an average of 3.48 bands per primer. The resolving power (Rp) of the primers ranged from 0.25 (OPC-12) to 0.67 (OPB-01) with an average of 0.45 per primer. Polymorphism information content for the primers ranged from 0.21 (OPB-06 and OPC-12) to 0.44 (OPB-01) with an average value of 0.32 per primer. Marker index value ranged from 0.05 (OPC-04 and OPC-12) to 0.22 (OPB-01) with an average value of 0.10 per primer (Table 4). A similarity matrix on simple matching co-efficients was calculated from the data based on the RAPD of all isolates. On the basis of the 23 primers used, similarity coefficient of pairwise comparison exhibited significant variations that ranged from 0.07 to 0.96. Maximum similarity index of 0.96 was observed for BGM 72 and BGM 73 suggesting high genetic similarity for isolates from same location. The matrix was used to construct a dendrogram using UPGMA tool of NTSYS for establishing to analyze the level of relatedness among the isolates. The resulting dendrogram derived from UPGMA analysis estimated two major groups (Fig. 4). One group comprised of six isolates (BGM76, 77, 78, 79, 80, 81); whereas another group includes all the other isolates taken in the study. Isolates also showed clustering according to location from four collection sites; North India, East India, Central Nepal and South-East Nepal (Fig. 4).

3.6. Biochemical studies The concentration of oxalic acid ranged from 25.7 to 81 ␮g/ml. Maximum concentration of oxalic acid was found in BGM-12 while minimum in BGM-61. The pH of culture filtrate varied from highly acidic to neutral (2.2–6.4). Concomitantly, the lytic enzyme activities also varied among the isolates. PG activity was maximum in BGM-51 (37.06 ␮M/h) and minimum in BGM-82 (14.5 ␮M/h). PME activity was highest in isolates BGM-47 and BGM-53 (0.56 ␮M/h) and lowest in BGM-27 (0.22 ␮M/h) (Fig. 5).




7

Fig. 3. Gel electrophoretic profile showing amplification for subset of isolates using specific primer pairs for (A) Boty (500 bp); (B) Flipper (1250 bp); (C) MAT1-1 (1100 bp); (D) MAT1-2 (1050 bp). (Numerals on the top of the gel represents the isolate number (BGM-); L: ladder.) The position of amplified fragments at respective base pairs is marked with arrows.

3.7. Sensitivity of B. cinerea isolates to fungicides Reaction of B. cinerea was tested against five botryticides. The most effective fungicide with respect to location was evaluated. Although all the isolates of a particular location did not follow a uniform trend for the most effective fungicide, however, some degree of correlation was noticed. Seventy eight per cent of isolates from North India were effectively inhibited by fluazinam and 73% with fenhexamid. The majority of isolates from East India were inhibited by fluazinam. On the other hand, carbendazim and thiram were highly effective on isolates from Central Nepal. Carbendazim alone proved to inhibit the mycelial growth of isolates from South-East Nepal (Fig. 6).

on chickpea, isolates were categorized into three groups: highly pathogenic (0–30%), moderately pathogenic (31–60%) and low pathogenic (61–100%). Relative distribution of pathogenic groups with respect to hosts and location was evaluated (Tables 2 and 3). Isolates from Central Nepal and East India belonged to low pathogenic group, whereas 58% of isolates from South-East Nepal were low pathogenic. Sixty-seven per cent isolates from North India belonged to high pathogenic group. Eighty nine per cent of rose isolates and 80% of lentil isolates were observed to be highly pathogenic. Seventy-six percent isolates from chickpea were low pathogenic while 81% isolates from marigold were highly pathogenic. In addition, chrysanthemum isolates were equally distributed under high and moderate pathogenic categories.

3.8. Pathogenicity assay

4. Discussion

All the isolates were pathogenic on chickpea plants. However, they showed variation in their pathogenic potential. Per cent disease ranged from 28 to 91% with maximum in BGM-61 and minimum in BGM-12. On the basis of their per cent disease infection

Phenotypic and genotypic diversity in B. cinerea isolates has been studied immensely from various locations around the world (Martinez et al. 2008; Isenegger et al. 2008; Kuzmanovska et al. 2012; Asadollahi et al. 2013). However, B. cinerea isolates from India




8

Table 4 Details of number of alleles amplified and number of polymorphic alleles with PIC, Rp and MI values analyzed after RAPD banding pattern. S. no.

