Analysis of Bacillus cereus toxicity using PCR, ELISA and a lateral flow device.

Journal of Applied Microbiology ISSN 1364-5072

ORIGINAL ARTICLE

Analysis of Bacillus cereus toxicity using PCR, ELISA and a lateral flow device S.M. Tallent, J.M. Hait and R.W. Bennett Food and Drug Administration, Center for Food Safety and Applied Nutrition, College Park, MD, USA

Keywords Bacillus cereus, detection, enterotoxigenic, food poisoning, food-borne illness. Correspondence Sandra M. Tallent, Food and Drug Administration, Center for Food Safety and Applied Nutrition, 5100 Paint Branch Parkway, College Park, MD 20740, USA. E-mail: [email protected] 2014/2288: received 7 November 2014, revised 10 December 2014 and accepted 14 January 2015 doi:10.1111/jam.12766

Abstract Aims: The aim of this study was to evaluate the performance of immunodetection methods and PCR analysis of enterotoxigenic Bacillus cereus strains. Methods and Results: Eighty-eight enterotoxigenic B. cereus group strains linked to food-borne outbreaks and illnesses were studied with 30 exclusivity nonenterotoxigenic strains including Bacillus amyoliquifaciens, Bacillus subtilis, Staphylococcus aureus, Salmonella and Escherichia coli for this assessment. The PCR results showed 80% agreement with immunoassays for the Nhe target and 84% for the Hbl product. All exclusivity strains were PCR and serologically negative. Conclusions: PCR has proven to be a valuable tool when used in conjunction with immunoassays to quickly identify enterotoxigenic B. cereus group strains. Significance and Impact of the Study: This study assessed the utility of rapid methods to characterize enterotoxigenic profiles of B. cereus group strains. The identification of enterotoxigenic bacteria and any associated toxins detected from food products is essential in food defense programs as public health officials search for methods to rapidly and accurately screen a global food supply.

Introduction Surveillance data provided by Center for Disease Control and Prevention (CDC) estimate 63,400 food-borne illnesses are associated with the Bacillus cereus group (Scallan et al. 2011). These spore-forming Gram-positive rods, which include B. cereus, Bacillus mycoides, Bacillus pseudomycoides, Bacillus thuringiensis, Bacillus weihenstephanensis and Bacillus anthracis are ubiquitous and have been detected in almost all food categories (Schraft and Griffiths 2006). Although in the U.S. illnesses associated with B. cereus infections rarely require hospitalization, (Scallan et al. 2011) several deaths have been associated toxins produced by B. cereus: cereulide (Mahler et al. 1997; Dierick et al. 2005; P osfay-Barbe et al. 2008) and cytolysin (Lund et al. 2000). Products vulnerable to B. cereus contamination include rice, pasta, milk, infant foods, meats, spices, fresh vegetables, seafood and ready to eat foods, posing challenges to the food industry. Protecting the food supply from these toxins requires 1068

effective monitoring for both the presence of the bacteria and the toxigenic potential of the strains cultured from the food. Current methodologies include plate enumeration from the suspicious food and ELISA if the food is identified as positive for B. cereus. This testing strategy is time consuming and limited to an immunoassay for a few enterotoxins produced by B. cereus and associated with food-borne illnesses. Food poisoning associated with B. cereus strains can take two different forms—a short-incubation emetic syndrome and one that requires a slightly longer incubation, the diarrhoeal syndrome. Emesis results from the consumption of cereulide, a preformed toxin that can survive heat, low pH and digestive enzymes. Cereulide is a cyclic dodecadepsipeptide, presumed to act as an ionophore causing disruption of oxidative phosphorylation in the mitochondria (Mahler et al. 1997). Vomiting occurs within a few hours after ingestion of cereulide contaminated food and symptoms usually resolve within 24–48 h; however, there have been reports of severe consequences

Journal of Applied Microbiology 118, 1068--1075. Published 2015. This article is a U.S. Government work and is in the public domain in the USA

Pathogenicity profiles of B. cereus strains

S.M. Tallent et al.

