YJMCC-07712; No. of pages: 8; 4C: Journal of Molecular and Cellular Cardiology xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Journal of Molecular and Cellular Cardiology journal homepage: www.elsevier.com/locate/yjmcc

4Q1 5 6 7 8

F

3

ANO1 contributes to Angiotensin-II-activated Ca2 +-dependent Cl− current in human atrial fibroblasts

Antoun El Chemaly a,1, Caroline Norez a,1, Christophe Magaud a,1, Jocelyn Bescond a, Aurelien Chatelier a, Nassim Fares c, Ian Findlay a, Christophe Jayle b, Frederic Becq a, Jean-François Faivre a, Patrick Bois a,⁎ a b c

O

2

Original article

FRE CNRS 3511, Université de Poitiers, 1 rue Georges Bonnet, 86022 Poitiers Cedex, France Service de chirurgie cardio-thoracique, CHU Poitiers, France Laboratoire de Physiologie, Faculté de Médecine-PTS, USJ, Beyrouth, Liban

R O

1

9

i n f o

a b s t r a c t

P

a r t i c l e

Cardiac fibroblasts are an integral part of the myocardial tissue and contribute to its remodelling. This study characterises for the first time the calcium-dependent chloride channels (CaCC) in the plasma membrane of primary human atrial cardiac fibroblasts by means of the iodide efflux and the patch clamp methods. The calcium ionophore A23187 and Angiotensin II (Ang II) activate a chloride conductance in cardiac fibroblasts that shares pharmacological similarities with calcium-dependent chloride channels. This chloride conductance is depressed by RNAi-mediated selective Anoctamine 1 (ANO1) but not by Anoctamine 2 (ANO2) which has been revealed as CaCC and is inhibited by the selective ANO1 inhibitor, T16inh-A01. The effect of Ang II on anion efflux is mediated through AT1 receptors (with an EC50 = 13.8 ± 1.3 nM). The decrease of anion efflux by calphostin C and bisindolylmaleimide I (BIM I) suggests that chloride conductance activation is dependent on PKC. We conclude that ANO1 contributes to CaCC current in human cardiac fibroblasts and that this is regulated by Ang II acting via the AT1 receptor pathway. © 2014 Published by Elsevier Ltd.

D

Article history: Received 24 June 2013 Received in revised form 3 December 2013 Accepted 31 December 2013 Available online xxxx

T

E

Keywords: Human cardiac fibroblasts Calcium-dependent chloride channels Angiotensin II ANO1 TMEM16A

C

10 11 12 13 14 15 17 16 18 19 20 21 22 23 24

E

40 39

1. Introduction

42 43

Cardiac fibroblasts represent the most abundant of all non-muscular cell types in the mammalian heart. They contribute to cardiac development, myocardial structure, cell signalling and electro-mechanical function in healthy and diseased myocardium [1–3]. Fibroblasts are involved in the synthesis and remodelling of the extra-cellular matrix and production of many factors such as collagen, cytokines, growth factors and matrix metalloproteinases (MMP) [4,5]. They are sensitive to circulating hormones [6,7] which affect their proliferative response to pathological stimuli. In pathological states, such as cardiac hypertrophy, heart failure and arrhythmia, collagen deposition is dramatically augmented [8] and is associated with fibrosis. Fibrotic tissue remodelling is linked with increased expression of MMP and humoral factors, such as transforming growth factor TGF-β, endothelin-1, Angiotensin II, and tumour necrosis factor-α [4,5]. Several lines of evidence suggest that calcium signalling is essential for fibroblast function. For example, in mechanical-stimulation studies both Ca2 +-entry and intracellular Ca2 +-release are involved in the generation of mechanically induced potentials. It has been shown that intracellular Ca2 + contributes to Ang II-induced proliferation of cardiac fibroblasts [9,10].

48 49 50 51 52 53 54 55 56 57 58 59 60

R

N C O

46 47

U

44 45

R

41

⁎ Corresponding author. Tel.: +33 5 49 45 39 00; fax: +33 5 49 45 40 14. E-mail address: [email protected] (P. Bois). 1 Denotes equal contribution.