Primer

TB

NP

PIC

Rp

MI

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23

OPA-15 OPB-06 OPC-04 OPC-12 OPE-11 OPG-14 OPG-18 OPI-08 OPI-12 OPR-02 OPW-04 OPX-19 OPB-01 OPB-03 OPB-04 OPB-05 OPB-08 OPB-10 OPB-13 OPB-15 OPB-18 OPB-20 OPD-02 Average(total)

4 3 5 4 3 4 3 3 3 3 4 3 2 3 4 4 4 3 3 4 4 4 3 3.48(80.00)

4 3 5 4 3 4 3 3 3 3 4 3 2 3 4 4 4 3 3 4 4 4 3 3.48(80.00)

0.23 0.16 0.24 0.15 0.33 0.24 0.23 0.30 0.41 0.23 0.27 0.20 0.42 0.38 0.22 0.36 0.33 0.35 0.41 0.36 0.18 0.29 0.41 0.29(6.70)

0.30 0.19 0.36 0.17 0.54 0.32 0.27 0.39 0.65 0.28 0.33 0.25 0.59 0.63 0.27 0.47 0.51 0.51 0.64 0.50 0.22 0.42 0.62 0.41(9.44)

0.06 0.05 0.05 0.04 0.11 0.06 0.08 0.10 0.14 0.08 0.07 0.07 0.21 0.13 0.05 0.09 0.08 0.12 0.14 0.09 0.05 0.07 0.14 0.09(2.05)

(TB: total number of bands; NB: number of polymorphic bands; PIC: polymorphism information content; MI: marker index; Rp: resolving power.)

and Nepal have been characterized only by Isenegger et al. (2008) and Pande et al. (2010). Their studies were restricted to small sample size and thus do not depict a complete picture of differentiation ˜ et al. 2002). This is the first study that in B. cinerea isolates (Munoz includes an ample collection of B. cinerea isolates from different areas as well as different hosts of India and Nepal. The identification of collected samples was confirmed at morphological and molecular level. A great diversity was observed among the isolates that were collected from the same geographical region. This feature has been previously reported, and has been ascribed to the presence of air borne conidia which due to being light weight disseminate to long distances, increase gene flow and thereby restrict geographical differentiation (Mirzaei et al. 2009). Morphological and cultural distinctions are indispensable features for differentiating the fungal isolates at the initial stage of isolate selection for variation studies. In present study, variation in terms of colony growth, color, sclerotia production and conidial measurements were observed. However, no specific pattern was observed between geographical origin and morphological groups. Transposable elements in B. cinerea population have been used as qualitative markers to study genetic diversity (Giraud et al. 1999; Daboussi and Capy 2003). Four molecular types were identified on the basis of distribution of transposable elements in B. cinerea isolates which has also been reported earlier (Fournier et al. 2005; ˜ et al. 2010). Our results on distribution Isenegger et al. 2008; Munoz frequency of four transposon types differed with that of Isenegger et al. (2008) which may be due to differences in the population size. Isolates from Central Nepal showed the presence of only boty element. When characterized according to host the strawberry isolates contained only flipper element. Isolates from molecular types (transposa and vacuma) from different host or regions showed no specialization with respect to host or location. We also carried out a correlation between the distribution of transposable elements and conidial dimensions. The conidial size was higher in transposa isolates as compared to vacuma isolates whereas the mean conidial lengths were equivalent in boty and flipper isolates. In general the results suggested that transposa populations have higher pathogenic potential as compared to vacuma isolates.