Table 1 Inclusivity strains investigated in this study, their source and demonstration of enterotoxins genes by PCR and immunoassay Strain identification Control F1383 Ba lichen ATCC 11778 Bace ATCC 14579 Bace Clinical F921486 stool R921456 clinic F921485 stool R921548 clinical F921484 stool R921587 clinical F921481 stool R921592 wound R921599 wound F921488 stool F921489 stool Environmental BGSC 6a1 BGSC 6A2 BGSC 6A3 BGSC 6A4 BGSC 6A8 BGSC 6A10 BGSC 6A15 BGSC 6A17 BGSC 6A18 BGSC 6A25 BGSC 6E1 BGSC 6G1 BGSC 6G2 BGSC 6G3 BGSC 6A9 Biocide Bathur karstaki Bathur kurnstaki dipel Bathur berliner dipel dust Food KL6006 M458 8A F4429/73 613 5B 15405 Netherlands 15405-1 15405-2 F-92 4029 chicken 36 M145 C-58 M-502 C59 H13 038-1

PCRi-Hbl

Duopathâ HblC

PCRi-Nhe

Tecra-Nhe

Duopathâ NheB

PCRi-ces

PCRi CytK

neg neg pos

neg neg pos

neg pos pos

neg pos pos

neg pos pos

neg neg neg

neg pos pos

neg neg pos pos neg pos neg pos pos neg neg

neg pos neg neg neg pos neg pos pos neg neg

pos pos pos pos pos pos pos pos pos pos pos



pos neg neg neg pos neg pos neg neg pos pos

neg pos neg pos neg pos neg neg pos neg neg

pos pos pos neg pos pos neg pos neg neg pos pos pos pos neg

pos pos pos pos pos pos neg pos neg neg pos pos pos pos neg

pos pos pos pos pos pos pos pos pos neg pos pos pos pos pos



neg neg neg neg neg neg neg neg neg neg neg neg neg neg neg

pos pos pos pos neg pos pos pos neg neg neg pos pos pos neg

pos pos pos

pos pos pos

neg neg neg

pos pos pos

pos pos pos

neg neg neg

pos pos pos

neg pos pos neg neg pos pos pos pos neg neg pos pos pos pos pos neg

neg pos pos neg neg pos pos pos pos neg neg neg pos neg pos pos pos

pos pos neg pos pos neg pos pos pos pos pos pos pos pos pos pos pos

pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos

pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos

pos neg neg neg neg neg neg neg neg pos neg neg neg neg neg neg neg

neg neg pos pos pos pos pos pos pos neg neg neg pos neg pos pos neg

(Continued)


1069


S.M. Tallent et al.

Table 1 (Continued) Strain identification TJL 16 TJL-9 2224 330 Netherlands Bath 992906 Bath Abbott #1 Bathur LBI-35 Bath ATCC 10792 Bath Bt1 Bath 1134 Bath 577 Bath BW CDC B4 AC cured 3998A 3998B 3998C 4227A 4227B 4227C 4230A 4230B 4230C Bace 126 F4810/72 BC3 F5881/94 BC22 RIVM BC379 BC229 1257 Bath 1264 1265 Bath 1258 1259 Bath 1260 1261 Bath 1262 1263 Bath 1266 1396 Bath 1397 Bath 1398

PCRi-Hbl

Duopathâ HblC

PCRi-Nhe

Tecra-Nhe

Duopathâ NheB

PCRi-ces

PCRi CytK

pos pos neg pos pos pos pos pos pos pos pos pos neg pos pos pos neg neg neg neg neg neg pos neg neg pos pos pos pos pos pos pos pos neg pos neg neg pos pos

pos pos pos pos neg pos pos pos pos pos pos pos neg pos pos pos neg neg neg neg neg neg pos neg neg neg pos pos pos pos pos pos neg neg neg pos neg pos neg

pos pos pos pos neg neg neg neg neg neg pos neg pos neg neg neg pos pos pos pos pos pos neg pos pos pos neg neg pos pos pos pos pos pos pos pos pos pos pos

pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos

pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos

neg neg neg neg neg neg neg neg neg neg neg neg pos neg neg neg pos pos pos pos pos pos neg pos pos pos neg neg neg neg neg neg neg neg neg neg neg neg neg

pos pos pos neg pos pos pos pos pos pos pos pos neg pos pos pos neg neg neg neg neg neg pos neg neg neg pos pos pos pos pos pos pos pos pos pos pos pos pos

