Urologic Oncology: Seminars and Original Investigations 33 (2015) 22.e11–22.e21
Original article
Annexin A2 in renal cell carcinoma: Expression, function, and prognostic significance Shun-Fa Yang, Ph.D.a,b,1, Han-Lin Hsu, M.D.c,1, Tai-Kuang Chao, M.D.d, Chia-Jung Hsiao, B.Sc.e, Yung-Feng Lin, Ph.D.f, Chao-Wen Cheng, Ph.D.e,g,* a
Institute of Medicine, Chung Shan Medical University, Taichung, Taiwan Department of Medical Research, Chung Shan Medical University Hospital, Taichung, Taiwan c Department of Internal Medicine, Taipei Medical University-Wan Fang Hospital, Taipei, Taiwan d Department of Pathology, Tri-Service General Hospital, Taipei, Taiwan e Graduate Institute of Clinical Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan f School of Medical Laboratory Sciences and Biotechnology, College of Medical Science and Technology, Taipei Medical University, Taipei, Taiwan g Graduate Institute of Medical Sciences, National Defense Medical Center, Taipei, Taiwan b
Received 31 July 2014; received in revised form 28 August 2014; accepted 29 August 2014
Abstract Objective: Renal cell carcinoma (RCC) is the most lethal genitourinary cancer and intrinsically resistant to chemotherapy, radiotherapy, and hormone therapy. Annexin A2 (Anxa2) is a calcium-dependent phospholipid-binding protein found on various cell types that plays multiple roles in regulating cellular functions. In RCC, Anxa2 expression was correlated with tumor differentiation, clinical outcomes, and the metastatic potential; however, the underlying mechanisms remain obscure. This study investigated the role of Anxa2 in regulating tumorigenesis of RCC. Materials and methods: Commercial RCC tissue microarray arrays and a kidney cancer quantitative polymerase chain reaction array were used to examine Anxa2 by immunohistochemistry and real-time polymerase chain reaction analysis. Short hairpin (sh)RNA–based lentiviral system technology was used to evaluate the effects of manipulating Anxa2 expression on multiple malignant features of 2 RCC cell lines, A498 and 786-O, and its mechanisms. Results: (1) The Anxa2 expression level was generally elevated to varying degrees in RCC tissues. In adjacent noncancerous tissues, Anxa2 was mainly expressed in glomeruli and slightly expressed in the cytoplasm of proximal tubules. (2) An increased Anxa2 expression level was found in tissues of clear cell RCC, papillary RCC, and chromophobe RCC, and it was prominently expressed in cancer cell membranes. In addition, the Anxa2 expression level was correlated with poor prognosis. (3) Silencing Anxa2 expression suppressed the abilities of cell migration and invasion, but cell proliferation was less affected. (4) Diminished Anxa2 expression caused alterations in the cell polarity, disrupted the formation of actin filaments, and reduced CXCR4 expression. (5) Inhibition of the Rho/Rock axis restored silencing of Anxa2-mediated suppression of cell motility. Conclusions: Overall, our study points out the regulatory function of Anxa2 in RCC cell motility and provides a molecular-based mechanism of Anxa2 positivity in the progression of RCC. r 2014 Elsevier Inc. All rights reserved.
Keywords: Actin cytoskeleton; Annexin A2; Cell motility; Rho GTPase; Metastasis
This work was supported by a Grant from Taipei Medical University and Wan Fang Hospital (102TMU-WFH-03) and was partly supported by Grants from the National Science Council (NSC101-2320-B-038-006 and NSC102-2320-B-038-020-MY2), Taiwan. 1 These authors contributed equally to this work. * Corresponding author. Tel.: þ886-2-273-61661, ext: 3236; fax: þ8862-273-90500. E-mail address: [email protected] (C.-W. Cheng). http://dx.doi.org/10.1016/j.urolonc.2014.08.015 1078-1439/r 2014 Elsevier Inc. All rights reserved.
1. Introduction Renal cell carcinoma (RCC) is the most lethal genitourinary cancer and comprises a group of tumor types including clear cell RCC (ccRCC), papillary RCC (PRCC), and chromophobe RCC that originate from the epithelium of renal tubules [1,2]. RCC is generally resistant to
22.e12
S.-F. Yang et al. / Urologic Oncology: Seminars and Original Investigations 33 (2015) 22.e11–22.e21
chemotherapy, radiotherapy, and hormone therapy. The median survival time of metastatic patients is only 8 months, and the 5-year survival rate is o10% [3]. Therefore, understanding the underlying pathogenic mechanisms of RCC is needed to improve therapeutic applications and clinical molecular diagnoses. Contrary to other organs, where ischemia results in permanent cell loss, the kidneys, which may experience severe damage induced by acute kidney injury (AKI), have the ability to completely restore their structure and function [4]. The phenomena present similar outcomes of RCC in the presence of large numbers of proliferating renal tubular cells in the regeneration stage. This model with precise separation into different stages can provide key information of these intensively proliferating tubular cells, thus reproducing certain aspects of RCC carcinogenesis [5,6]. In our previous study, annexin A2 (Anxa2) was modulated in a temporal pattern concomitant with the initiation of and recovery from AKI, and it was possibly involved in the regulation of tubular cell proliferation and regeneration in the recovery process of nephrotoxic and ischemia/reperfusion–induced AKI [5]. Anxa2 is a calciumdependent phospholipid-binding protein expressed by many different cell types. It was suggested that Anxa2 shows distinct biochemical properties as a monomer and as a heterotetrameric complex with the plasminogen receptor protein S100A10 in many cellular processes, including exocytosis, endocytosis, membrane organization, ion channel conductance, and cytoskeletal remodeling (critically reviewed in Refs. [7,8]). Increased expression of Anxa2 was reported in many different malignancies, including those of the breast, kidney, liver, ovary, and pancreas [9–15]. In addition to promoting tumor growth, it may also participate in cancer metastasis by modulating cancer cell migration, invasion, and adhesion processes [16]. Although Anxa2 expression was reported to be correlated with tumor differentiation and clinical outcomes in RCC [10,11], its role in RCC progression remains largely unknown. Herein, we investigated the role of Anxa2 in modulating malignant phenotypes of RCC and further delineated the underlying mechanisms. Our findings corroborated earlier reports that the Anxa2 expression level was up-regulated in clinical RCC biopsies and correlated with poor prognosis. Down-regulation of Anxa2 expression in RCC cells led to suppression of the abilities of in vitro cell migration and invasion, but cell proliferation was less affected. The inhibition of cell motility in Anxa2-silenced RCC cell lines was contributed to by an alteration of cell polarity, disrupted F-actin formation, and reduced CXCR4 expression. Treatment with a Rock inhibitor restored silencing of Anxa2-mediated inhibition of cell migration and invasion. These findings indicated that Anxa2 modulates cancer cell motility in RCC and thus influences the metastatic potential of this cancer.
2. Material and methods 2.1. Cell culture We obtained 2 human RCC cell lines A498 and 786-O from the American Type Culture Collection and routinely cultured them in minimum essential medium or Roswell Park Memorial Institute medium, supplemented with 10% fetal bovine serum (FBS) and 1% MycoZap Plus-CL antibiotics (Lonza, Verviers, Belgium). Cells were cultured at 371C in a humidified incubator containing 5% CO2. The constructs with scrambled and 2 Anxa2 short hairpin (sh)RNA reagents were obtained from the National RNAi Core Facility Platform located at the Institute of Molecular Biology/Genomic Research Center, Academia Sinica (Taipei, Taiwan), supported by the National Core Facility Program for Biotechnology Grants of the National Science Council (NSC100-2319-B-001002). The sequence of the Anxa2-KD1-shRNA oligonucleotide was 50 -CCGGGCAGGAAATTAACAGAGTCTACTCGAGT AGACTCTGTTAATTTCCTGCTTTTTG-30 and of the Anxa2KD2-shRNA oligonucleotide was 50 -CCGGCGGGATGCTTTGAACATTGAACTCGAGTTCAATGTTCAAAGCATCCCG TTTTTG-30 . The transfected cells were selected using 1 μg/ml of puromycin (Invitrogen, San Diego, CA), and the knockdown efficiency was confirmed by real-time polymerase chain reaction (PCR) and Western blot analysis. The Rock inhibitor Y-27632 and human Cdc42 small interfering (si)RNA (sc-29256, Santa Cruz, Santa Cruz, CA) were applied for the wound-healing and invasion assay. 2.2. Cell proliferation assay Cell proliferation was analyzed by an MTT assay as described previously [3]. Colorimetric measurements were performed at an optical density of 450 nm with a spectrophotometer. 2.3. Wound-healing assay A wound-healing assay was performed by an established method [17]. Briefly, 1.5 104 cells were seeded into each wound-produced culture insert (400 ⫾ 50 μm [Ibidi, Martinsried, Germany]) and incubated overnight. After the culture inserts were removed, cells were washed twice with phosphate-buffered saline (PBS), and 10% FBS medium was added. Cell migration toward the wounded area was observed and photographed at indicated time points. Wound closure (%) was calculated as the area of migrated cells divided by wounded area at 0 hours. 2.4. Invasion assay For the invasion assays, 2.5 104 cells were seeded in the upper chamber of 24-well Matrigel-coated invasion chambers with 8.0-μm pores (Becton Dickinson, Bedford,
S.-F. Yang et al. / Urologic Oncology: Seminars and Original Investigations 33 (2015) 22.e11–22.e21
MA) with 0% FBS medium. The chemotaxis gradient was set up by adding medium containing 10% FBS to the lower chamber. After 24 hours, cells that had migrated to the lower chamber were stained with 4',6-diamidino-2-phenylindole and counted by ImageJ software (National Institutes of Health, Bethesda, MD). 2.5. RNA isolation, reverse transcription, and a quantitative reverse transcription PCR RNA isolation, reverse transcription, and quantitative reverse transcription PCR were performed as described previously [3]. The PCR primers included Anxa2, s100A10, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH), which was used as the housekeeping standard to quantify RNA. The following primers were used: Anxa2 forward 50 -TCGGACACATCTGGTGACTTCC-30 and reverse 50 -CCTCTTCACTCCAGCGTCATAG-30 , S100A10 forward 50 -AACAAAGGA GGACCTGAGAGTAC-30 and reverse 50 -CTTTGCCATC TCTACACTGGTCC-30 , and GAPDH forward 50 -TCCACTCACGGCAAATTCAAC-30 and reverse 50 -TCCACGACAT ACTCAGCACC-30 (MDBio, Taipei, Taiwan). Gene expression profiles were normalized to GAPDH and calculated using the 2ΔΔCt method. 2.6. Western blot analysis Protein extraction and Western blot analysis were performed as described previously [3]. Membranes were blocked with 0.5% bovine serum albumin in PBS and then incubated with Anxa2 (1:5000, R&D Systems, Minneapolis, MN), CXCR4 (1:2000, GeneTex, San Antonio, TX), and GAPDH (1:10,000, GeneTex) antibodies. The bound antibodies were detected after incubation with a horseradish peroxidase–conjugated secondary antibody (Jackson ImmunoResearch Laboratories, West Grove, PA) and were visualized by an enhanced chemiluminescence system. 2.7. Immunofluorescence and confocal microscopy RCC cells were plated onto poly-D-lysine–coated 8-well glass chamber slides for immunostaining. Cells were fixed with 10% buffered formalin, and double immunofluorescence staining was performed. Primary antibodies were used, including Anxa2 (R&D Systems) and β-actin (Sigma-Aldrich) at 1:200 dilutions, followed by DyLight 488- and DyLight 649-conjugated secondary antibodies (Rockland Immunochemicals, Gilbertsville, PA). 4',6-Diamidino-2-phenylindole (Vector Labs, Burlingame, CA) was used to stain nuclei. Cells incubated with DyLight 488- and DyLight 649-conjugated secondary antibodies in the absence of primary antibodies served as negative controls. Cellular interactions were visualized by laser confocal microscopy.