25 26 27 28 29 30 31 32 33 34 35 36 38 37

In many cell types such as the secretory epithelia, smooth muscle, exocrine glands, olfactory cells and sensory neurons [11] a rise in [Ca]i is implicated in their physiological functions through Ca2+-activated Cl− channel activation. Recently, several groups reported that TMEM16A and TMEM16B (also known as anoctamin-1 and 2 or ANO1 and 2) genes encode a CaCC [12–14] in heterologous expression systems. It has been reported that ANO1 can be activated by the stimulation of G-protein-coupled receptors by means of the PLC/Ins(1,4,5)P3 pathway [13]. This membrane protein is also expressed in various tumours, where it has been proposed to play a role in tumour cell proliferation [13,15–17]. Recently, ANO1 has been also proposed to act as a heat sensor in nociceptive neurons [18]. Given that many different ionic channels have been reported in human cardiac fibroblast cell lines [19] and that expression of these currents has already been demonstrated to be associated with important physiopathological consequences [20–29], we wondered if CaCC may participate in fibroblast excitability. Whereas anoctamins have been reported to be expressed in many tissues including the heart [30,31], nothing is known regarding their presence in cardiac fibroblasts. The purpose of this study was to verify the presence of the Ca2+-activated chloride current in human atria fibroblasts and identify the membrane protein associated with this CaCC activity. Using reverse transcriptase polymerase chain reaction (RT-PCR), iodide efflux and the patch clamp techniques combined with silencing of ANO1 we provide evidence that ANO1 is the major component of CaCC recorded in human

0022-2828/$ – see front matter © 2014 Published by Elsevier Ltd. http://dx.doi.org/10.1016/j.yjmcc.2013.12.027

Please cite this article as: El Chemaly A, et al, ANO1 contributes to Angiotensin-II-activated Ca2 +-dependent Cl− current in human atrial fibroblasts, J Mol Cell Cardiol (2014), http://dx.doi.org/10.1016/j.yjmcc.2013.12.027

61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85

2

A. El Chemaly et al. / Journal of Molecular and Cellular Cardiology xxx (2014) xxx–xxx

86 87

cardiac fibroblasts and that this chloride component is regulated by Ang II via AT1-receptor stimulation.

88 89

2.1. Fibroblast isolation and culture

2.4. Measurement of calcium fluorescence

149

90 91

To measure intracellular calcium concentration changes in cardiac fibroblasts, the Fluo-4 dye was used at the final concentration of 3 μM. The fluorescence was monitored with a confocal microscope (Bio-Rad MRC 1024). The excitation and emission wavelength of Fluo-4 are 488 and 522, respectively. Cells were superfused with normal Tyrode solution containing (mM): NaCl, 140; KCl, 5.4; CaCl2, 1.8; MgCl2, 1; D-glucose, 5.5; HEPES-NaOH, 5; pH = 7.4 in the absence and in the presence of Ang II.

150 151

2.5. Chemicals

157

104

Small segments of myocardium sampled from right atrial appendages were obtained from twenty two adult patients (mean age of donors was 69.25 years, 13 males and 9 females), without left ventricular dysfunction, undergoing heart surgery either for valve disease or for coronary artery disease. Sinus rhythm was present in all cases. Myocardial samples were removed during cannulation for cardiopulmonary bypass with extra-corporal circulation, a routine procedure comprising normal management of the patients. All procedures were carried out in accordance with the declaration of Helsinki. Fibroblasts were dissociated as previously described [32,23]. Cells were cultivated afterward for a maximum period of six days, to minimize possible phenotype changes which are known to occur during culture [33,34,10,4]. All experiments were carried out during this period of time. Positive immuno-staining for anti-fibronectin and anti-vimentin antibodies showed that over 98% of the cells were fibroblasts.