Pos, indicates positive reaction; Neg, indicates negative reaction.

including liver failure and death as a result of cereulide intoxication (Mahler et al. 1997; Dierick et al. 2005; P osfay-Barge et al. 2008). The diarrhoeal syndrome is associated with consumption of the bacteria or spores that subsequently germinate producing enterotoxins in the intestine within 8–16 h; symptoms typically subside 12–14 h later (Granum and Lund 1997; Lund and Granum 1997; Schraft and Griffiths 2006). Two of the diarrhoeal enterotoxins are known to be tripartite proteins, hemolysin BL (Hbl) and nonhemolytic enterotoxin (Nhe); a third enterotoxin occurs as a single protein, cytolysin K (CytK). Cytolysin K has been associated with necrotic enteritis and a severe diarrhoeal outbreak that 1070

resulted in three deaths (Lund et al. 2000). The two tripartite enterotoxins, Hbl and Nhe, are most commonly linked to the B. cereus diarrhoeal syndrome (Schraft and Griffiths 2006). Formation of an active tripartite protein requires all three components, i.e. Hbl requires L2, L1 and binding protein B, while Nhe requires the presence of NheA, NheB and NheC. These components are not interchangeable (Granum et al. 1999). One of the immunological assays commonly used for Nhe detection is the Bacillus Diarrhoeal Enterotoxin Visual Immunoassay (BDE-VIATM) (3M Tecra, St. Paul, MN). This ELISA assay uses a double-sandwich enzyme immunoassay with detection limits of 2–5 ng ml1 of



S.M. Tallent et al.

Table 2 Exclusivity strains investigated in this study, their source and demonstration of enterotoxins genes by PCR and immunoassay

Strain No.

Genus/species

PCR: RNA/ diarrhoeal

Tecra

Duopathâ

872 176 177 178 179 180 181 182 183 BGSC 6A25 F1383 1267 1268 1269 1270 2136 2145 611 385 386 387 392 522 1403 1 249 336 626963-3 626963-57 626963-75

Acinetobacter sp. Bacillus amyloliquifaciens Bacillus amyloliquifaciens Bacillus amyloliquifaciens Bacillus amyloliquifaciens Bacillus amyloliquifaciens Bacillus amyloliquifaciens Bacillus amyloliquifaciens Bacillus amyloliquifaciens Bacillus cereus Bacillus licheniformis Bacillus subtilis Bacillus subtilis Bacillus subtilis Bacillus subtilis Citrobacter freundii Citrobacter koseri Enterobacter sakazakii Escherichia coli Escherichia coli Escherichia coli Escherichia coli Escherichia coli Listeria monocytogenes Salmonella enterica Salmonella enterica Salmonella enterica Staphylococcus aureus Staphylococcus aureus Staphylococcus aureus

pos/neg pos/neg pos/neg pos/neg pos/neg pos/neg pos/neg pos/neg pos/neg pos/neg pos/neg pos/neg pos/neg pos/neg pos/neg pos/neg pos/neg pos/neg pos/neg pos/neg pos/neg pos/neg pos/neg pos/neg pos/neg pos/neg pos/neg pos/neg pos/neg pos/neg

neg neg neg neg neg neg neg neg neg neg neg neg neg neg neg neg neg neg neg neg neg neg neg neg neg neg neg neg neg pos

neg/neg neg/neg neg/neg neg/neg neg/neg neg/neg neg/neg neg/neg neg/neg neg/neg neg/neg pos/pos pos/pos neg/neg neg/neg neg/neg neg/neg neg/neg neg/neg neg/neg neg/neg neg/neg neg/neg neg/neg neg/neg neg/neg neg/neg neg/neg neg/neg neg/neg