Sexual recombination may be a potentially significant factor in determining population dynamics, as it results in the generation of new genotypes and thus contributes to genetic diversity and evolutionary potential (Milgroom 1996; McDonald and Linde 2000). Insight into the MAT locus and the fundamental principles of the mating process can prompt new strategies for the control of B. cinerea. Mating type distribution in B. cinerea isolates from India and Nepal has not been investigated previously. The observations revealed heterothallism i.e. presence of either MAT1-1 or MAT1-2, in majority of the isolates. Also the distribution of allele followed 1:1 ratio that differed while comparing sub-populations from different hosts and locations, and is in accordance with previous reports (Faretra et al. 1988; Giraud et al. 1997; 1999). Wide distribution of two loci suggested possible occurrence of sexual recombination in fields indicating rapid evolution of this polyphageous pathogen according to changing environment. Analysis of B. cinerea population revealed genetic diversity within subpopulations. Based on the genetic similarities, 79 B. cinerea isolates showed some degree of clustering on the basis of locations and pathogenicity group. Primers used in the study provided a sufficient number of informative characters to construct cladograms and identified the relationship among the isolates. Four polymorphic bands were generated per RAPD primer on an average, implying frequent detection of polymorphism in B. cinerea population. Similar results were documented by Pande et al. (2010). A high genetic diversity was further supported by the variable banding pattern observed in RAPD analysis, none of the 23 primers tested showed common amplified product in sampled isolates. The study demonstrated that RAPD is an efficient and reliable tool for indexing genetic diversity on the basis of pathotype or location. The isolates were highly variable in the severity of the necrotic symptoms they induced in chickpea plants. The variation in pathogenic potential of sampled isolates ranged from 29 to 91%, suggesting the existence of broad pathogenic variability. The pathogenic behavior of the isolates was correlated with the distribution of transposable elements. In agreement with previous studies, transposa isolates were more pathogenic as compared to ˜ vacuma isolates (Pande et al. 2010; Samuel et al. 2012; Munoz




9

Fig. 4. Dendrogram generated for seventy nine B. cinerea isolates using UPGMA cluster analysis based on Jaccard’s similarity estimates. (Shaded isolates belonged to same location; H and L represent high and low pathogenic groups respectively.)

et al. 2010; Valiuˇskaite et al. 2010). There was no differentiation of pathogenic group on the basis of location. Deviation in aggressiveness of B. cinerea isolates is often a consequence of variation in cell wall degrading enzyme

activities and secretion of a potential pathogenicity factor – oxalic acid (Derckel et al. 1999). Higher oxalic acid accumulation is associated with higher virulence of the pathogen and vice versa (Lyon et al. 2004; Fernández Acero et al. 2011). Variation in oxalic acid


G Model MICRES-25664; No. of Pages 11 10


Fig. 5. Box plot graphs showing frequency distribution among B. cinerea isolates for: (A) oxalic acid; (B) pH; (C) polygalacturonase; (D) pectin methyl esterase.

Fig. 6. Sensitivity of B. cinerea towards different fungicides: BGM-70, BGM-15, BGM-05 and BGM-03 were selected as representative isolates from North India, East India, Central Nepal and South-east Nepal respectively.