22.e13
2.8. Tissue microarray and immunohistochemical analyses Immunohistochemical (IHC) staining was done using commercially available kidney cancer tissue microarrays (TMAs): a renal clear cell cancer TMA with matched adjacent kidney tissues (KD244, containing 9 cases of kidney clear cell carcinoma, 1 case of kidney transitional cell carcinoma, and 2 cases of kidney PRCC; US Biomax, Rockville, MD), a middle-to-advanced stage of renal carcinoma and metastatic carcinoma TMA (KD808, containing 59 cases of clear cell carcinoma, 9 cases of transitional cell carcinoma, 4 cases of carcinoma sarcomatodes, 2 cases of RCC, 1 case of chromophobe carcinoma, 1 case of squamous cell carcinoma, and 4 cases of metastatic carcinoma; US Biomax), and a commercial kidney cancer TMA with tumor-specific 10-year survival data (CL2; Super Bio Chips, Seoul, Korea). The pathological grades were confirmed by hematoxylin and eosin images provided by the suppliers. In addition, transitional cell carcinoma and adjacent nontumorous tissue specimens with interstitial nephritis were excluded from further analysis. Paraffin was removed, followed by rehydration. Endogenous peroxidase activity was quenched, and sections were blocked with 1% wt/vol bovine serum albumin in PBS for 1 hour. These sections were then incubated with Anxa2 antibodies diluted in PBS. After incubation with a biotinylated secondary antibody (Dako, Copenhagen, Denmark), tissue sections were treated with an avidin-biotin peroxidase complex (Dako). The reaction was visualized using the DAB chromogen (Dako) following tissue counterstaining with hematoxylin. IHC staining was assessed, and a consensus of grading was reached. Immunostaining was evaluated manually, and the intensity was scored on the following scale: 0 ¼ negative, 1 ¼ weak, 2 ¼ moderate, and 3 ¼ strong. 2.9. TissueScan kidney cancer cDNA panel and real-time PCR For systematic expression profiling of Anxa2 in normal and tumor tissues, a commercial array was used that included cDNAs from 48 human RCC tissues (covering 9 normal, 10 stage I, 5 stage II, 13 stage III, and 11 stage IV specimens) normalized to β-actin (TissueScan, OriGene Technologies, Rockville, MD). A quantitative polymerase chain reaction (qPCR) analysis of Anxa2 was performed using a KAPA SYBR FAST qPCR kit and an ABI real-time PCR system. PCR cycling parameters were as follows: 1 cycle at 951C for 3 minutes, followed by 45 cycles at 951C for 10 seconds and 581C for 45 seconds. The relative expression of Anxa2 was compared using the 2ΔΔCt method. 2.10. Assay of the F-/G-actin ratio To determine the ratio of F-/G-actin–mediated RCC cell motility, cellular protein extracts from cells were subjected
22.e14
S.-F. Yang et al. / Urologic Oncology: Seminars and Original Investigations 33 (2015) 22.e11–22.e21
to an analysis using F-/G-actin in vivo assay kit (Cytoskeleton, Denver, CO) according to the manufacturer's protocol. Briefly, cells were lysed with a cell lysis and F-actin stabilization buffer and homogenized. After being centrifuged at 105 g for 1 hour at 371C, the supernatants (G-actin) were separated from the pellets (F-actin) and placed on ice. Pellets were then resuspended in ice-cold double-distilled (dd)H2O containing 1% cytochalasin D for 60 minutes. Equal amounts of samples (supernatant and pellet) were separated using sodium dodecyl sulfate polyacrylamide gel electrophoresis and subjected to a Western blot analysis.
cohort, stronger Anxa2 expression was detected in 31 samples (67.4%). In the remainder of the TMA elements (n ¼ 15, 32.6%), staining was either weak or absent. The Kaplan-Meier survival curves for patients with RCC, categorized according to Anxa2 expression intensity, are shown in Fig. 1D. Statistical analysis of these data revealed a positive correlation between strong Anxa2 expression and poor tumor-specific survival (P ¼ 0.0344) in a Mantel-Cox log-rank test analysis. These data suggest that Anxa2 is upregulated in RCC tumors, and the expression level was negatively correlated with tumor-specific survival.
2.11. Statistical analysis
3.2. Silencing Anxa2 expression suppressed RCC cell motility
All results are expressed as the mean ⫾ standard deviation. Comparisons between 2 groups were made using unpaired or paired Student t test. Disease-free survival was defined as the time from surgery to recurrence or cancer-specific death, whichever occurred first. Survival curves were estimated by the Kaplan-Meier method and compared using the log-rank statistic. All statistical tests were 2-tailed and P o 0.05 was regarded as significant. 3. Results 3.1. Anxa2 was up-regulated in RCC and affected the prognosis Commercial TMAs were used to evaluate whether Anxa2 is up-regulated in RCC specimens using an IHC analysis. IHC staining results showed that the Anxa2 expression level was generally elevated to varying degrees in RCC tissues. In adjacent noncancerous tissues, Anxa2 was mainly expressed in glomeruli, whereas it was slightly expressed in the cytoplasm of proximal tubules. A higher Anxa2 expression level was found in ccRCC, PRCC, and chromophobe RCC tissues, and it was prominently expressed in cancer cell membranes (Fig. 1A and B). Furthermore, we examined Anxa2 messenger (m)RNA expression in kidney cancer with a qPCR array using a real-time PCR analysis. RCC samples showed higher levels of Anxa2 expression than nontumor samples did (Fig. 1C). In addition, the expression profile was also supported by reanalyzing Anxa2 mRNA expression profiles in patients' data sets from the Oncomine Database (www.oncomine.com). After analyzing data sets of patients with RCC in the study by Jones and Gumz et al., the Anxa2 expression level was significantly increased in ccRCC (Fig. S1) and PRCC (Fig. S2); moreover, mRNA expression of its compartment protein S100A10 was also up-regulated (Fig. S3). However, the Anxa2 mRNA expression level was not associated with the tumor stages or grades (Fig. S4). To determine whether Anxa2 expression is correlated with the clinical aggressiveness of RCC, we further analyzed IHC staining in commercial TMAs in which tumor-specific 10-year survival data were available. In this
To analyze the biological effects related to Anxa2 expression in RCC cells, we used 2 RCC cell lines, A498 and 786-O, to silence Anxa2 expression with a specific shRNA-based lentiviral system. We used 2 different Anxa2specific shRNA-established clones to evaluate cell proliferation, migration, and invasion. The KD2 shRNA sequences efficiently diminished Anxa2 mRNA expression, whereas KD1 shRNA sequences showed only moderate inhibition (Fig. 2A and B). Inhibition of Anxa2 protein levels was also observed (Fig. 2C and D). It is noteworthy that S100A10 mRNA expression levels were not affected by the reduction in Anxa2 expression in A498 and 786-O cells (Fig. 2E and F). The cell growth rate and cell cycle analysis showed no significant differences in Anxa2-silenced A498 cells when compared with scrambled control cells (Fig. 2G and H). Next, we further investigated the effects of Anxa2 expression on RCC cell migration and invasion in vitro. When compared with scrambled shRNA-expressing RCC cells, Anxa2-knockdown cells exhibited a significant reduction in the migratory ability in an in vitro wound-closure assay (Fig. 3A–C). Similar results were also shown in the Matrigel invasion assays (Fig. 3D–F). Both KD2 shRNA– expressing A498 and 786-O cells showed superior inhibitory abilities of cell migration and invasion when compared with KD1 shRNA–expressing cells. These data indicated that lower Anxa2 expression levels presented higher suppression abilities of cell motility in RCC cells. 3.3. Silencing Anxa2 expression altered RCC cell polarity and disrupted F-actin formation Early data found in this study indicated that Anxa2 contributes to RCC cell motility; in addition, Anxa2knockdown cells presented loss of the morphological spindlelike shape when compared with scrambled shRNA-expressing cells (data not shown). To examine the effects of silencing Anxa2 on actin cytoskeletal organization, a confocal microscopic analysis was performed. After a 24-hour incubation, Anxa2 was homogeneously expressed in the cytoplasm, and silencing Anxa2 expression resulted in a decrease in the amount of stress fibers and a round cell morphology. After
S.-F. Yang et al. / Urologic Oncology: Seminars and Original Investigations 33 (2015) 22.e11–22.e21
22.e15
Fig. 1. Anxa2 is up-regulated in renal cell carcinoma (RCC) tumors, and the expression level was negatively correlated with tumor-specific survival. Commercial kidney cancer tissue arrays were used for immunohistochemical analysis of the Anxa2 antibody. (A) Differential expression levels of Anxa2 in RCC clinical specimens. (B) A commercial tissue microarray (TMA; KD244, n ¼ 9, transitional cell carcinoma and adjacent nontumorous tissue specimens with interstitial nephritis were excluded) was used to analyze the intensity of Anxa2 expression. (C) Anxa2 mRNA expression in a kidney cancer qPCR array was analyzed using a real-time PCR. (D) In the analysis with the commercial TMA with tumor-specific 10-year survival data (CL2), Anxa2 expression was correlated with the clinical aggressiveness of RCC.
longer incubation times to 48 hours, Anxa2 was dominantly expressed in regions of the cell membrane. The stress fibers in KD2 shRNA–expressing A498 cells were shorter, and cells were predominantly in irregular shapes, with alterations in cell polarity (Fig. 4). The effect of Anxa2 on actin cytoskeletal organization was also quantified by measuring the ratio of G-actin to F-actin. The G-/ F-actin ratio in KD2 shRNA–expressing A498 cells was 2-fold greater than that of scrambled control cells (Fig. 5A and B), indicating that Anxa2 participated in modulating the formation of monomeric actin to F-actin. The dynamic reorganization of the actin cytoskeleton is mainly carried out by Rho GTPase family proteins in an adaptation of cell motility to the microenvironment. Based on the results mentioned earlier, we presume that Anxa2
may modulate cell migration and invasion through regulating Rho family expression or activity. Therefore, a ROCK inhibitor (Y-27632) and Cdc42 siRNA were used for in vitro migration and invasion assays. Both the cell migration and invasion abilities increased in scrambled control A498 cells in response to Y-27632 but were suppressed with Cdc42 siRNA treatment. In addition, KD2 shRNA–expressing cells showed superior abilities of cell migration and invasion ( 2-fold increases) when sensitized to Y-27632, but these were not changed with Cdc42 siRNA treatment (Fig. 5C–F). These data suggest that activation of Rho signaling suppresses RCC cell migration and invasion, and Anxa2 promotes RCC cell motility through inhibition of Rho signaling and regulates the dynamic reorganization of the actin cytoskeleton.