Repeat testing Tecra/Duopathâ

N/N/N N/N/N

Pos, indicates positive reaction; Neg or N, indicates negative reaction.

protein (Beecher and Wong 1994). The Duopathâ Cereus Enterotoxins (EMD Millipore, Darmstadt, Germany) assay is a lateral flow device (LFD) that detects both NheB and the L2 component of Hbl with a detection limit of 6 and 20 ng ml1, respectively (Krause et al. 2010). The BDE-VIATM uses polyclonal antibodies reacting with NheA and NheB components, whereas the Duopathâ uses monoclonal antibodies directed against NheB and Hbl L2 (Cueppens et al. 2012). There are other commercial kits such as the BCET-RPLA (Oxoid, Ltd., Basingstoke Hampshire, UK) available as a single assay for Hbl detection, but these kits are not evaluated in our study. Although methods to identify the cereulide include cell based assays and mass spectrometry, no commercial products have yet been developed for the detection of cereulide or CytK. We used previously designed multiplex primers that took into account polymorphisms and targeted two genes with a single set of primers (Ehling-Schulz et al. 2006) derived from four known enterotoxins including Hbl,

Nhe, CytK and the cereulide synthetase gene (ces) in a one-step method. Our objective was to process a select group of B. cereus strains along with other Bacillus spp. and known foodborne contaminants using the multiplex one-step PCR, enzyme-linked immunosorbent assay (ELISA), and a LFD to determine the most rapid and accurate method to detect enterotoxigenic Bacillus strains. The PCR results for Nhe were compared to BDE-VIATM and Duopathâ. Likewise, the PCR results for Hbl were compared to the Duopathâ. Mismatch results between PCR and immunoassay were further analyzed using a multiplex PCR with primers for individual gene components (Ngamwongsatit et al. 2008). Materials and methods The 118 bacterial strains used in this study had been submitted to Center for Food Safety and Nutrition (CFSAN) isolated from food, clinical samples or environmental


1071


S.M. Tallent et al.

Table 3 Primers (with assigned names or numbers) used in this study with product size, primer concentration and references

CesF1 CesR2 HD2F HA4R NA2F NB1R CKF2 CFR5 FHblC RHblC FHD RHD2 FHblA RHblA F2NheA RNheA F2NheB RNheB FNheC R2NheC

Gene target

Sequence (50 to 30 )

Product size (bp)

Primer concentration (lmol l1)

References

ces

GGTGACACATTATCATATAAGGTG GTAAGCGAACCTGTCTGTAACAACA GTAAATTAIGATGAICAATTTC AGAATAGGCATTCATAGATT AAGCIGCTCTTCGIATTC ITIGTTGAAATAAGCTGTGG ACAGATATCGGICAAAATGC CAAGTIACTTGACCOGTTGC CCTATCAATACTCTCGCAA TTTCCTTTGTTTATACGTCGC GAAACAGGGTCTCATATTCT CTGCATCTTTATGAATATCA GCAAAATCCTATGAATCGGTA GCATCTGTTCGTAATGTTTT TAAGGAGGGGCAAAACAGAAG TGAATGCGAAGAGCTGCTGCTTC CAAGCTCCAGTTCATGCGG GATCCCATTGTGTACCATTG ACATCCTTTTGCAGCAGAAC CCACCAGCAATGACCATATC

1271

02

Ehling-Schulz

1091

01

Ehling-Schulz

766

03

Ehling-Schulz

421

04

Ehling-Schulz

695

04

Ngamwongsatit

1018

04

Ngamwongsatit

884

04

Ngamwongsatit

759

02

Ngamwongsatit

935

02

Ngamwongsatit

618

02

Ngamwongsatit

hblD-hblA nheA-nheB cytK hblC hblD hblA nheA nheB nheC

Table 4 Discrepant one-step PCR and Duopathâ Hbl results compared to individual component PCR assay

Strain name

PCRi-Hbl

Duopathâ HblC (L2)