105

2.2. Iodide efflux

106

129

Calcium-activated chloride channel activity was assayed by measuring the rate of iodide (125I) efflux from cells as previously described [35]. All experiments were performed with a MultiPROBE®IIex robotic liquid handling system (PerkinElmer Life Sciences, Courtaboeuf, France). At the beginning of each experiment, cells were washed twice with efflux buffer containing (in mM) 136.9 NaCl, 5.4 KCl, 0.3 KH2PO4, 0.3 NaH2PO4, 1.3 CaCl2, 0.5 MgCl2, 0.4 MgSO4, 5.6 glucose and 10 HEPES, pH 7.4. Cells were then incubated in efflux buffer containing Na125I (1 μCi Na125I/ml, NEN, Boston, MA) for 1 h at 37 °C, then washed with efflux medium to remove extracellular 125I. The loss of intracellular 125I was determined by replacing the medium with fresh efflux buffer every 1 min for up to 10 min. The first three aliquots were used to establish a stable baseline in efflux buffer alone. A medium containing the appropriate drug was used for the remaining aliquots. Residual radioactivity was extracted with 0.1 N NaOH/0.1% SDS, and determined using a Packard Cobra ™II gamma counter (PerkinElmer life Sciences, Courtaboeuf, France). The fraction of initial intracellular 125I lost during each time point was collected and time-dependent rates of 125I efflux calculated from: ln (125It1 / 125It2) / (t1 − t2) where 125It is the intracellular 125I at time t, and t1 and t2 successive time points [35]. Curves were constructed by plotting rate of 125I versus time. All comparisons were based on maximal values for the time-dependent rates (k = peak rates, min−1) excluding the points used to establish the baseline (kpeak − kbasal, min−1), and histograms were presented as percentage of activation.

130

2.3. Electrophysiological recording

131

The whole-cell configuration of the patch-clamp technique was used to record ion currents via a patch-clamp amplifier (Axoclamp 200A, Axon Instruments). The standard extracellular solution had the following composition (in mM): NMDG-Cl 165, MgCl2 1, CaCl2 1.8, HEPES 10 and glucose 10 (pH 7.4). Patch electrodes (3–5 MΩ) were filled with a solution containing (in mM): NaCl 10, CsCl 57, MgCl2 3, Cs-glutamate 88, Mg-ATP 2, Na2-GTP 0.3, HEPES-CsOH 10 (pH 7.2). To test both Ang II and A23187 (calcium ionophore) we used the standard internal solution with low calcium buffering with 0.25 mM EGTA and 0.1 mM Ca2+ (solution 1; pCa = 7). The internal solution calcium concentration was otherwise fixed using high calcium buffering with 10 mM EGTA and 7.7 or 6.1 mM Ca2+ for 500 nM and 250 nM internal calcium free concentrations, respectively (solution 2). The osmolarity of both the internal and external solutions was maintained at 300 and 310 mOsm (with

115 116 117 118 119 120 121 122 123 124 125 126 127 128

132 133 134 135 136 137 138 139 140 141 142 143 144

O

152 153 154 155 156

2.6. Messenger RNA determination

162

Total RNA from human cardiac fibroblasts was isolated using Rnable reagent (Eurobio) followed by chloroform extraction and isopropanol precipitation. RNA integrity was evaluated by ethidium bromide staining on a 1% agarose gel. Total RNA was quantified by assessing optical density at 260 and 280 nm (NanoDrop ND-100 Labtech France). cDNA was synthesized using the Pd(N)6 random hexamer primer (GE Healthcare Life Sciences). 10 μL of total RNA (1–2 μg) was added to 12 μL of reaction mixture (100 mM Tris–HCl pH 8.3, 150 mM KCl, 6.25 mM MgCl2, 20 mM DTT, 2 mM dNTPs (Invitrogen) and 2.4 μg Random Primer p(dN)6 (GE Healthcare Life Sciences)). RNA was denatured at 65 °C for 2 min and then added to 40 U RNAse inhibitor (RNaseOUTInvitrogen) and 400 U M-MLV Reverse Transcriptase (Invitrogen) to 25 μL final volume. cDNA was synthesized at 37 °C for 1 h and then diluted to with 50 μL sterile water. Remaining enzymes were heat inactivated at 100 °C, 2 min. After the RT procedure, 5 μL of cDNA was added to 20 μL of PCR reaction mixture (250 mM Tris–HCl pH 8.4, 62.5 mM KCl, 2.5 mM MgCl2, 312.5 μM dNTPs, 10 pmol forward and reverse primers and 1.25 U of Taq Polymerase (Invitrogen)). Thermal cycles performed in a PTC-100 (M.J. Research, Inc.) were: 95 °C for 5 min, followed by 35 cycles at 55–64 °C for 30 s, 72 °C for 30 s, and 95 °C for 30 s. After the last cycle, samples were incubated at 55–64 °C for 4 min and at 72 °C for 10 min to ensure complete product extension. All primers and annealing temperature are described in Table 1. GAPDH was used as a positive control and the negative control consisted of the PCR reaction without the addition of the template. Amplified products were separated by electrophoresis on 2% agarose gels (containing 0.01% ethidium bromide) in Tris-Acetate-EDTA buffer and visualised using a UV Transilluminator. Bands were cut out of the gel and the products extracted using Macherey-Nagel gel extraction kit (NucleoSpin ExtractII), and then sequenced using the ABI prism Big Dye terminator method (V3.1 — Applied Biosystems).