22.e16
S.-F. Yang et al. / Urologic Oncology: Seminars and Original Investigations 33 (2015) 22.e11–22.e21
Fig. 2. Suppression of Anxa2 expression had less effect on cell proliferation in renal cell carcinoma (RCC) cell lines. A real-time RT-PCR analysis of Anxa2 expression levels in scrambled KD1 and KD2 shRNA–expressing A498 (A) and 786-O (B) cell lines. Representative Western blot analysis of Anxa2 in A498 (C) and 786-O (D) cells. Numbers indicate the relative intensity to GAPDH. An RT-PCR analysis of S100A10 expression levels in A498 (E) and 786-O (F) cells. The growth and cell cycle in scrambled KD1 and KD2 shRNA–expressing A498 cells were determined by an MTT (G) and FACS (H) analysis. *P o 0.05, **P o 0.01, and ***P o 0.001. FACS ¼ fluorescence-activated cell sorting; RT-PCR ¼ reverse transcription PCR.
S.-F. Yang et al. / Urologic Oncology: Seminars and Original Investigations 33 (2015) 22.e11–22.e21
22.e17
Fig. 3. Silencing of Anxa2 expression suppressed renal cell carcinoma (RCC) cell motility and invasiveness. When compared with scrambled shRNAexpressing RCC cells, Anxa2-knockdown cells exhibited a significant reduction in the migratory ability in an in vitro wound-closure assay (A–C). Similar results were also shown in Matrigel invasion assays (D–F). Both KD2 shRNA–expressing A498 and 786-O cells showed superior inhibitory abilities against cell motility when compared with KD1 shRNA–expressing cells. *P o 0.05, **P o 0.01, and ***P o 0.001.
Fig. 4. Silencing of Anxa2 expression caused alterations in cell polarity. Cells were cultured on a chamber slide for 24 (upper 2 panels) and 48 hours (lower 2 panels), fixed, stained for anti-Anxa2 (red), and costained with β-actin (green) antibody and DAPI. DAPI ¼ 4',6-diamidino-2-phenylindole.
22.e18
S.-F. Yang et al. / Urologic Oncology: Seminars and Original Investigations 33 (2015) 22.e11–22.e21
Fig. 5. Silencing of Anxa2 expression disrupted F-actin formation. (A) Western blot data of 3 individual representatives of G-actin and F-actin from scrambled control and KD2 A498 cells. (B) Grouped densitometric data expressed as the ratio of G-/F-actin. Migratory ability of SC and KD2 A498 cells in response to the Rock inhibitor, Y-27632 (C), and Cdc42 siRNA (D). Invasive ability of SC and KD2 A498 cells in response to the Rock inhibitor, Y-27632 (E), and Cdc42 siRNA (F). *P o 0.05 and **P o 0.01.
3.4. Silencing Anxa2 suppressed CXCR4 expression in A498 cells The expression of the CXCR4 chemokine receptor was reported in various malignancies, and its expression was linked to tumor dissemination and a poor prognosis. It was reported that Anxa2-deficient animals had fewer hematopoietic stem cells in their marrow and also expressed less CXCR4 and CXCR7 [18]. Therefore, we further examined CXCR4 expression levels in Anxa2-silenced A498 cell lines. When compared with scrambled shRNA-expressing
A498 cells, Anxa2-knockdown cells expressed lower levels of CXCR4 mRNA and protein (Fig. 6).
4. Discussion It was reported that Anxa2 expression was correlated with tumor differentiation and clinical outcomes of RCC [10,11]. In addition, positive Anxa2 expression was observed in 47.4% of primary ccRCC cases and in 87.5% of metastatic tumors, and the 5-year metastasis-free rate in
S.-F. Yang et al. / Urologic Oncology: Seminars and Original Investigations 33 (2015) 22.e11–22.e21
Fig. 6. Silencing of Anxa2 suppressed CXCR4 expression. (A) Real-time RT-PCR analysis of CXCR4 expression levels in scrambled control, KD1 and KD2 Anxa2 cells. (B) Representative Western blot data of CXCR4 protein expression levels from scrambled control, KD1 and KD2 A498 cells. Data are from 1 of 3 experiments. *P o 0.05. RT-PCR ¼ reverse transcription PCR.
patients with Anxa2-positive tumors was significantly lower than that in those with Anxa2-negative tumors [10]. By contrast, Domoto et al. [9] reported that the expression of Anxa2 mRNA was only 1.64-fold higher in tumors than that in normal tissues, and no clear relationship was observed with nuclear grade and stage. In this study, protein and mRNA expression levels of Anxa2 in RCC tumors both showed an approximately 2-fold increase compared with adjacent nontumorous tissues, and the Anxa2 protein was predominately expressed in cell membranes of tumor cells (Fig. 1A–C, Fig. S2). In addition, the disease-specific survival was lower in patients with higher Anxa2 expression (Fig. 1D). Although Anxa2 expression was higher in RCC, expression levels showed no significant differences in stages or tumor differentiation in a kidney cancer qPCR array analysis (Fig. S1). However, these results may need further validation because of the small sample size. From previous reports and the current findings, Anxa2 has emerged as an attractive molecule for regulating tumor malignancies, and its expression level might be a novel predictor of the metastatic potential of RCC. In our previous study on AKI, increased expression of Anxa2 simultaneously occurred with S100A6 and PCNA
22.e19
expressions during the regeneration process [5], which suggests that Anxa2 may participate in regulating cell proliferation. In addition, Anxa2 was reported to be involved in the proliferation of cervical cancer [19,20], breast cancer [15], hepatoma [21], non–small cell lung carcinoma [20], and multiple myeloma cells [22]. Although Anxa2 showed the ability to control cell proliferation, multiple different regulatory mechanisms are involved. In the cell cycle process, peak expression of Anxa2 was observed in the G1-S and S-G2 phases in HeLa cells [19]. Disrupted Anxa2 expression suppressed cell division and proliferation through inhibiting DNA synthesis in cervical and multiple myeloma cell lines [20,22]. In addition to influencing DNA synthesis, Anxa2 also showed the ability to facilitate the cell cycle through regulating p53 via c-Jun N-terminal kinase (JNK)/ c-Jun and silencing Anxa2-induced G2 cell cycle arrest in non–small cell lung carcinoma [23]. By contrast, knockdown of Anxa2 by shRNA did not affect the proliferation in glioma cells [24,25], and overexpression of Anxa2 protein in DU145 prostate cancer cells did not affect cell cycle progression [26]. When silencing Anxa2 in the A498 (Fig. 2G and H), Achn, and 786-O (data not shown) RCC cell lines, both cell proliferation and the distribution of the cell cycle phase were less affected. This evidence suggests that differences in Anxa2's regulation of cell proliferation may be related to the biological features of tumor types, and Anxa2 is not involved in RCC cell proliferation. In the current study, we demonstrated that Anxa2 modulates RCC cell migration and invasion in vitro, and lower Anxa2 expression showed superior inhibitory abilities. These observations are similar to previous findings in several types of cancers. Anxa2 was reported to have Ca2þ-dependent filament-bundling activity through the heterotetrameric Anxa2-S100A10 complex. At sites of cholesterol-rich membrane domains, Anxa2 can regulate the organization of membrane-associated actin through promoting the association of lipid microdomains [27] or via conjunction with other actin-binding proteins, such as α-actinin, ezrin, and actin [28]. In the current study, suppression of Anxa2 using shRNA reduced cell spreading and inhibited the formation of stress fibers after seeding cells for 24 hours, whereas at 48 hours, stress fibers exhibited a shorter form, and cells presented irregular shapes (Figs. 3–5). Therefore, Anxa2 may regulate RCC cell motility through regulating actin cytoskeletal remodeling. Rho GTPases control downstream signal pathways of multiple cell surface receptors and are best known as regulators of the actin cytoskeleton (critically reviewed in Ref. [29]). In addition, the tyrosine phosphorylation switch in Anxa2 is important for triggering Rho-/ROCK-dependent and actin-mediated changes in cell morphology associated with the control of cell adhesion [30]. Here, treatment with a ROCK inhibitor enhanced A498 cell migration and invasion, whereas Cdc42 siRNA treatment produced inhibition. Moreover, Anxa2silenced A498 cells showed superior abilities to induce cell migration and invasion when sensitized to a ROCK
22.e20
S.-F. Yang et al. / Urologic Oncology: Seminars and Original Investigations 33 (2015) 22.e11–22.e21
inhibitor (Fig. 5C–F). This finding concurred with an earlier report that Anxa2 regulates Rho-membrane interactions, resulting in alterations in F-actin networks and inhibition of Caco-2 cell motility [31]. This evidence implies that Anxa2 promotes RCC cell motility through inhibiting activation of Rho-related signaling and increasing dynamic reorganization of the actin cytoskeleton. CXCL12/CXCR4 interactions are important in regulating tumor outgrowth and metastasis of CXCR4-expressing tumor cells. The expression of CXCR4 by tumor cells is regulated by hypoxia and angiogenic factors [32]. Overexpression of VHL in VHL-negative A498 cells decreased the CXCR4 expression level owing to its capacity to target hypoxia-inducible factor for degradation under normoxic conditions [33]. The strong expression of CXCR4 was correlated with the metastatic ability in an RCC mouse model and advanced human RCC specimens [34,35]. Anxa2-deficient animals showed decreases in CXCR4 and CXCR7 expressions in hematopoietic stem cells [18]. Herein, we showed that reduction of Anxa2 expression suppressed CXCR4 mRNA and protein expressions (Fig. 6). Therefore, Anxa2 may also participate in regulating CXCR4 expression, although the underlying mechanisms still need further investigation. These findings support the notion that in addition to controlling RCC cell motility, at least in part, Anxa2 may also increase the sensitivity to environmental stimuli and contribute to the metastatic potential through regulating the CXCR4 expression level. In addition to intracellular expression, Anxa2 also is a cell surface receptor for S100A10 and helps regulate cell surface generation of the proteolytic enzyme, plasmin, which contributes to cell invasion by digesting the extracellular matrix and other tissue barriers [7]. Zheng et al. [15] demonstrated that anti-Anxa2 antibodies inhibited pancreatic ductal adenocarcinoma and prolonged survival in an allograft mouse model. Treatment with anti-Anxa2 antibodies also inhibited ovary cancer cell motility and invasion in vitro and in vivo in a chick chorioallantoic membrane assay and an intraperitoneal xenograft mouse model [16]. Inasmuch as anti-Anxa2 antibodies are effective in inhibiting cancer cell metastasis in immunocompromised models, anti-Anxa2 antibodies may drive the activities of neutralization rather than cytotoxicity. This also implies that extracellular and intracellular Anxa2 may serve distinct functions in regulating cancer cell metastasis. Although extracellular Anxa2 expression in A498 and Achn cells was not observed by fluorescence-activated cell sorting, analysis (unpublished data), further studies to evaluate anti-Anxa2 antibodies in advanced RCC treatment are still recommended.