HblD

HblA

HblC

F1383 Ba lichen ATCC 11778 Bace ATCC 14579 Bace BGSC 6A4 R921456 038-1 2224 Bath 1266 F921485 stool R921548 clinical M145 M502 Bath 992906 Bath 1398 RIVM BC379 BC229 1261 1263

neg neg pos neg neg neg neg neg pos pos pos pos pos pos pos pos pos

neg neg pos pos pos pos pos pos neg neg neg neg neg neg neg neg neg

neg neg pos pos pos pos pos pos neg pos pos pos pos pos neg neg neg



samples associated with food-borne illness (Table 1, Table 2). Eighty-eight strains from this collection had previously been identified as members of the B. cereus group. The 30 exclusivity strains from this collection included Escherichia coli, Staphylococcus aureus, Citrobacter sp., Enterobacter sp., Salmonella sp., Bacillus amyloliquifaciens, Bacillus subtilis, Bacillus licheniformis, Acinetobacter sp., and Listeria sp. The strains were preserved in nutrient 1072

broth with glycerol and maintained at 80°C. Each strain was retrieved from storage, transferred twice to tryptic soy agar (TSA) and incubated overnight. B. cereus strains were incubated at 30°C and all other strains were incubated at 37°C. One colony from each culture was transferred to Brain Heart Infusion broth containing 01% glucose (BHIG), incubated overnight, then centrifuged at 12,000 g for 15 min to pellet the cells. The cell-free supernatant was used to test immunological assays and DNA was extracted from each pellet for use in PCR amplification. The cell-free supernatant for each strain was tested using the immunological assays BDE-VIATM and Duopathâ as directed by the manufacturer’s instructions except BHIG was used instead of the casein hydrolysate yeast extract broth with 1% glucose (CYG) that had been recommended for the Duopathâ kit. Total DNA was extracted from cell pellets using the UltraClean Microbial DNA isolation kit (MoBio, Carlsbad, CA). The primers for multiplex PCR reactions (Table 3) were purchased from Integrated DNA Technologies (IDT) (Coralville, IA) and used with conditions as described (Ehling-Schulz et al. 2006; Ngamwongsatit et al. 2008). Briefly, the initial multiplex PCR is a onestep method to screen for four toxins associated with Bacillus sp. The method allowed us to select isolates positive for one of the four toxins. The reaction tubes contained HotStar DNA Polymerase (Qiagen, Germantown, MD) (1 unit DNA polymerase, 15 mmol l1 MgCl2 and 02 mmol l1 each dNTP) mixed in 50 ll reactions with



S.M. Tallent et al.

Table 5 Discrepant one-step PCR, Tecra, and Duopathâ Nhe results compared to individual component PCR assay Strain identification

PCRi-Nhe

Tecra-Nhe

Duopathâ NheB

Nheb

NheA

NheC

F1383 Ba lichen ATCC 11778 Bace ATCC 14579 Bace 8A 5B Bath karstaki Bath 992906 Bath kurnstaki dipel Bath Abbott #1 Bath LBI-35 Bath berliner dipel dust Bath ATCC 10792 Bath Bt1 Bath 1134 Bath BW CDC 3998A 3998B 3998C 126

neg pos pos neg neg neg neg neg neg neg neg neg neg neg neg neg neg neg neg

neg pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos pos





the four primer sets with final concentrations as follows: 00002 mmol l1 of CesF1 and CesR2; 0001 mmol l1 of HD2F and HA4R; 00003 mmol l1 of NA2F and NB1R; 00004 mmol l1 CKF2 and CFR5 and DNA extracted from cell pellets. Primers designed to amplify individual components of the diarrhoeal enterotoxins (Ngamwongsatit et al. 2008) were used in cases of disagreement between the one-step PCR and immunological assays. The reaction tubes contained HotStar DNA Polymerase as described above in 20 ll reactions with three primers sets (00004 mmol l1 each) for the Hbl gene targets and three primer sets (00002 mmol l1 each) for the Nhe gene targets. The amplified products were resolved by electrophoresis on a 2% agarose gel. Positive controls included 4227A isolated from macaroni and cheese carrying Nhe and ces genes as well as an American Type Culture Collection (ATCC) (Manassas, VA) strain ATCC14579 positive for Nhe, Hbl and CytK. Bacillus licheniformis (F1383) was included as the negative control. Results The 88 inclusivity isolates screened with PCR included three ATCC strains, 11 clinical strains, 18 environmental strains including several biopesticide strains, and 56 strains isolated from foods associated with food-borne illnesses. The majority of inclusivity strains tested positive according to the initial PCR: 68/88 (77%) for the Nhe gene product, 56/88 (64%) strains testing positive for the Hbl gene target, and 57/88 (65%) positive for the CytK gene product. A total of 73/88 (83%) of the strains tested