production was also observed in our study. BGM-61 with maximum per cent disease severity displayed enhanced cell wall degrading enzyme activities and higher oxalic acid concentration. On the other hand, BGM-12 showed minimum per cent disease severity with reduced enzyme activities and secondary metabolite concentration. Thus, genotypic characters (different molecular types) along with pathogenicity factors (oxalic acid and cell wall degrading enzymes) play a crucial role for successful host–pathogen interaction. Using polyphasic approaches, marked diversity was observed in sampled isolates from India and Nepal. When isolates were characterized for their sensitivity towards different fungicides, isolates from different geographical location showed varied sensitivity (Leroux 2004). Some degree of grouping was observed with respect to a single location, although it was not rigid and deviated to some extent. No fungicides have been developed till date based on location or host preferences. Such studies can contribute in developing or devising a suitable control measure. Effective management of disease incidence can be achieved by applying fungicides in rotation with lesser chances of isolates to develop resistance. Acknowledgements We would like to thank Dr. Suresh Pande, International Crop Research Institute for Semi-Arid Tropics (ICRISAT), Hyderabad for providing B. cinerea cultures for the study. The authors would like to thank University Grants Commission and University of Delhi for fellowship and for research grants respectively. References Ahmed DB, Hamada W. Genetic diversity of some Tunisian Botrytis cinerea isolates using molecular markers. Phytopathol Mediterr 2005;44:300–6. Alfonso C, Raposo R, Melgarejo P. Genetic diversity in sarita Botrytis cinerea populations on vegetable crops in greenhouses in south-eastern Spain. Plant Pathol 2000;49:243–51. Asadollahi M, Fekete E, Karaffa L, Flipphi M, Árnyasi M, Esmaeili M, et al. Comparison of Botrytis cinerea populations isolated from two open-field cultivated host plants. Microbiol Res 2013;168:379–88. Beever RE, Weeds PL. Elad Y, Williamson B, Tudzynski P, Delen N, editors. Taxonomy and genetic variation of Botrytis and Botryotinia. New Zealand: Kluwer Academic Publishers; 2004. p. 29–52. Büttner P, Koch F, Voigt K, Quidde T, Risch S, Blaich R, et al. Variations in ploidy among isolates of Botrytis cinerea: implications for genetic and molecular analyses. Curr Genet 1994;25:445–50. Chardonnet CO, Sams CE, Trigiano RN, Conway WS. Variability of three isolates of Botrytis cinerea affects the inhibitory effects of calcium on this fungus. Phytopathology 2000;90:769–74. Daboussi MJ, Capy P. Transposable elements in filamentous fungi. Annu Rev Microbiol 2003;57:275–99. Das BK, Jena RC, Samal KC. Optimization of DNA isolation and PCR protocol for RAPD analysis of banana/plantain (Musa spp.). Int J Agri Sci 2009;1(2):21–5. Dean R, van Kan JAL, Pretorius ZA, Hammond-Kosack KE, Pirtro AD, Spanu PD, et al. The top 10 fungal pathogens in molecular plant pathology. Mol Plant Pathol 2012;13:414–30. Derckel JP, Baillieul F, Manteau S, Audran JC, Haye B, Lambert B, et al. Differential induction of grapevine defences by two strains of Botrytis cinerea. Phytopathology 1999;89:197–203. Diolez A, Marches F, Fortini D, Brygoo Y. Boty, a long-terminal-repeat retroelement in the phytopathogenic fungus Botrytis cinerea. Appl Environ Microbiol 1995;61(1):103–8. Durman SB, Menendez AB, Godeas AM. Variation in oxalic acid production and mycelial compatibility within field populations of Sclerotinia sclerotiorum. Soil Biol Biochem 2005;37:2180–4. Faretra F, Antonacci E, Pollastro S. Sexual behavior and mating system of Botryotinia fuckeriana, teleomorph of Botrytis cinerea. J Gen Microbiol 1988;134:2543–50. Fekete E, Fekete E, Irinyi L, Karaffa L, Árnyasi M, Asadollahi M, et al. Genetic diversity of a Botrytis cinerea cryptic species complex in Hungary. Microbiol Res 2011;167:283–91. Fernández Acero FJ, Carbú M, El-Akhal MR, Garrido C, González-Rodríguez VE, Cantoral JM. Development of proteomics-based fungicides: new strategies for environmentally friendly control of fungal plant diseases. Int J Mol Sci 2011;12:795–816. Fournier E, Giraud T, Loiseau A, Vautrain D, Estoup A, Solignac M. Characterization of nine polymorphic microsatelilite loci in the fungus Botrytis cinerea (Ascomycota). Mol Ecol Notes 2002;2:253–5.