5. Conclusion In summary, we investigated expression levels of Anxa2 in RCC clinical specimens and its biological functions. Expression levels of Anxa2 were higher in RCC tissues and
were associated with a poor prognosis. Suppression of Anxa2 expression inhibited RCC cell motility through regulating the actin cytoskeleton. This study provides a molecular-based mechanism of Anxa2 positivity in the progression of RCC, and the level of Anxa2 can be considered an important prognostic factor in patients with RCC. Acknowledgments The authors thank Ms. Yu-Hua Wu and Mr. Yu-Hsuan Sung for technical support. Appendix A. Supporting Information Supplementary material cited in this article is available online at http://dx.doi.org/10.1016/j.urolonc.2014.08.015.
References [1] Gupta K, Miller JD, Li JZ, Russell MW, Charbonneau C. Epidemiologic and socioeconomic burden of metastatic renal cell carcinoma (mRCC): a literature review. Cancer Treat Rev 2008;34:193–205. [2] Arai E, Kanai Y. Genetic and epigenetic alterations during renal carcinogenesis. Int J Clin Exp Pathol 2010;4:58–73. [3] Lin JA, Fang SU, Su CL, Hsiao CJ, Chang CC, Lin YF, et al. Silencing glucose-regulated protein 78 induced renal cell carcinoma cell line G1 cell-cycle arrest and resistance to conventional chemotherapy. Urol Oncol 2014;32(1):29.e1–11. [4] Thadhani R, Pascual M, Bonventre JV. Acute renal failure. N Engl J Med 1996;334:1448–60. [5] Cheng CW, Rifai A, Ka SM, Shui HA, Lin YF, Lee WH, et al. Calcium-binding proteins annexin A2 and S100A6 are sensors of tubular injury and recovery in acute renal failure. Kidney Int 2005; 68:2694–703. [6] Cheng CW, Ka SM, Yang SM, Shui HA, Hung YW, Ho PC, et al. Nephronectin expression in nephrotoxic acute tubular necrosis. Nephrol Dial Transplant 2008;23:101–9. [7] Bharadwaj A, Bydoun M, Holloway R, Waisman D. Annexin A2 heterotetramer: structure and function. Int J Mol Sci 2013;14:6259–305. [8] Gerke V, Creutz CE, Moss SE. Annexins: linking Ca2þ signalling to membrane dynamics. Nat Rev Mol Cell Biol 2005;6:449–61. [9] Domoto T, Miyama Y, Suzuki H, Teratani T, Arai K, Sugiyama T, et al. Evaluation of S100A10, annexin II and B-FABP expression as markers for renal cell carcinoma. Cancer Sci 2007;98:77–82. [10] Ohno Y, Izumi M, Kawamura T, Nishimura T, Mukai K, Tachibana M. Annexin II represents metastatic potential in clear-cell renal cell carcinoma. Br J Cancer 2009;101:287–94. [11] Zimmermann U, Woenckhaus C, Pietschmann S, Junker H, Maile S, Schultz K, et al. Expression of annexin II in conventional renal cell carcinoma is correlated with Fuhrman grade and clinical outcome. Virchows Arch 2004;445:368–74. [12] Zhang L, Peng X, Zhang Z, Feng Y, Jia X, Shi Y, et al. Subcellular proteome analysis unraveled annexin A2 related to immune liver fibrosis. J Cell Biochem 2010;110:219–28. [13] Lokman NA, Elder AS, Ween MP, Pyragius CE, Hoffmann P, Oehler MK, et al. Annexin A2 is regulated by ovarian cancer-peritoneal cell interactions and promotes metastasis. Oncotarget 2013;4:1199–211. [14] Deng S, Jing B, Xing T, Hou L, Yang Z. Overexpression of annexin A2 is associated with abnormal ubiquitination in breast cancer. Genomics Proteomics Bioinformatics 2012;10:153–7.
S.-F. Yang et al. / Urologic Oncology: Seminars and Original Investigations 33 (2015) 22.e11–22.e21 [15] Zheng L, Foley K, Huang L, Leubner A, Mo G, Olino K, et al. Tyrosine 23 phosphorylation–dependent cell-surface localization of annexin A2 is required for invasion and metastases of pancreatic cancer. PloS One 2011;6:e19390. [16] Lokman NA, Ween MP, Oehler MK, Ricciardelli C. The role of annexin A2 in tumorigenesis and cancer progression. Cancer Microenviron 2011;4:199–208. [17] Ke TW, Hsu HL, Wu YH, Chen WT, Cheng YW, Cheng CW. MicroRNA-224 suppresses colorectal cancer cell migration by targeting Cdc42. Dis Markers 2014;2014:617150. [18] Jung Y, Shiozawa Y, Wang J, Patel LR, Havens AM, Song J, et al. Annexin-2 is a regulator of stromal cell-derived factor-1/CXCL12 function in the hematopoietic stem cell endosteal niche. Exp Hematol 2011;39:151e1–66e1. [19] Chiang Y, Schneiderman MH, Vishwanatha JK. Annexin II expression is regulated during mammalian cell cycle. Cancer Res 1993;53: 6017–21. [20] Chiang Y, Rizzino A, Sibenaller ZA, Wold MS, Vishwanatha JK. Specific down-regulation of annexin II expression in human cells interferes with cell proliferation. Mol Cell Biochem 1999;199:139–47. [21] Dong Z, Yao M, Zhang H, Wang L, Huang H, Yan M, et al. Inhibition of Annexin A2 gene transcription is a promising molecular target for hepatoma cell proliferation and metastasis. Oncol Lett 2014;7:28–34. [22] Bao H, Jiang M, Zhu M, Sheng F, Ruan J, Ruan C. Overexpression of Annexin II affects the proliferation, apoptosis, invasion and production of proangiogenic factors in multiple myeloma. Int J Hematol 2009;90:177–85. [23] Wang CY, Chen CL, Tseng YL, Fang YT, Lin YS, Su WC, et al. Annexin A2 silencing induces G2 arrest of non-small cell lung cancer cells through p53-dependent and -independent mechanisms. J Biol Chem 2012;287:32512–24. [24] Tatenhorst L, Rescher U, Gerke V, Paulus W. Knockdown of annexin 2 decreases migration of human glioma cells in vitro. Neuropathol Appl Neurobiol 2006;32:271–7.
22.e21
[25] Zhai H, Acharya S, Gravanis I, Mehmood S, Seidman RJ, Shroyer KR, et al. Annexin A2 promotes glioma cell invasion and tumor progression. J Neurosci 2011;31:14346–60. [26] Inokuchi J, Narula N, Yee DS, Skarecky DW, Lau A, Ornstein DK, et al. Annexin A2 positively contributes to the malignant phenotype and secretion of IL-6 in DU145 prostate cancer cells. Int J Cancer 2009;124:68–74. [27] Babiychuk EB, Draeger A. Annexins in cell membrane dynamics. Ca(2þ)-regulated association of lipid microdomains. J Cell Biol 2000;150:1113–24. [28] Gerke V, Moss SE. Annexins: from structure to function. Physiol Rev 2002;82:331–71. [29] Raftopoulou M, Hall A. Cell migration: Rho GTPases lead the way. Dev Biol 2004;265:23–32. [30] Rescher U, Ludwig C, Konietzko V, Kharitonenkov A, Gerke V. Tyrosine phosphorylation of annexin A2 regulates Rho-mediated actin rearrangement and cell adhesion. J Cell Sci 2008;121: 2177–85. [31] Babbin BA, Parkos CA, Mandell KJ, Winfree LM, Laur O, Ivanov AI, et al. Annexin 2 regulates intestinal epithelial cell spreading and wound closure through Rho-related signaling. Am J Pathol 2007;170: 951–66. [32] Liekens S, Schols D, Hatse S. CXCL12-CXCR4 axis in angiogenesis, metastasis and stem cell mobilization. Curr Pharm Des 2010;16: 3903–20. [33] Staller P, Sulitkova J, Lisztwan J, Moch H, Oakeley EJ, Krek W. Chemokine receptor CXCR4 downregulated by von Hippel-Lindau tumour suppressor pVHL. Nature 2003;425:307–11. [34] Wehler TC, Graf C, Biesterfeld S, Brenner W, Schadt J, Gockel I, et al. Strong expression of chemokine receptor CXCR4 by renal cell carcinoma correlates with advanced disease. J Oncol 2008;2008: 626340. [35] Pan J, Mestas J, Burdick MD, Phillips RJ, Thomas GV, Reckamp K, et al. Stromal derived factor-1 (SDF-1/CXCL12) and CXCR4 in renal cell carcinoma metastasis. Mol Cancer 2006;5:56.