were enterotoxigenic: 47/88 (53%) were positive for both Hbl and Nhe; 26/88 (30%) strains were positive for Nhe and negative for Hbl (Table 1). A small number of inclusivity strains 17/88 (19%) were positive for the ces gene product associated with the emetic toxin. All exclusivity strains were PCR negative for all target genes with the exception of an rRNA gene that served as an internal control (Table 2). The initial PCR indicated that all the clinical strains were toxigenic: 11/11 were positive for Nhe; 5/11 (45%) positive for Hbl, 4/11 (36%) for CytK and 6/11 (55%) for emetic toxin. The environmental strains carried genes to encode enterotoxins as follows: 12/18 (67%) of which were positive for Hbl; 10/18 (55%) positive for Nhe; 13/ 18 (72%) positive for CytK. None of the environmental isolates carried the ces gene target for the emetic toxin. The three biopesticide strains were positive for Hbl and CytK, but negative for Nhe (Table 1). An attempt to resolve mismatch results between PCR and immunoassays was made using a second PCR method with primers designed to amplify individual gene components (Ngamwongsatit et al. 2008). There were 14/ 88 (16%) strains with mismatched Hbl results. The Hbl genes from 5/14 (36%) strains were detected in both PCR assays, but the LFD was negative. The initial PCR for Hbl from 3/14 (21%) strains was positive, but individual component PCR and LFD were negative. Finally, the initial PCR for Hbl from 5/14 (36%) strains was negative with individual component PCR and LFD positive (Table 4). Mismatched results for Nhe revealed 16/88 (18%) B. cereus strains with negative initial PCR results;


1073


S.M. Tallent et al.

however, all three genes were detected in the second PCR and both immunoassays were positive (Table 5). A comparison of the PCR results for Nhe using LFD and ELISA showed 70/88 (80%) with all three tests in agreement. Results of PCR and LFD for Hbl were in agreement with 74/88 (84%) using this strain collection.

should include a rapid immunoassay such as the LFD in addition to a multiplex PCR method which detects gene targets that cannot otherwise be detected such as CytK and the emetic toxin.

Discussion

We are grateful for the assistance of Lili Velez, Ph.D. for her review of this manuscript.

Our detection rates were similar to other published strain analyses: the detection of Nhe ranged between 73–100% and Hbl between 42–85% (Rusul and Yaacob 1995; Hansen and Hendriksen 2001; Guinebretiere et al. 2002; Thaenthanee et al. 2005; Moravek et al. 2006; EhlingSchulz et al. 2006; Ngamwongsatit et al. 2008; Krause et al. 2010). Our study also demonstrated similar rates of detection and amplification for the total CytK gene, seen in earlier research (Guinebretiere et al. 2002; EhlingSchulz et al. 2006), identifying the gene in 28–53% of B. cereus group strains. Fourteen strains showed discrepancies between the one-step PCR and Duopathâ immunoassay for Hbl. Six of these strains were positive using both PCR methods, but negative using the LFD indicating the level of enterotoxin was less than the detectable immunoassay range (20 ng ml1) (Krause et al. 2010). The remaining strains with mismatched results indicate the genetic variability in the B. cereus group strains (Table 4). Both of the immunological assays for Nhe found 86/88 (98%) strains to be positive, but the one-step PCR detected only 68/88 (77%) as Nhe positive (Table 5). These discrepancies are presumably due to genetic variations within the region of interest since the amplification of individual gene targets revealed the presence of all three targets. The use of PCR or an immunoassay is not absolute confirmation of toxicity since the PCR method does not verify gene expression and the immunoassay uses one antibody to predict the expression of one component of a tripartite functional protein. However, even given these constraints, enterotoxin detection using one of these immunoassays shows good correlation with food poisoning (Cueppens et al. 2012) demonstrating that a presence/ absence test such as a multiplex PCR can prove useful in strain characterization as a tool to predict enterotoxigenicity. In conclusion, toxin detection using the one-step PCR method showed Nhe, Hbl, CytK and ces were positive 77%, 64%, 65%, 19%, respectively, using our collection of inclusivity strains. The one step PCR did not detect 16 strains that were Nhe positive and 10 strains that were Hbl positive. The most rapid and accurate methods to determine enterotoxigenic potential of Bacillus strains 1074