163 164

Table 1 Sequences of the primers for RT-PCR (human).

t1:1 t1:2

E

D

R O

158

P

113 114

147 148

Ang II, A23187, flufenamic acid, 9-AC, DIDS, losartan, calphostin C and Forskolin were purchased from Sigma-Aldrich Co. (Saint-Quentin Fallavier, France). BIM I and A16inh-A01 were purchased from Calbiochem (Darmstadt, Allemagne).

T

111 112

C

109 110

E

107 108

R

102 103

R

100 101

O

98 99

C

96 97

N

94 95

U

92 93

F

145 146

2. Materials and methods

mannitol), respectively. All electrophysiological experiments were performed at room temperature (23–25 °C). The amplitudes of whole-cell membrane currents were normalized to cell capacitance and reported as pA.pF−1.

159 160 161

165 166 167 168 169 170 171 172 173 174 175 176 177 Q3 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193

Gene

mRNA accession number

Primers pair (5′-3′)

Amplicon size (pb)

t1:3Q2

GAPDH

NM_002046

350

ANO1

NM_018043

ANO2

NM_020373

Forward: CAATGCCTCCTGCACCAC Reverse: CCTGCTTCACCACCTTCTTG Forward: GCTGACATGGAGAGATCGGT Reverse: TCTTTGGGACCTCGATCTTG Forward: GGCAAGTTCTCTGTTATCAGC Reverse: AACCTCCTGGTCAAACTGTG

t1:4 t1:5 t1:6 t1:7 t1:8 t1:9

275 195

Please cite this article as: El Chemaly A, et al, ANO1 contributes to Angiotensin-II-activated Ca2 +-dependent Cl− current in human atrial fibroblasts, J Mol Cell Cardiol (2014), http://dx.doi.org/10.1016/j.yjmcc.2013.12.027

A. El Chemaly et al. / Journal of Molecular and Cellular Cardiology xxx (2014) xxx–xxx

212 213 214 215 216 217 218 219 220 221

F

232 233

O

210 211

Immediately after cell dissociation, fibroblasts were transferred on poly-D-lysine coated glass cover slips. After 8 days of culture, cells were washed and fixed with 4% paraformaldehyde in PBS for 1 h at 4 °C. A step of saturation/permeabilization was performed using PBS 0.5% BSA and 0.1% Triton X-100 for 2 h at room temperature. Samples were incubated overnight at 4 °C with a goat polyclonal antiTMEM16A antibody (Santa-Cruz, 1:50). Cells were then washed with PBS and incubated for 4 h with the secondary antibody Alexa Fluor 555-conjugated donkey anti-goat IgG (Invitrogen, 1:250). Nuclei were stained with 1000-fold diluted TOPRO-3 (Invitrogen) for 4 h and then cover slips were rinsed and mounted on slides in Mowiol (Sigma). The specificity of the primary anti-ANO1 antibody was confirmed (data not shown) using negative (HeLa) and positive (CFPAC1) control cells as previously reported [36]. The specificity of secondary antibody was confirmed by the absence of a signal when the primary antibody was omitted. Images were acquired and processed by using an inverted