Original article
Annexin A2 in renal cell carcinoma: Expression, function, and prognostic significance Shun-Fa Yang, Ph.D.a,b,1, Han-Lin Hsu, M.D.c,1, Tai-Kuang Chao, M.D.d, Chia-Jung Hsiao, B.Sc.e, Yung-Feng Lin, Ph.D.f, Chao-Wen Cheng, Ph.D.e,g,* a
Institute of Medicine, Chung Shan Medical University, Taichung, Taiwan Department of Medical Research, Chung Shan Medical University Hospital, Taichung, Taiwan c Department of Internal Medicine, Taipei Medical University-Wan Fang Hospital, Taipei, Taiwan d Department of Pathology, Tri-Service General Hospital, Taipei, Taiwan e Graduate Institute of Clinical Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan f School of Medical Laboratory Sciences and Biotechnology, College of Medical Science and Technology, Taipei Medical University, Taipei, Taiwan g Graduate Institute of Medical Sciences, National Defense Medical Center, Taipei, Taiwan b
Received 31 July 2014; received in revised form 28 August 2014; accepted 29 August 2014
Abstract Objective: Renal cell carcinoma (RCC) is the most lethal genitourinary cancer and intrinsically resistant to chemotherapy, radiotherapy, and hormone therapy. Annexin A2 (Anxa2) is a calcium-dependent phospholipid-binding protein found on various cell types that plays multiple roles in regulating cellular functions. In RCC, Anxa2 expression was correlated with tumor differentiation, clinical outcomes, and the metastatic potential; however, the underlying mechanisms remain obscure. This study investigated the role of Anxa2 in regulating tumorigenesis of RCC. Materials and methods: Commercial RCC tissue microarray arrays and a kidney cancer quantitative polymerase chain reaction array were used to examine Anxa2 by immunohistochemistry and real-time polymerase chain reaction analysis. Short hairpin (sh)RNA–based lentiviral system technology was used to evaluate the effects of manipulating Anxa2 expression on multiple malignant features of 2 RCC cell lines, A498 and 786-O, and its mechanisms. Results: (1) The Anxa2 expression level was generally elevated to varying degrees in RCC tissues. In adjacent noncancerous tissues, Anxa2 was mainly expressed in glomeruli and slightly expressed in the cytoplasm of proximal tubules. (2) An increased Anxa2 expression level was found in tissues of clear cell RCC, papillary RCC, and chromophobe RCC, and it was prominently expressed in cancer cell membranes. In addition, the Anxa2 expression level was correlated with poor prognosis. (3) Silencing Anxa2 expression suppressed the abilities of cell migration and invasion, but cell proliferation was less affected. (4) Diminished Anxa2 expression caused alterations in the cell polarity, disrupted the formation of actin filaments, and reduced CXCR4 expression. (5) Inhibition of the Rho/Rock axis restored silencing of Anxa2-mediated suppression of cell motility. Conclusions: Overall, our study points out the regulatory function of Anxa2 in RCC cell motility and provides a molecular-based mechanism of Anxa2 positivity in the progression of RCC. r 2014 Elsevier Inc. All rights reserved.
Keywords: Actin cytoskeleton; Annexin A2; Cell motility; Rho GTPase; Metastasis
This work was supported by a Grant from Taipei Medical University and Wan Fang Hospital (102TMU-WFH-03) and was partly supported by Grants from the National Science Council (NSC101-2320-B-038-006 and NSC102-2320-B-038-020-MY2), Taiwan. 1 These authors contributed equally to this work. * Corresponding author. Tel.: þ886-2-273-61661, ext: 3236; fax: þ8862-273-90500. E-mail address: [email protected] (C.-W. Cheng). http://dx.doi.org/10.1016/j.urolonc.2014.08.015 1078-1439/r 2014 Elsevier Inc. All rights reserved.
1. Introduction Renal cell carcinoma (RCC) is the most lethal genitourinary cancer and comprises a group of tumor types including clear cell RCC (ccRCC), papillary RCC (PRCC), and chromophobe RCC that originate from the epithelium of renal tubules [1,2]. RCC is generally resistant to
22.e12
S.-F. Yang et al. / Urologic Oncology: Seminars and Original Investigations 33 (2015) 22.e11–22.e21
chemotherapy, radiotherapy, and hormone therapy. The median survival time of metastatic patients is only 8 months, and the 5-year survival rate is o10% [3]. Therefore, understanding the underlying pathogenic mechanisms of RCC is needed to improve therapeutic applications and clinical molecular diagnoses. Contrary to other organs, where ischemia results in permanent cell loss, the kidneys, which may experience severe damage induced by acute kidney injury (AKI), have the ability to completely restore their structure and function [4]. The phenomena present similar outcomes of RCC in the presence of large numbers of proliferating renal tubular cells in the regeneration stage. This model with precise separation into different stages can provide key information of these intensively proliferating tubular cells, thus reproducing certain aspects of RCC carcinogenesis [5,6]. In our previous study, annexin A2 (Anxa2) was modulated in a temporal pattern concomitant with the initiation of and recovery from AKI, and it was possibly involved in the regulation of tubular cell proliferation and regeneration in the recovery process of nephrotoxic and ischemia/reperfusion–induced AKI [5]. Anxa2 is a calciumdependent phospholipid-binding protein expressed by many different cell types. It was suggested that Anxa2 shows distinct biochemical properties as a monomer and as a heterotetrameric complex with the plasminogen receptor protein S100A10 in many cellular processes, including exocytosis, endocytosis, membrane organization, ion channel conductance, and cytoskeletal remodeling (critically reviewed in Refs. [7,8]). Increased expression of Anxa2 was reported in many different malignancies, including those of the breast, kidney, liver, ovary, and pancreas [9–15]. In addition to promoting tumor growth, it may also participate in cancer metastasis by modulating cancer cell migration, invasion, and adhesion processes [16]. Although Anxa2 expression was reported to be correlated with tumor differentiation and clinical outcomes in RCC [10,11], its role in RCC progression remains largely unknown. Herein, we investigated the role of Anxa2 in modulating malignant phenotypes of RCC and further delineated the underlying mechanisms. Our findings corroborated earlier reports that the Anxa2 expression level was up-regulated in clinical RCC biopsies and correlated with poor prognosis. Down-regulation of Anxa2 expression in RCC cells led to suppression of the abilities of in vitro cell migration and invasion, but cell proliferation was less affected. The inhibition of cell motility in Anxa2-silenced RCC cell lines was contributed to by an alteration of cell polarity, disrupted F-actin formation, and reduced CXCR4 expression. Treatment with a Rock inhibitor restored silencing of Anxa2-mediated inhibition of cell migration and invasion. These findings indicated that Anxa2 modulates cancer cell motility in RCC and thus influences the metastatic potential of this cancer.
2. Material and methods 2.1. Cell culture We obtained 2 human RCC cell lines A498 and 786-O from the American Type Culture Collection and routinely cultured them in minimum essential medium or Roswell Park Memorial Institute medium, supplemented with 10% fetal bovine serum (FBS) and 1% MycoZap Plus-CL antibiotics (Lonza, Verviers, Belgium). Cells were cultured at 371C in a humidified incubator containing 5% CO2. The constructs with scrambled and 2 Anxa2 short hairpin (sh)RNA reagents were obtained from the National RNAi Core Facility Platform located at the Institute of Molecular Biology/Genomic Research Center, Academia Sinica (Taipei, Taiwan), supported by the National Core Facility Program for Biotechnology Grants of the National Science Council (NSC100-2319-B-001002). The sequence of the Anxa2-KD1-shRNA oligonucleotide was 50 -CCGGGCAGGAAATTAACAGAGTCTACTCGAGT AGACTCTGTTAATTTCCTGCTTTTTG-30 and of the Anxa2KD2-shRNA oligonucleotide was 50 -CCGGCGGGATGCTTTGAACATTGAACTCGAGTTCAATGTTCAAAGCATCCCG TTTTTG-30 . The transfected cells were selected using 1 μg/ml of puromycin (Invitrogen, San Diego, CA), and the knockdown efficiency was confirmed by real-time polymerase chain reaction (PCR) and Western blot analysis. The Rock inhibitor Y-27632 and human Cdc42 small interfering (si)RNA (sc-29256, Santa Cruz, Santa Cruz, CA) were applied for the wound-healing and invasion assay. 2.2. Cell proliferation assay Cell proliferation was analyzed by an MTT assay as described previously [3]. Colorimetric measurements were performed at an optical density of 450 nm with a spectrophotometer. 2.3. Wound-healing assay A wound-healing assay was performed by an established method [17]. Briefly, 1.5 104 cells were seeded into each wound-produced culture insert (400 ⫾ 50 μm [Ibidi, Martinsried, Germany]) and incubated overnight. After the culture inserts were removed, cells were washed twice with phosphate-buffered saline (PBS), and 10% FBS medium was added. Cell migration toward the wounded area was observed and photographed at indicated time points. Wound closure (%) was calculated as the area of migrated cells divided by wounded area at 0 hours. 2.4. Invasion assay For the invasion assays, 2.5 104 cells were seeded in the upper chamber of 24-well Matrigel-coated invasion chambers with 8.0-μm pores (Becton Dickinson, Bedford,
S.-F. Yang et al. / Urologic Oncology: Seminars and Original Investigations 33 (2015) 22.e11–22.e21
MA) with 0% FBS medium. The chemotaxis gradient was set up by adding medium containing 10% FBS to the lower chamber. After 24 hours, cells that had migrated to the lower chamber were stained with 4',6-diamidino-2-phenylindole and counted by ImageJ software (National Institutes of Health, Bethesda, MD). 2.5. RNA isolation, reverse transcription, and a quantitative reverse transcription PCR RNA isolation, reverse transcription, and quantitative reverse transcription PCR were performed as described previously [3]. The PCR primers included Anxa2, s100A10, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH), which was used as the housekeeping standard to quantify RNA. The following primers were used: Anxa2 forward 50 -TCGGACACATCTGGTGACTTCC-30 and reverse 50 -CCTCTTCACTCCAGCGTCATAG-30 , S100A10 forward 50 -AACAAAGGA GGACCTGAGAGTAC-30 and reverse 50 -CTTTGCCATC TCTACACTGGTCC-30 , and GAPDH forward 50 -TCCACTCACGGCAAATTCAAC-30 and reverse 50 -TCCACGACAT ACTCAGCACC-30 (MDBio, Taipei, Taiwan). Gene expression profiles were normalized to GAPDH and calculated using the 2ΔΔCt method. 2.6. Western blot analysis Protein extraction and Western blot analysis were performed as described previously [3]. Membranes were blocked with 0.5% bovine serum albumin in PBS and then incubated with Anxa2 (1:5000, R&D Systems, Minneapolis, MN), CXCR4 (1:2000, GeneTex, San Antonio, TX), and GAPDH (1:10,000, GeneTex) antibodies. The bound antibodies were detected after incubation with a horseradish peroxidase–conjugated secondary antibody (Jackson ImmunoResearch Laboratories, West Grove, PA) and were visualized by an enhanced chemiluminescence system. 2.7. Immunofluorescence and confocal microscopy RCC cells were plated onto poly-D-lysine–coated 8-well glass chamber slides for immunostaining. Cells were fixed with 10% buffered formalin, and double immunofluorescence staining was performed. Primary antibodies were used, including Anxa2 (R&D Systems) and β-actin (Sigma-Aldrich) at 1:200 dilutions, followed by DyLight 488- and DyLight 649-conjugated secondary antibodies (Rockland Immunochemicals, Gilbertsville, PA). 4',6-Diamidino-2-phenylindole (Vector Labs, Burlingame, CA) was used to stain nuclei. Cells incubated with DyLight 488- and DyLight 649-conjugated secondary antibodies in the absence of primary antibodies served as negative controls. Cellular interactions were visualized by laser confocal microscopy.