Acknowledgement

Conflict of Interest No conflict of interest declared. Mentions of trade names or commercial products in the article are solely for providing scientific information and do not imply recommendation or endorsement by the U. S. Food and Drug Administration. References Beecher, J.D. and Wong, A.C. (1994) Identification and analysis of the antigens detected by two commercial Bacillus cereus diarrheal enterotoxin immunoassay kits. Appl Environ Microbiol 60, 4614–4616. Cueppens, S., Rajkovic, A., Hamelink, S., Van de Wiele, T., Boon, N. and Uyttendaele, M. (2012) Enterotoxin production by Bacillus cereus under gastrointestinal conditions and their immunological detection by commercially available kits. Foodborne Pathog Dis 9, 1130–1136. Dierick, K., Van Coillie, E., Swiecicka, I., Meyfroidt, G., Devlieger, H., Meulemans, A., Hoedemaekers, G., Fourie, L. et al. (2005) Fatal family outbreak of Bacillus cereusassociated food poisoning. J Clin Microbiol 43, 4277–4279. Ehling-Schulz, M., Guinebretiere, M., Monthan, A., Berge, O., Fricker, M. and Svensson, B. (2006) Toxin gene profiling of enterotoxic and emetic Bacillus cereus. FEMS Microbiol Lett 260, 232–240. Granum, P.E. and Lund, T. (1997) Bacillus cereus and its food poisoning toxins. FEMS Microbiol Lett 157, 223–228. Granum, P.E., O’Sullivan, K. and Lund, T. (1999) The sequence of non-haemolytic enterotoxin operon from Bacillus cereus. FEMS Microbiol Lett 177, 223–229. Guinebretiere, M.-H., Broussolle, V. and Nguyen-The, C. (2002) Enterotoxigenic profiles of food-poisoning and food-borne Bacillus cereus strains. J Clin Microbiol 40, 3053–3056. Hansen, B.M. and Hendriksen, N.B. (2001) Detection of enterotoxin Bacillus cereus and Bacillus thuringiensis strains by PCR analysis. Appl Environ Microbiol 67, 185–189. Krause, N., Moravek, M., Dietrich, R., Wehrle, E., Slaghuis, J. and M€artlbauer, E. (2010) Performance characteristics of the Duopathâ Cereus Enterotoxins assay for rapid detection of enterotoxinogenic Bacillus cereus strains. Int J Food Microbiol 144, 322–326.


S.M. Tallent et al.

Lund, T. and Granum, P.E. (1997) Comparison of biological effect of the two different enterotoxin complexes isolated from three different strains of Bacillus cereus. Microbiology 143, 3329–3336. Lund, T., De Buyser, M.L. and Granum, P.E. (2000) A new cytotoxin from Bacillus cereus that may cause necrotic enteritis. Mol Microbiol 38, 254–261. Mahler, H., Pasi, A., Kramer, J.M., Schulte, P., Scoging, A.C., Bar, W. and Kr€ahenb€ uhl, S. (1997) Fulminant liver failure in association with the emetic toxin of Bacillus cereus. N Engl J Med 336, 1142–1148. Moravek, M., Dietrich, R., Buerk, C., Broussolle, V., Guinebretiere, M.-H., Granum, P.E., Nguyen-The, C. and M€artlbauer, E. (2006) Determination of the toxic potential of Bacillus cereus isolates by quantitative enterotoxin analyses. FEMS Microbiol Lett 257, 293–298. Ngamwongsatit, P., Buasri, W., Pianariyanon, P., Pulsrikarn, C., Ohba, M., Assavanig, A. and Panbangred, W. (2008) Broad distribution of enterotoxin genes (hblCDA, nheABC, cytK, and entFM) among Bacillus thuringiensis and Bacillus cereus as shown by novel primers. Int J Food Microbiol 121, 352–356.