T

208 209

231

C

206 207

2.8. Immunofluorescence staining

E

204 205

R

202 203

R

200 201

N C O

199

U

197 198

R O

Human cardiac fibroblasts were transfected with Lipofectamine® 2000 (Invitrogen) according to the manufacturer's instructions with 16:1 ratio (siRNA pmol:lipofectamine μl). ANO1 siRNA is a pool of three targets-specific 19–25 nt siRNAs designed to knock down gene expression. It was purchased from TebuBio. siRNA duplex against TMEM16B gene was a pool of three target-specific RNA sequence designed and synthesized by Eurogentec (GCAGCUCUGUCAUCAACAA, GCGCUAUGGAGUGUUCUAU and GGAGGAAUUUGAGCACAAU). A scrambled siRNA (Eurogentec) was used as negative control. For twenty-four well plates, 1 μl of lipofectamine diluted in 50 μl Opti-MEM I® medium was added to 16 pmol of siRNA duplex diluted in 50 μl Opti-MEM I® medium. The mixture was kept at room temperature for 20 min to form the transfection complexes. The complexes were then added to serum and antibiotic free DMEM (Lonza) and were swirled gently to ensure uniform distribution. After incubation for 6 h at 37 °C, medium was replaced with normal DMEM containing 10% Fetal calf serum (Biowest, South America), 100 units/ml penicillin and 0.1 mg/ml streptomycin. Twenty-four hours later, the cells were used for iodide efflux and patch-clamp studies. Real-time quantitative RT-PCR was used to examine the efficacy of TMEM16A siRNA and negative siRNA on TMEM16A mRNA expression before experiments (data not shown). Total RNA from human cardiac fibroblasts transfected with siRNA was isolated using Rnable reagent (Eurobio) according to the manufacturer's instructions. cDNA was synthesized using the Pd(N)6 random hexamer primer (GE Healthcare Life Sciences). Quantitative PCR was performed in the presence of 20 ng of cDNA and 16 μl reaction mixture containing 10 μl Taqman® Fast Universal Master Mix 2 × (Applied Biosystems), 1 μl of Taqman® Gene

222 223

P

195 196

Expression Assays 20× and 5 μl of water. Amplification was performed at 95 °C for 10 min, followed by 40 cycles at 95 °C (30 s) and 60 °C (30 s). Reactions were performed in MicroAmp optical 96-well reaction plates (Applied Biosystems) using a 7500HT Real-Time PCR system (Applied Biosystems). All measurements were normalized to GAPDH gene (endogenous control) to account for the variability in the initial concentration and quality of the total RNA. Taqman Gene expression Assays FAM/MGB probes were purchased from Applied Biosystems (Hs99999905_m1-Human GAPDH, Hs00216121_m1 ANO1).

D

2.7. siRNA transfection

E

194

3

Fig. 1. Analysis and pharmacological profile of chloride transport in human cardiac fibroblasts. (A) Time-dependent iodide efflux in human cardiac fibroblasts exposed to A23187 (1 μM), Ang II (0.1 μM), forskolin (Fsk, 10 μM) a cAMP agonist, a solution with pH 5 and basal solution. (B) Relative rates of iodide efflux presented as mean ± S.E.M. (n = 4). (C) The effects of 9-AC (1 mM), A16inh-AO1 (10 μM), FA (500 μM) and DIDS (500 μM) on A23187 (1 μM) induced iodide efflux. n = 4 for each condition. Each inhibition was normalized to its own control. The statistical analysis was a one way ANOVA followed by a Bonferroni's multiple comparison test (⁎⁎⁎p b 0.001; ⁎⁎p b 0.01 versus basal; ns: no significant difference). Basal was vehicle alone.

Please cite this article as: El Chemaly A, et al, ANO1 contributes to Angiotensin-II-activated Ca2 +-dependent Cl− current in human atrial fibroblasts, J Mol Cell Cardiol (2014), http://dx.doi.org/10.1016/j.yjmcc.2013.12.027

224 225 226 227 228 229 230

234 235 236 237 238 239 240 241 242 243 244 245 246 247

251

254 255

All results are expressed as means +/− S.E.M. of n observations. Sets of data were compared with either an analysis of variance (ANOVA) or Student's t test. Differences were considered statistically significant when p b 0.05. ns: no significant difference, ⁎p b 0.05, ⁎⁎p b 0.01, ⁎⁎⁎p b 0.001. All statistical tests were performed using GraphPad Prism.