22.e13
2.8. Tissue microarray and immunohistochemical analyses Immunohistochemical (IHC) staining was done using commercially available kidney cancer tissue microarrays (TMAs): a renal clear cell cancer TMA with matched adjacent kidney tissues (KD244, containing 9 cases of kidney clear cell carcinoma, 1 case of kidney transitional cell carcinoma, and 2 cases of kidney PRCC; US Biomax, Rockville, MD), a middle-to-advanced stage of renal carcinoma and metastatic carcinoma TMA (KD808, containing 59 cases of clear cell carcinoma, 9 cases of transitional cell carcinoma, 4 cases of carcinoma sarcomatodes, 2 cases of RCC, 1 case of chromophobe carcinoma, 1 case of squamous cell carcinoma, and 4 cases of metastatic carcinoma; US Biomax), and a commercial kidney cancer TMA with tumor-specific 10-year survival data (CL2; Super Bio Chips, Seoul, Korea). The pathological grades were confirmed by hematoxylin and eosin images provided by the suppliers. In addition, transitional cell carcinoma and adjacent nontumorous tissue specimens with interstitial nephritis were excluded from further analysis. Paraffin was removed, followed by rehydration. Endogenous peroxidase activity was quenched, and sections were blocked with 1% wt/vol bovine serum albumin in PBS for 1 hour. These sections were then incubated with Anxa2 antibodies diluted in PBS. After incubation with a biotinylated secondary antibody (Dako, Copenhagen, Denmark), tissue sections were treated with an avidin-biotin peroxidase complex (Dako). The reaction was visualized using the DAB chromogen (Dako) following tissue counterstaining with hematoxylin. IHC staining was assessed, and a consensus of grading was reached. Immunostaining was evaluated manually, and the intensity was scored on the following scale: 0 ¼ negative, 1 ¼ weak, 2 ¼ moderate, and 3 ¼ strong. 2.9. TissueScan kidney cancer cDNA panel and real-time PCR For systematic expression profiling of Anxa2 in normal and tumor tissues, a commercial array was used that included cDNAs from 48 human RCC tissues (covering 9 normal, 10 stage I, 5 stage II, 13 stage III, and 11 stage IV specimens) normalized to β-actin (TissueScan, OriGene Technologies, Rockville, MD). A quantitative polymerase chain reaction (qPCR) analysis of Anxa2 was performed using a KAPA SYBR FAST qPCR kit and an ABI real-time PCR system. PCR cycling parameters were as follows: 1 cycle at 951C for 3 minutes, followed by 45 cycles at 951C for 10 seconds and 581C for 45 seconds. The relative expression of Anxa2 was compared using the 2ΔΔCt method. 2.10. Assay of the F-/G-actin ratio To determine the ratio of F-/G-actin–mediated RCC cell motility, cellular protein extracts from cells were subjected
22.e14
S.-F. Yang et al. / Urologic Oncology: Seminars and Original Investigations 33 (2015) 22.e11–22.e21
to an analysis using F-/G-actin in vivo assay kit (Cytoskeleton, Denver, CO) according to the manufacturer's protocol. Briefly, cells were lysed with a cell lysis and F-actin stabilization buffer and homogenized. After being centrifuged at 105 g for 1 hour at 371C, the supernatants (G-actin) were separated from the pellets (F-actin) and placed on ice. Pellets were then resuspended in ice-cold double-distilled (dd)H2O containing 1% cytochalasin D for 60 minutes. Equal amounts of samples (supernatant and pellet) were separated using sodium dodecyl sulfate polyacrylamide gel electrophoresis and subjected to a Western blot analysis.
cohort, stronger Anxa2 expression was detected in 31 samples (67.4%). In the remainder of the TMA elements (n ¼ 15, 32.6%), staining was either weak or absent. The Kaplan-Meier survival curves for patients with RCC, categorized according to Anxa2 expression intensity, are shown in Fig. 1D. Statistical analysis of these data revealed a positive correlation between strong Anxa2 expression and poor tumor-specific survival (P ¼ 0.0344) in a Mantel-Cox log-rank test analysis. These data suggest that Anxa2 is upregulated in RCC tumors, and the expression level was negatively correlated with tumor-specific survival.
2.11. Statistical analysis
3.2. Silencing Anxa2 expression suppressed RCC cell motility
All results are expressed as the mean ⫾ standard deviation. Comparisons between 2 groups were made using unpaired or paired Student t test. Disease-free survival was defined as the time from surgery to recurrence or cancer-specific death, whichever occurred first. Survival curves were estimated by the Kaplan-Meier method and compared using the log-rank statistic. All statistical tests were 2-tailed and P o 0.05 was regarded as significant. 3. Results 3.1. Anxa2 was up-regulated in RCC and affected the prognosis Commercial TMAs were used to evaluate whether Anxa2 is up-regulated in RCC specimens using an IHC analysis. IHC staining results showed that the Anxa2 expression level was generally elevated to varying degrees in RCC tissues. In adjacent noncancerous tissues, Anxa2 was mainly expressed in glomeruli, whereas it was slightly expressed in the cytoplasm of proximal tubules. A higher Anxa2 expression level was found in ccRCC, PRCC, and chromophobe RCC tissues, and it was prominently expressed in cancer cell membranes (Fig. 1A and B). Furthermore, we examined Anxa2 messenger (m)RNA expression in kidney cancer with a qPCR array using a real-time PCR analysis. RCC samples showed higher levels of Anxa2 expression than nontumor samples did (Fig. 1C). In addition, the expression profile was also supported by reanalyzing Anxa2 mRNA expression profiles in patients' data sets from the Oncomine Database (www.oncomine.com). After analyzing data sets of patients with RCC in the study by Jones and Gumz et al., the Anxa2 expression level was significantly increased in ccRCC (Fig. S1) and PRCC (Fig. S2); moreover, mRNA expression of its compartment protein S100A10 was also up-regulated (Fig. S3). However, the Anxa2 mRNA expression level was not associated with the tumor stages or grades (Fig. S4). To determine whether Anxa2 expression is correlated with the clinical aggressiveness of RCC, we further analyzed IHC staining in commercial TMAs in which tumor-specific 10-year survival data were available. In this
To analyze the biological effects related to Anxa2 expression in RCC cells, we used 2 RCC cell lines, A498 and 786-O, to silence Anxa2 expression with a specific shRNA-based lentiviral system. We used 2 different Anxa2specific shRNA-established clones to evaluate cell proliferation, migration, and invasion. The KD2 shRNA sequences efficiently diminished Anxa2 mRNA expression, whereas KD1 shRNA sequences showed only moderate inhibition (Fig. 2A and B). Inhibition of Anxa2 protein levels was also observed (Fig. 2C and D). It is noteworthy that S100A10 mRNA expression levels were not affected by the reduction in Anxa2 expression in A498 and 786-O cells (Fig. 2E and F). The cell growth rate and cell cycle analysis showed no significant differences in Anxa2-silenced A498 cells when compared with scrambled control cells (Fig. 2G and H). Next, we further investigated the effects of Anxa2 expression on RCC cell migration and invasion in vitro. When compared with scrambled shRNA-expressing RCC cells, Anxa2-knockdown cells exhibited a significant reduction in the migratory ability in an in vitro wound-closure assay (Fig. 3A–C). Similar results were also shown in the Matrigel invasion assays (Fig. 3D–F). Both KD2 shRNA– expressing A498 and 786-O cells showed superior inhibitory abilities of cell migration and invasion when compared with KD1 shRNA–expressing cells. These data indicated that lower Anxa2 expression levels presented higher suppression abilities of cell motility in RCC cells. 3.3. Silencing Anxa2 expression altered RCC cell polarity and disrupted F-actin formation Early data found in this study indicated that Anxa2 contributes to RCC cell motility; in addition, Anxa2knockdown cells presented loss of the morphological spindlelike shape when compared with scrambled shRNA-expressing cells (data not shown). To examine the effects of silencing Anxa2 on actin cytoskeletal organization, a confocal microscopic analysis was performed. After a 24-hour incubation, Anxa2 was homogeneously expressed in the cytoplasm, and silencing Anxa2 expression resulted in a decrease in the amount of stress fibers and a round cell morphology. After
S.-F. Yang et al. / Urologic Oncology: Seminars and Original Investigations 33 (2015) 22.e11–22.e21
22.e15
Fig. 1. Anxa2 is up-regulated in renal cell carcinoma (RCC) tumors, and the expression level was negatively correlated with tumor-specific survival. Commercial kidney cancer tissue arrays were used for immunohistochemical analysis of the Anxa2 antibody. (A) Differential expression levels of Anxa2 in RCC clinical specimens. (B) A commercial tissue microarray (TMA; KD244, n ¼ 9, transitional cell carcinoma and adjacent nontumorous tissue specimens with interstitial nephritis were excluded) was used to analyze the intensity of Anxa2 expression. (C) Anxa2 mRNA expression in a kidney cancer qPCR array was analyzed using a real-time PCR. (D) In the analysis with the commercial TMA with tumor-specific 10-year survival data (CL2), Anxa2 expression was correlated with the clinical aggressiveness of RCC.
longer incubation times to 48 hours, Anxa2 was dominantly expressed in regions of the cell membrane. The stress fibers in KD2 shRNA–expressing A498 cells were shorter, and cells were predominantly in irregular shapes, with alterations in cell polarity (Fig. 4). The effect of Anxa2 on actin cytoskeletal organization was also quantified by measuring the ratio of G-actin to F-actin. The G-/ F-actin ratio in KD2 shRNA–expressing A498 cells was 2-fold greater than that of scrambled control cells (Fig. 5A and B), indicating that Anxa2 participated in modulating the formation of monomeric actin to F-actin. The dynamic reorganization of the actin cytoskeleton is mainly carried out by Rho GTPase family proteins in an adaptation of cell motility to the microenvironment. Based on the results mentioned earlier, we presume that Anxa2
may modulate cell migration and invasion through regulating Rho family expression or activity. Therefore, a ROCK inhibitor (Y-27632) and Cdc42 siRNA were used for in vitro migration and invasion assays. Both the cell migration and invasion abilities increased in scrambled control A498 cells in response to Y-27632 but were suppressed with Cdc42 siRNA treatment. In addition, KD2 shRNA–expressing cells showed superior abilities of cell migration and invasion ( 2-fold increases) when sensitized to Y-27632, but these were not changed with Cdc42 siRNA treatment (Fig. 5C–F). These data suggest that activation of Rho signaling suppresses RCC cell migration and invasion, and Anxa2 promotes RCC cell motility through inhibition of Rho signaling and regulates the dynamic reorganization of the actin cytoskeleton.