P osfay-Barbe, K.M., Schrenzel, J., Frey, J., Studer, R., Korff, C., Belli, D.C. and Parvex, P. (2008) Food poisoning as a cause of acute liver failure. Pediatr Infect Dis J 27, 846– 847. Rusul, G. and Yaacob, N.H. (1995) Prevalence of Bacillus cereus in selected foods and detection of enterotoxin using TECRA-VIA and BCET-RPLA. Int J Food Microbiol 25, 131–139. Scallan, E., Hoekstra, R.M., Angulo, F.J., Tauxe, R.V., Widdowson, M.A., Roy, S.L., Jones, J.L. and Griffin, P.M. (2011) Foodborne Illness Acquired in the United States – Major Pathogens. Emerg Infect Dis. 17, 7–15. Schraft, H. and Griffiths, M.W. (2006) Bacillus cereus gastroenteritis. In Foodborne Infections and Intoxications, 3rd edn ed. Riemann, H.P. and Cliver, D.O. pp. 563–577. New York, NY: Academic Press. Thaenthanee, S., Lee Wong, A.C. and Watanalai, P. (2005) Phenotypic and genotypic comparisons reveal a broad distribution and heterogeneity of hemolysin BL genes among Bacillus cereus isolates. Int J Food Microbiol 105, 203–212.


1075

Copyright of Journal of Applied Microbiology is the property of Wiley-Blackwell and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.

Comparative analysis of 23S ribosomal RNA gene sequences of Bacillus anthracis and emetic Bacillus cereus determined by PCR-direct sequencing.

Sensitive genotyping of mutations in the EGFR gene from NSCLC patients using PCR-GoldMag lateral flow device.

Central Venous Access Device-Related Bacillus Cereus Endocarditis: A Case Report and Review of the Literature.

Diagnostic accuracy of a novel lateral-flow device in invasive aspergillosis: a meta-analysis.

Bacillus cereus wound infections.

A novel multiplex PCR discriminates Bacillus anthracis and its genetically related strains from other Bacillus cereus group species.

Bacillus cereus endogenous panophthalmitis.

Beta-lactamase (Bacillus cereus).

Simultaneous detection of nucleic acid and protein using gold nanoparticles and lateral flow device.

A case of Bacillus cereus bacteraemia.

Continuous flow real-time PCR device using multi-channel fluorescence excitation and detection.

Apolipoprotein E genotyping using PCR-GoldMag lateral flow assay and its clinical applications.

Identity of hemolysins produced by Bacillus thuringiensis and Bacillus cereus.

Differentiation of Bacillus anthracis from Bacillus cereus by gas chromatographic whole-cell fatty acid analysis.

Analytical methods for Bacillus cereus and other Bacillus species.

Sub-emetic toxicity of Bacillus cereus toxin cereulide on cultured human enterocyte-like Caco-2 cells.

Bacillus cereus Response to a Proanthocyanidin Trimer, a Transcriptional and Functional Analysis.

Properties of Bacillus cereus spore coat mutants.

Membrane-bound nucleotidase of Bacillus cereus.

Purification of an enterotoxin produced by Bacillus cereus by immunoaffinity chromatography using a monoclonal antibody.

Enterotoxigenic profiling of emetic toxin- and enterotoxin-producing Bacillus cereus, Isolated from food, environmental, and clinical samples by multiplex PCR.

Protease associated with spores of Bacillus cereus.

Psychrotrophic strains of Bacillus cereus producing enterotoxin.

Murine model of Bacillus cereus gastrointestinal infection.