256

3. Results

257

3.1. Evidence for CaCC activity in the plasma membrane of human cardiac fibroblasts

273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305

Fig. 2. The effects of A23187 and intracellular calcium upon whole cell patch clamp currents in human cardiac fibroblasts. (Aa) Families of currents evoked in the same cell by voltage steps to potentials between −100 and 100 mV. The pulses were applied in 20 mV increments every 10 s, from a holding potential of − 70 mV, before (upper panel) and in presence (middle panel) of A23187 (1 μM). (lower panel) A23187activated currents obtained by subtracting current values recorded in the upper and middle panels. The interrupted lines indicate zero current level. (Ab) Current density– voltage curves in the absence (●) or in the presence (■) of A23187. Current density– voltage curve of A23187-activated current ( ). (Data are means ± S.E.M.; n = 9). (B) Current density–voltage curves recorded from fibroblasts with different concentrations of calcium (250 and 500 nM) in the pipette solution. (Data are means ± S.E.M. n = 5).

T

271 272

C

269 270

E

267 268

R

265 266

R

263 264

3.2. Whole cell current recording of A23187-activated chloride current in human cardiac fibroblasts

O

261 262

The rate of iodide (125I) efflux was measured from human cardiac fibroblasts in order to examine the presence of Cl− transport. As illustrated in Fig. 1, cultured human cardiac fibroblasts were challenged by i) an NaCl-rich solution at pH 5 to activate acid-sensing chloride channels; ii) a solution containing the cAMP-agonist forskolin, an activator of CFTR channels [33]; iii) solutions containing either the Ca2 + ionophore A23187 or Ang II, both reported to increase intracellular calcium concentration [37,38]. Forskolin and the pH 5 solution did not stimulate iodide efflux (Fig. 1A). By contrast, Ang II and A23187 showed a significant stimulation of iodide efflux relative to basal (Fig. 1A). Note that the responses evoked by Ang II and A23187 were of the same order of magnitude. Fig. 1B summarises these results. Neither forskolin nor acidity succeeded in increasing iodide efflux which suggests the absence of either CFTR or acid dependent chloride conductances in these cells. However, the activation of iodide efflux by both A23187 and Ang II suggests the presence of the Ca2+-dependent Cl− channel in human cardiac fibroblasts. To characterise the anionic conductance induced by Ca2+ influx we studied the pharmacological profile and the transduction pathway of Cl− transport induced by Ca2+ ionophore A23187. Fig. 1C shows that the A23187-activated iodide efflux is inhibited by 60% by 9-AC, 77.7% by A16inh-A01, 87.3% by flufenamic acid and 92.3% by DIDS. This is the pharmacological profile of CaCC currents already reported on other excitable and non-excitable cells [11]. The inhibition by A16inh-A01 suggests strongly the contribution of ANO1 [39].

To characterise the electrophysiological signature of the anionic transport we studied this conductance using the patch clamp technique. Whole cell currents were recorded from cardiac fibroblasts before and during superfusion of the calcium ionophore A23187 (Fig. 2A). The intracellular solution (solution 1 see Materials and methods) contained a low concentration of EGTA (0.25 mM) and therefore, allowing transient calcium variation. Both recordings, in control and after perfusion of A23187 revealed dynamic outward currents at positive potentials. A23187-sensitive currents (obtained by subtracting the control current from the current recorded in the presence of calcium ionophore (Fig. 2A; bottom panel)) present the same properties. These currents markedly increased after perfusion of the Ca 2 +-ionophore. At + 100 mV the amplitude of the current was increased by 68% vs basal (n = 9). The effect of the ionophore was quasi-instantaneous. In this experimental series more than 95% of cells responded to A23187 stimulation. The resulting current density–voltage curves in Fig. 2Ab (top and bottom panels) present an outward going rectification and reversal potentials (Erev) estimated at −19.11 +/−2.26 mV and −20.43 +/−1.31 in control and after perfusion of A23187, respectively. These values are close to the theoretical Nernst equilibrium potential of −21 mV for a chloride-selective current (in the present ionic conditions). These

C

259 260

N

258

U

252 253

O

2.9. Statistics

R O

250

P

confocal laser-scanning microscope (FV1000, Olympus) and with FV10ASW software (Olympus).