22.e16
S.-F. Yang et al. / Urologic Oncology: Seminars and Original Investigations 33 (2015) 22.e11–22.e21
Fig. 2. Suppression of Anxa2 expression had less effect on cell proliferation in renal cell carcinoma (RCC) cell lines. A real-time RT-PCR analysis of Anxa2 expression levels in scrambled KD1 and KD2 shRNA–expressing A498 (A) and 786-O (B) cell lines. Representative Western blot analysis of Anxa2 in A498 (C) and 786-O (D) cells. Numbers indicate the relative intensity to GAPDH. An RT-PCR analysis of S100A10 expression levels in A498 (E) and 786-O (F) cells. The growth and cell cycle in scrambled KD1 and KD2 shRNA–expressing A498 cells were determined by an MTT (G) and FACS (H) analysis. *P o 0.05, **P o 0.01, and ***P o 0.001. FACS ¼ fluorescence-activated cell sorting; RT-PCR ¼ reverse transcription PCR.
S.-F. Yang et al. / Urologic Oncology: Seminars and Original Investigations 33 (2015) 22.e11–22.e21
22.e17
Fig. 3. Silencing of Anxa2 expression suppressed renal cell carcinoma (RCC) cell motility and invasiveness. When compared with scrambled shRNAexpressing RCC cells, Anxa2-knockdown cells exhibited a significant reduction in the migratory ability in an in vitro wound-closure assay (A–C). Similar results were also shown in Matrigel invasion assays (D–F). Both KD2 shRNA–expressing A498 and 786-O cells showed superior inhibitory abilities against cell motility when compared with KD1 shRNA–expressing cells. *P o 0.05, **P o 0.01, and ***P o 0.001.
Fig. 4. Silencing of Anxa2 expression caused alterations in cell polarity. Cells were cultured on a chamber slide for 24 (upper 2 panels) and 48 hours (lower 2 panels), fixed, stained for anti-Anxa2 (red), and costained with β-actin (green) antibody and DAPI. DAPI ¼ 4',6-diamidino-2-phenylindole.
22.e18
S.-F. Yang et al. / Urologic Oncology: Seminars and Original Investigations 33 (2015) 22.e11–22.e21
Fig. 5. Silencing of Anxa2 expression disrupted F-actin formation. (A) Western blot data of 3 individual representatives of G-actin and F-actin from scrambled control and KD2 A498 cells. (B) Grouped densitometric data expressed as the ratio of G-/F-actin. Migratory ability of SC and KD2 A498 cells in response to the Rock inhibitor, Y-27632 (C), and Cdc42 siRNA (D). Invasive ability of SC and KD2 A498 cells in response to the Rock inhibitor, Y-27632 (E), and Cdc42 siRNA (F). *P o 0.05 and **P o 0.01.
3.4. Silencing Anxa2 suppressed CXCR4 expression in A498 cells The expression of the CXCR4 chemokine receptor was reported in various malignancies, and its expression was linked to tumor dissemination and a poor prognosis. It was reported that Anxa2-deficient animals had fewer hematopoietic stem cells in their marrow and also expressed less CXCR4 and CXCR7 [18]. Therefore, we further examined CXCR4 expression levels in Anxa2-silenced A498 cell lines. When compared with scrambled shRNA-expressing
A498 cells, Anxa2-knockdown cells expressed lower levels of CXCR4 mRNA and protein (Fig. 6).
4. Discussion It was reported that Anxa2 expression was correlated with tumor differentiation and clinical outcomes of RCC [10,11]. In addition, positive Anxa2 expression was observed in 47.4% of primary ccRCC cases and in 87.5% of metastatic tumors, and the 5-year metastasis-free rate in
S.-F. Yang et al. / Urologic Oncology: Seminars and Original Investigations 33 (2015) 22.e11–22.e21
Fig. 6. Silencing of Anxa2 suppressed CXCR4 expression. (A) Real-time RT-PCR analysis of CXCR4 expression levels in scrambled control, KD1 and KD2 Anxa2 cells. (B) Representative Western blot data of CXCR4 protein expression levels from scrambled control, KD1 and KD2 A498 cells. Data are from 1 of 3 experiments. *P o 0.05. RT-PCR ¼ reverse transcription PCR.
patients with Anxa2-positive tumors was significantly lower than that in those with Anxa2-negative tumors [10]. By contrast, Domoto et al. [9] reported that the expression of Anxa2 mRNA was only 1.64-fold higher in tumors than that in normal tissues, and no clear relationship was observed with nuclear grade and stage. In this study, protein and mRNA expression levels of Anxa2 in RCC tumors both showed an approximately 2-fold increase compared with adjacent nontumorous tissues, and the Anxa2 protein was predominately expressed in cell membranes of tumor cells (Fig. 1A–C, Fig. S2). In addition, the disease-specific survival was lower in patients with higher Anxa2 expression (Fig. 1D). Although Anxa2 expression was higher in RCC, expression levels showed no significant differences in stages or tumor differentiation in a kidney cancer qPCR array analysis (Fig. S1). However, these results may need further validation because of the small sample size. From previous reports and the current findings, Anxa2 has emerged as an attractive molecule for regulating tumor malignancies, and its expression level might be a novel predictor of the metastatic potential of RCC. In our previous study on AKI, increased expression of Anxa2 simultaneously occurred with S100A6 and PCNA
22.e19
expressions during the regeneration process [5], which suggests that Anxa2 may participate in regulating cell proliferation. In addition, Anxa2 was reported to be involved in the proliferation of cervical cancer [19,20], breast cancer [15], hepatoma [21], non–small cell lung carcinoma [20], and multiple myeloma cells [22]. Although Anxa2 showed the ability to control cell proliferation, multiple different regulatory mechanisms are involved. In the cell cycle process, peak expression of Anxa2 was observed in the G1-S and S-G2 phases in HeLa cells [19]. Disrupted Anxa2 expression suppressed cell division and proliferation through inhibiting DNA synthesis in cervical and multiple myeloma cell lines [20,22]. In addition to influencing DNA synthesis, Anxa2 also showed the ability to facilitate the cell cycle through regulating p53 via c-Jun N-terminal kinase (JNK)/ c-Jun and silencing Anxa2-induced G2 cell cycle arrest in non–small cell lung carcinoma [23]. By contrast, knockdown of Anxa2 by shRNA did not affect the proliferation in glioma cells [24,25], and overexpression of Anxa2 protein in DU145 prostate cancer cells did not affect cell cycle progression [26]. When silencing Anxa2 in the A498 (Fig. 2G and H), Achn, and 786-O (data not shown) RCC cell lines, both cell proliferation and the distribution of the cell cycle phase were less affected. This evidence suggests that differences in Anxa2's regulation of cell proliferation may be related to the biological features of tumor types, and Anxa2 is not involved in RCC cell proliferation. In the current study, we demonstrated that Anxa2 modulates RCC cell migration and invasion in vitro, and lower Anxa2 expression showed superior inhibitory abilities. These observations are similar to previous findings in several types of cancers. Anxa2 was reported to have Ca2þ-dependent filament-bundling activity through the heterotetrameric Anxa2-S100A10 complex. At sites of cholesterol-rich membrane domains, Anxa2 can regulate the organization of membrane-associated actin through promoting the association of lipid microdomains [27] or via conjunction with other actin-binding proteins, such as α-actinin, ezrin, and actin [28]. In the current study, suppression of Anxa2 using shRNA reduced cell spreading and inhibited the formation of stress fibers after seeding cells for 24 hours, whereas at 48 hours, stress fibers exhibited a shorter form, and cells presented irregular shapes (Figs. 3–5). Therefore, Anxa2 may regulate RCC cell motility through regulating actin cytoskeletal remodeling. Rho GTPases control downstream signal pathways of multiple cell surface receptors and are best known as regulators of the actin cytoskeleton (critically reviewed in Ref. [29]). In addition, the tyrosine phosphorylation switch in Anxa2 is important for triggering Rho-/ROCK-dependent and actin-mediated changes in cell morphology associated with the control of cell adhesion [30]. Here, treatment with a ROCK inhibitor enhanced A498 cell migration and invasion, whereas Cdc42 siRNA treatment produced inhibition. Moreover, Anxa2silenced A498 cells showed superior abilities to induce cell migration and invasion when sensitized to a ROCK
22.e20
S.-F. Yang et al. / Urologic Oncology: Seminars and Original Investigations 33 (2015) 22.e11–22.e21
inhibitor (Fig. 5C–F). This finding concurred with an earlier report that Anxa2 regulates Rho-membrane interactions, resulting in alterations in F-actin networks and inhibition of Caco-2 cell motility [31]. This evidence implies that Anxa2 promotes RCC cell motility through inhibiting activation of Rho-related signaling and increasing dynamic reorganization of the actin cytoskeleton. CXCL12/CXCR4 interactions are important in regulating tumor outgrowth and metastasis of CXCR4-expressing tumor cells. The expression of CXCR4 by tumor cells is regulated by hypoxia and angiogenic factors [32]. Overexpression of VHL in VHL-negative A498 cells decreased the CXCR4 expression level owing to its capacity to target hypoxia-inducible factor for degradation under normoxic conditions [33]. The strong expression of CXCR4 was correlated with the metastatic ability in an RCC mouse model and advanced human RCC specimens [34,35]. Anxa2-deficient animals showed decreases in CXCR4 and CXCR7 expressions in hematopoietic stem cells [18]. Herein, we showed that reduction of Anxa2 expression suppressed CXCR4 mRNA and protein expressions (Fig. 6). Therefore, Anxa2 may also participate in regulating CXCR4 expression, although the underlying mechanisms still need further investigation. These findings support the notion that in addition to controlling RCC cell motility, at least in part, Anxa2 may also increase the sensitivity to environmental stimuli and contribute to the metastatic potential through regulating the CXCR4 expression level. In addition to intracellular expression, Anxa2 also is a cell surface receptor for S100A10 and helps regulate cell surface generation of the proteolytic enzyme, plasmin, which contributes to cell invasion by digesting the extracellular matrix and other tissue barriers [7]. Zheng et al. [15] demonstrated that anti-Anxa2 antibodies inhibited pancreatic ductal adenocarcinoma and prolonged survival in an allograft mouse model. Treatment with anti-Anxa2 antibodies also inhibited ovary cancer cell motility and invasion in vitro and in vivo in a chick chorioallantoic membrane assay and an intraperitoneal xenograft mouse model [16]. Inasmuch as anti-Anxa2 antibodies are effective in inhibiting cancer cell metastasis in immunocompromised models, anti-Anxa2 antibodies may drive the activities of neutralization rather than cytotoxicity. This also implies that extracellular and intracellular Anxa2 may serve distinct functions in regulating cancer cell metastasis. Although extracellular Anxa2 expression in A498 and Achn cells was not observed by fluorescence-activated cell sorting, analysis (unpublished data), further studies to evaluate anti-Anxa2 antibodies in advanced RCC treatment are still recommended.