11

Fournier E, Giraud T, Albertini C, Brygoo Y. Partition of the Botrytis cinerea complex in France using multiple gene genealogies. Mycologia 2005;97(6): 1251–67. Giraud T, Fortini D, Levis C, Lamarque C, Leroux P, LoBuglio K, et al. Two sibling species of the Botrytis cinerea complex, transposa and vacuma, are found in sympatry on numerous host plants. Ecol Population Biol 1999;89(10): 967–73. Giraud T, Fortini D, Levis C, Leroux P, Brygoo Y. RFLP markers show genetic recombination in Botryotinia fuckeliana (Botrytis cinerea) and transposable elements reveal two sympatric species. Mol Biol Evol 1997;14(11):1177–85. González G, Moya M, Sandoval C, Herrera R. Genetic diversity in Chilean strawberry (Fragaria chiloensis): differential response to Botrytis cinerea infection. Spanish J Agric Res 2009;7(40):886–95. Isenegger DA, Macleod WJ, Ford R, Taylor PWJ. Genotypic diversity and migration of clonal lineages of Botrytis cinerea from chickpea fields of Bangladesh inferred by microsatellite markers. Plant Pathol 2008;57:967–73. Karakaya A, Bayraktar H. Botrytis disease of kiwifruit in Turkey. Australasian Plant Dis Notes 2009;4:87–8. Kerssies A, Bosker-Van Zessen AI, Wagemakers CAM, Van Kan JAL. Variation in pathogenicity and DNA polymorphism among Botrytis cinerea isolates sampled inside and outside a glasshouse. Plant Dis 1997;81:781–6. Khazaeli P, Zamanizadeh H, Morid B, Bayat H. Morphological and molecular identification of Botrytis cinerea causal agent of gray mold in rose greenhouses in central regions of Iran. Int J Agric Sci Res 2010;1(1):19–24. Kuzmanovska B, Rusevski R, Jankuloski L, Jankulovska M, Ivic D, Bandzo K. Phenotypic and genetic characterization of Botrytis cinerea isolates from tomato. Genetika 2012;44(3):633–47. Leroux P. Elad Y, Williamson B, Tudzynski P, Delen N, editors. Chemical control of Botrytis and its resistance to chemical fungicides. New Zealand: Kluwer Academic Publishers; 2004. p. 95–217. Levis C, Fortini D, Brygoo Y. Flipper, a mobile Fot1-like transposable element in Botrytis cinerea. Mol Gen Genet 1997;254:674–80. Lyon GD, Goodman BA, Williamson B. Elad Y, Williamson B, Tudzynski P, et al., editors. Botrytis cinerea perturbs redox processes as an attack strategy in plants. New Zealand: Kluwer Academic Publishers; 2004. p. 119–41. Ma Z, Michailides TJ. Genetic structure of Botrytis cinerea population from different host plants in California. Plant Dis 2005;89:1083–9. Martinez F, Corio-costet MF, Levis C, Coarer M, Fermaud M. New PCR primers applied to characterize distribution of Botrytis cinerea population in French vineyards. Vitis 2008;47(4):217–26. McDonald BA, Linde C. Pathogen population genetics, evolutionary potential, and durable resistance. Annu Rev Phytopathol 2000;40:349–79. Milgroom MG. Recombination and the multilocus structure of fungal populations. Ann Rev Phytopathol 1996;34:457–77. Mirzaei S, Goltapeh EM, Shams-bakhsh M, Safaie N, Chaichi M. Genetic and phenotypic diversity among Botrytis cinerea isolates in Iran. J Phytopathol 2009;157:474–82. Moyano C, Alfonso C, Gallego J, Raposo R, Melgarejo P. Comparison of RAPD and AFLP marker analysis as a means to study the genetic structure of Botrytis cinerea populations. Eur J Plant Pathol 2003;109:515–22. ˜ Munoz G, Hinrichsen P, Brygoo Y, Giraud T. Genetic characterisation of Botrytis cinerea populations in Chile. Mycol Res 2002;106(5):594–601. ˜ Munoz G, Talquenca SG, Oriolani E, Combina M. Genetic characterization of grapevine-infecting Botrytis cinerea isolates from Argentina. Rev Iberoam Micol 2010;27(2):66–70. Pande S, Sharma M, Kishore GK, Shivram L, Mangala UN. Characterization of Botrytis cinerea isolates from chickpea: DNA polymorphisms, cultural, morphological and virulence characteristics. Afr J Biotechnol 2010;9(46):7961–7. Prevost A, Wilkinson MJ. A new system of comparing PCR primers applied to ISSR fingerprinting of potato cultivars. Theor Appl Genet 1999;98:107–12. Riggotti S, Gindro K, Richter H, Viret O. Characterization of molecular markers for specific and sensitive detection of Botrytis cinerea Pers.: Fr. in strawberry (Fragaria X ananassa Duch.) using PCR. FEMS Microbiol Lett 2002;209:169–74. Samuel S, Veloukas T, Papavasileiou A, Karaoglanidis GS. Differences in frequency of transposable elements presence in Botrytis cinerea population from several hosts in Greece. Plant Dis 2012;96(9):1286–90. Tanovic B, Delibasic G, Milivojevic J, Nikolic M. Characterization of Botrytis cinerea isolates from small fruits and grapevine in Serbia. Arch Biol Sci 2009;61(3):419–29. Tomlinson JA, Dickinson MJ, Boonham N. Detection of Botrytis cinerea by loopmediated isothermal amplification. Lett App Microbiol 2010;51:650–7. Valiuˇskaite A, Surviliene˙ E, Baniulis D. Genetic diversity and pathogenicity traits of Botrytis spp. isolated from horticultural hosts. Zˇ emdirbyste˙ Agric 2010;97(4):85–95. Van der Vlugt-Bergmans CJ, Brandwagt BF, Van’t Klooster JW, Wagemakers CAM, van Kan JAL. Genetic variation and segregation of DNA polymorphisms Botrytis cinerea. Mycol Res 1993;97(10):1193–200. Van der Vlugt-Bergmans CJB. Genetic variation and pathogenicity of Botrytis cinerea. Wageningen, Netherlands: University of Wageningen; 1996 (Ph.D. thesis). van Kan JAL, Duarte J, Dekkers E, Dyer PS, Kohn LM. The Botrytis cinerea mating type loci. In: XV International Botrytis Symposium; 2010. Williamson B, Tudzynski B, Tudzynski P, van Kan AL. Botrytis cinerea: the cause of grey mould disease. Mol Plant Pathol 2007;8(5):561–81. Yourman LF, Jeffers SN, Dean RA. Genetic analysis of isolates of Botrytis cinerea sensitive and resistance to benzimidazole and dicarboximide fungicides. Phytopathol 2000;90:851–9.