D

248 249

F

A. El Chemaly et al. / Journal of Molecular and Cellular Cardiology xxx (2014) xxx–xxx

E

4

electrophysiological properties are those of calcium-dependent chloride currents. In order to study the calcium sensitivity of the chloride current, fibroblasts were dialysed for 5–7 min with a pipette solution (solution 2 see Materials and methods) containing 10 mM EGTA and various fixed Ca2 + concentrations (equivalent to 500 nM and 250 nM free Ca2 +). The membrane currents increased as the cytosolic free Ca2 + was increased from 250 to 500 nM and were markedly voltagedependent, with a strong activation at positive membrane potentials. The resulting current–voltage relationships were characterised by an outward rectification (Fig. 2B). The inward current component is not significantly modified by either intracellular concentrations of calcium. A similar outward rectification was described for TMEM16A (or ANO1) characterised in rat basilar smooth muscle cells [40]. Note that in the presence of 500 nM [Ca2+]i the reversal potential slightly shifted positively by 6.4 mV (i.e. from −19.00+/−6.80 mV to −12.6+/−2.32 mV), which could suggest contamination by another calcium-dependent conductance. Nevertheless, the chloride current recorded in the presence of 500 nM [Ca2+]i (at −120 mV) was inhibited by 85.0 ± 5.2% (n = 4) by 100 μM flufenamic acid (data not shown).

306

3.3. Molecular identity of CaCC in human cardiac fibroblasts

326

Recently, two members of the TMEM16 family, TMEM16A (ANO1) and TMEM16B (ANO2) have been proposed as candidates for CaCC [12–14]. To explore the molecular identities of the calcium-dependent chloride current in human cardiac fibroblasts we examined gene expression of these two members of the TMEM16 family with RT-PCR

327 328

Please cite this article as: El Chemaly A, et al, ANO1 contributes to Angiotensin-II-activated Ca2 +-dependent Cl− current in human atrial fibroblasts, J Mol Cell Cardiol (2014), http://dx.doi.org/10.1016/j.yjmcc.2013.12.027

307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325

329 330 331

A. El Chemaly et al. / Journal of Molecular and Cellular Cardiology xxx (2014) xxx–xxx

353 354 355 356 357 358 359

F

O

R O

351 352

P

349 350

D

347 348

E

345 346

T

343 344

363

C

341 342

Whole cell currents were recorded from cardiac fibroblasts before and during perfusion with Ang II (Fig. 4A). The intracellular solution (solution 1 see Materials and methods) contained a low concentration of EGTA (0.25 mM) and therefore, allowing transient calcium variation. The Ang II effect at 0.1 μM was not instantaneous (Fig. 4Aa) but it developed over 4 min after starting the perfusion. 32% of fibroblasts responded to Ang II stimulation. Both recordings in control and after perfusion of Ang II showed voltage-dependent dynamic outward currents for positive potentials (Fig. 4Ab). At +120 mV, the amplitude of the current was increased by Ang II by 43% (p b 0.05, n = 4) vs basal. The curves show an outward going rectification and a reversal potential estimated at − 14.67 +/− 7.89 mV. This value is not significantly different from the Erev estimated in the presence of A23187 (− 19.11 +/−2.26 mV) (p N 0.05). In the next series of experiments we investigated the pharmacological profile of Cl− transport induced by Ang II and studied its molecular identity with iodide efflux. Fig. 4B shows 68.8% blockade by 9-AC, 90.9% blockade by A16inh-A01, 91.8% blockade by FA and 92.0% blockade by DIDS of the iodide efflux activated by Ang II (0.1 μM). A similar sequence of inhibition had been obtained for iodide efflux induced by A23187 (Fig. 1C). Again, ANO1 siRNA significantly attenuated iodide (125I) (60.4% p b 0.0009) efflux induced by Ang II (Fig. 4C).

E

339 340

362

R

338

3.4. CaCC stimulated by Ang II

R

336 337

N C O

334 335

Taken together we consider that these data indicate that ANO1 medi- 360 ates a significant part of CaCC in human cardiac fibroblasts. 361