5. Conclusion In summary, we investigated expression levels of Anxa2 in RCC clinical specimens and its biological functions. Expression levels of Anxa2 were higher in RCC tissues and
were associated with a poor prognosis. Suppression of Anxa2 expression inhibited RCC cell motility through regulating the actin cytoskeleton. This study provides a molecular-based mechanism of Anxa2 positivity in the progression of RCC, and the level of Anxa2 can be considered an important prognostic factor in patients with RCC. Acknowledgments The authors thank Ms. Yu-Hua Wu and Mr. Yu-Hsuan Sung for technical support. Appendix A. Supporting Information Supplementary material cited in this article is available online at http://dx.doi.org/10.1016/j.urolonc.2014.08.015.
References [1] Gupta K, Miller JD, Li JZ, Russell MW, Charbonneau C. Epidemiologic and socioeconomic burden of metastatic renal cell carcinoma (mRCC): a literature review. Cancer Treat Rev 2008;34:193–205. [2] Arai E, Kanai Y. Genetic and epigenetic alterations during renal carcinogenesis. Int J Clin Exp Pathol 2010;4:58–73. [3] Lin JA, Fang SU, Su CL, Hsiao CJ, Chang CC, Lin YF, et al. Silencing glucose-regulated protein 78 induced renal cell carcinoma cell line G1 cell-cycle arrest and resistance to conventional chemotherapy. Urol Oncol 2014;32(1):29.e1–11. [4] Thadhani R, Pascual M, Bonventre JV. Acute renal failure. N Engl J Med 1996;334:1448–60. [5] Cheng CW, Rifai A, Ka SM, Shui HA, Lin YF, Lee WH, et al. Calcium-binding proteins annexin A2 and S100A6 are sensors of tubular injury and recovery in acute renal failure. Kidney Int 2005; 68:2694–703. [6] Cheng CW, Ka SM, Yang SM, Shui HA, Hung YW, Ho PC, et al. Nephronectin expression in nephrotoxic acute tubular necrosis. Nephrol Dial Transplant 2008;23:101–9. [7] Bharadwaj A, Bydoun M, Holloway R, Waisman D. Annexin A2 heterotetramer: structure and function. Int J Mol Sci 2013;14:6259–305. [8] Gerke V, Creutz CE, Moss SE. Annexins: linking Ca2þ signalling to membrane dynamics. Nat Rev Mol Cell Biol 2005;6:449–61. [9] Domoto T, Miyama Y, Suzuki H, Teratani T, Arai K, Sugiyama T, et al. Evaluation of S100A10, annexin II and B-FABP expression as markers for renal cell carcinoma. Cancer Sci 2007;98:77–82. [10] Ohno Y, Izumi M, Kawamura T, Nishimura T, Mukai K, Tachibana M. Annexin II represents metastatic potential in clear-cell renal cell carcinoma. Br J Cancer 2009;101:287–94. [11] Zimmermann U, Woenckhaus C, Pietschmann S, Junker H, Maile S, Schultz K, et al. Expression of annexin II in conventional renal cell carcinoma is correlated with Fuhrman grade and clinical outcome. Virchows Arch 2004;445:368–74. [12] Zhang L, Peng X, Zhang Z, Feng Y, Jia X, Shi Y, et al. Subcellular proteome analysis unraveled annexin A2 related to immune liver fibrosis. J Cell Biochem 2010;110:219–28. [13] Lokman NA, Elder AS, Ween MP, Pyragius CE, Hoffmann P, Oehler MK, et al. Annexin A2 is regulated by ovarian cancer-peritoneal cell interactions and promotes metastasis. Oncotarget 2013;4:1199–211. [14] Deng S, Jing B, Xing T, Hou L, Yang Z. Overexpression of annexin A2 is associated with abnormal ubiquitination in breast cancer. Genomics Proteomics Bioinformatics 2012;10:153–7.
S.-F. Yang et al. / Urologic Oncology: Seminars and Original Investigations 33 (2015) 22.e11–22.e21 [15] Zheng L, Foley K, Huang L, Leubner A, Mo G, Olino K, et al. Tyrosine 23 phosphorylation–dependent cell-surface localization of annexin A2 is required for invasion and metastases of pancreatic cancer. PloS One 2011;6:e19390. [16] Lokman NA, Ween MP, Oehler MK, Ricciardelli C. The role of annexin A2 in tumorigenesis and cancer progression. Cancer Microenviron 2011;4:199–208. [17] Ke TW, Hsu HL, Wu YH, Chen WT, Cheng YW, Cheng CW. MicroRNA-224 suppresses colorectal cancer cell migration by targeting Cdc42. Dis Markers 2014;2014:617150. [18] Jung Y, Shiozawa Y, Wang J, Patel LR, Havens AM, Song J, et al. Annexin-2 is a regulator of stromal cell-derived factor-1/CXCL12 function in the hematopoietic stem cell endosteal niche. Exp Hematol 2011;39:151e1–66e1. [19] Chiang Y, Schneiderman MH, Vishwanatha JK. Annexin II expression is regulated during mammalian cell cycle. Cancer Res 1993;53: 6017–21. [20] Chiang Y, Rizzino A, Sibenaller ZA, Wold MS, Vishwanatha JK. Specific down-regulation of annexin II expression in human cells interferes with cell proliferation. Mol Cell Biochem 1999;199:139–47. [21] Dong Z, Yao M, Zhang H, Wang L, Huang H, Yan M, et al. Inhibition of Annexin A2 gene transcription is a promising molecular target for hepatoma cell proliferation and metastasis. Oncol Lett 2014;7:28–34. [22] Bao H, Jiang M, Zhu M, Sheng F, Ruan J, Ruan C. Overexpression of Annexin II affects the proliferation, apoptosis, invasion and production of proangiogenic factors in multiple myeloma. Int J Hematol 2009;90:177–85. [23] Wang CY, Chen CL, Tseng YL, Fang YT, Lin YS, Su WC, et al. Annexin A2 silencing induces G2 arrest of non-small cell lung cancer cells through p53-dependent and -independent mechanisms. J Biol Chem 2012;287:32512–24. [24] Tatenhorst L, Rescher U, Gerke V, Paulus W. Knockdown of annexin 2 decreases migration of human glioma cells in vitro. Neuropathol Appl Neurobiol 2006;32:271–7.
22.e21
[25] Zhai H, Acharya S, Gravanis I, Mehmood S, Seidman RJ, Shroyer KR, et al. Annexin A2 promotes glioma cell invasion and tumor progression. J Neurosci 2011;31:14346–60. [26] Inokuchi J, Narula N, Yee DS, Skarecky DW, Lau A, Ornstein DK, et al. Annexin A2 positively contributes to the malignant phenotype and secretion of IL-6 in DU145 prostate cancer cells. Int J Cancer 2009;124:68–74. [27] Babiychuk EB, Draeger A. Annexins in cell membrane dynamics. Ca(2þ)-regulated association of lipid microdomains. J Cell Biol 2000;150:1113–24. [28] Gerke V, Moss SE. Annexins: from structure to function. Physiol Rev 2002;82:331–71. [29] Raftopoulou M, Hall A. Cell migration: Rho GTPases lead the way. Dev Biol 2004;265:23–32. [30] Rescher U, Ludwig C, Konietzko V, Kharitonenkov A, Gerke V. Tyrosine phosphorylation of annexin A2 regulates Rho-mediated actin rearrangement and cell adhesion. J Cell Sci 2008;121: 2177–85. [31] Babbin BA, Parkos CA, Mandell KJ, Winfree LM, Laur O, Ivanov AI, et al. Annexin 2 regulates intestinal epithelial cell spreading and wound closure through Rho-related signaling. Am J Pathol 2007;170: 951–66. [32] Liekens S, Schols D, Hatse S. CXCL12-CXCR4 axis in angiogenesis, metastasis and stem cell mobilization. Curr Pharm Des 2010;16: 3903–20. [33] Staller P, Sulitkova J, Lisztwan J, Moch H, Oakeley EJ, Krek W. Chemokine receptor CXCR4 downregulated by von Hippel-Lindau tumour suppressor pVHL. Nature 2003;425:307–11. [34] Wehler TC, Graf C, Biesterfeld S, Brenner W, Schadt J, Gockel I, et al. Strong expression of chemokine receptor CXCR4 by renal cell carcinoma correlates with advanced disease. J Oncol 2008;2008: 626340. [35] Pan J, Mestas J, Burdick MD, Phillips RJ, Thomas GV, Reckamp K, et al. Stromal derived factor-1 (SDF-1/CXCL12) and CXCR4 in renal cell carcinoma metastasis. Mol Cancer 2006;5:56.