Novel hypovirulence-associated RNA mycovirus in the plant-pathogenic fungus Botrytis cinerea: molecular and biological characterization.

Resistance to fludioxonil in Botrytis cinerea isolates from blackberry and strawberry.

Proteomic profiling of Botrytis cinerea conidial germination.

Polygalacturonase of Botrytis cinerea E-200 Pers.

Efficiency of different strategies for gene silencing in Botrytis cinerea.

Redox systems in Botrytis cinerea: impact on development and virulence.

Antifungal effect of 405-nm light on Botrytis cinerea.

Isolate Dependency of Brassica rapa Resistance QTLs to Botrytis cinerea.

Genetic variability within and among Haemonchus contortus isolates from goats and sheep in China.

Morphological and pathogenic variability among Macrophomina phaseolina isolates associated with mungbean (Vigna radiata L.) Wilczek from Pakistan.

Molecular identification of Botrytis cinerea, Botrytis paeoniae and Botrytis pseudocinerea associated with gray mould disease in peonies (Paeonia lactiflora Pall.) in Southern Chile.

Function of small GTPase Rho3 in regulating growth, conidiation and virulence of Botrytis cinerea.

Genetic variability among Syphacia obvelata isolates from laboratory mice in four different geographical locations of China revealed by sequence analyses of five mitochondrial genes.

UVA Photoactivation of Harmol Enhances Its Antifungal Activity against the Phytopathogens Penicillium digitatum and Botrytis cinerea.

Effects of Bunch Rot (Botrytis cinerea) and Powdery Mildew (Erysiphe necator) Fungal Diseases on Wine Aroma.

Identification of glycoproteins secreted by wild-type Botrytis cinerea and by protein O-mannosyltransferase mutants.

Molecular characterisation and detection of resistance to succinate dehydrogenase inhibitor fungicides in Botryotinia fuckeliana (Botrytis cinerea).

Antigenic Relationships among Human Pathogenic Orientia tsutsugamushi Isolates from Thailand.

Genomic variability among globally distributed isolates of equine arteritis virus.

Effects of Two Salts Compounds on Mycelial Growth, Sporulation, and Spore Germination of Six Isolates of Botrytis cinerea in the Western North of Algeria.

Sequencing and transcriptional analysis of the biosynthesis gene cluster of abscisic acid-producing Botrytis cinerea.

Synthesis of linear Geranylphenols and their effect on mycelial growth of plant pathogen Botrytis cinerea.

Growth Simulation and Discrimination of Botrytis cinerea, Rhizopus stolonifer and Colletotrichum acutatum Using Hyperspectral Reflectance Imaging.

Functional analysis of BcBem1 and its interaction partners in Botrytis cinerea: impact on differentiation and virulence.