using specific primers targeting human genes for ANO1 and 2. Fig. 3A shows the significant gene expression obtained from four different human cardiac fibroblasts cultures (1 to 4). The positive control in this set of experiments was primers designed to GAPDH. No product was visible in the negative control sample. These results indicate that ANO1 and 2 are expressed in the four fibroblasts cultures with a weak signal for ANO2. The expression of ANO1 in fibroblasts was then investigated by immunofluorescence experiments (Fig. 3B). Cells incubated with specific ANO1 antibodies exhibited a clear staining at the membrane level that confirmed the presence of the protein. siRNA of both ANO1 and ANO2 was used as a complementary approach to examine the molecular identity of CaCC. Anionic efflux experiments indicate that ANO1 siRNA reduced significantly iodide (125I) efflux induced by treatment with the Ca2+ ionophore (Fig. 3C). The reduction is estimated at 45% (p b 0.0001, n = 8) when compared with control siRNA. In contrast, siRNA against ANO2 did not alter the anionic flux provoked by A23187. Knockdown of ANO1 with anti-ANO1 siRNA decreases CaCC recorded in the presence of 500 nM intracellular free-calcium (Fig. 3D). The reduction of current-density was 57.5% (p b 0.05, n = 7) at + 140 mV when compared to siRNA control. The reversal potentials measured in control conditions and in the presence of ANO1 siRNA were estimated at −12.71 +/−6.61 and −16.29 +/−4.53, respectively. Although the shift is not significant (p N 0.05) the apparent reversal potential values seem different to the theoretical Nernst equilibrium potential (−21 mV) for a purely chloride-selective current. It is possible that the measured currents are not entirely carried by chloride, but under our experimental conditions these values are far from those which might be carried by either monovalent or divalent cations.

U

332 333

5

Fig. 3. Molecular characterization of CaCC in human cardiac fibroblasts. (A) Gene expression obtained from four different human cardiac fibroblast cultures (1 to 4) using specific primers targeting human genes ANO1 and 2. (B) Confocal imaging of ANO1 channels in human atrial fibroblasts. Left panel: Light transmission imaging of fibroblasts merged with the TO-PRO®-3 stained nuclei (blue). Right panel: Cells were stained with anti-ANO1 antibody (red) and the nuclei were stained using TO-PRO®-3 (blue). Scaled bar corresponds to 20 μm. (C) Percentage of maximal activation of A23187 (1 μM) induced iodide efflux in untransfected human cells and cells transfected with: control siRNA; ANO1 siRNA and ANO2 siRNA. (⁎⁎⁎p b 0.001 versus untransfected cells; ns: no significant difference, n = 8). (D) (upper panel) Representative CaCC stimulated by 500 nM [Ca2+]i. Voltage steps to potentials between −100 and +140 mV from a holding potential of −70 mV (in increments of 20 mV) in cells transfected with control siRNA and ANO1. siRNA (lower panel) Current density–voltage plot of currents in cells transfected with either siRNA control (■) or with ANO1 siRNA (●). (Data are means ± S.E.M.; n = 7).

Please cite this article as: El Chemaly A, et al, ANO1 contributes to Angiotensin-II-activated Ca2 +-dependent Cl− current in human atrial fibroblasts, J Mol Cell Cardiol (2014), http://dx.doi.org/10.1016/j.yjmcc.2013.12.027

364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384

A. El Chemaly et al. / Journal of Molecular and Cellular Cardiology xxx (2014) xxx–xxx

D

P

R O

O

F

6

C

T

E

Fig. 4. Properties and molecular characterization of CaCC stimulated by Ang II in human cardiac fibroblasts. (A) CaCC activated by Ang II. (a) Whole cell current/density was obtained (at +120 mV) before and during perfusion with Ang II (0.1 μM). (b) Families of currents evoked in one cell by voltage steps to potentials between −60 and +120 mV. The pulses were applied in 20 mV increments from a holding potential of −70 mV, before (up left) and during (up right) perfusion of Ang II (0.1 μM). (Lower panel) Current density–voltage curves, in the absence (●) or in presence (▲) of 0.1 μM Ang II. Data are means ± S.E.M. (n = 6). (B) Histograms showing the effects of 9-AC (1 mM), A16inh-A01 (10 μM), FA (500 μM) and DIDS (500 μM) on Ang II (0.1 μM) induced iodide efflux. n = 4 for each condition. Each inhibition was normalized to its own control. The statistical analysis was a one way ANOVA followed by a Bonferroni's multiple comparison test (⁎⁎⁎p b 0.001, ⁎⁎p b 0.01 versus basal: ns, no significant difference) (C) Percentage of maximal activation of Ang II (0.1 μM) induced iodide efflux in untransfected cells and cells transfected with: control siRNA and ANO1 siRNA. (⁎⁎⁎p b 0.001 versus untransfected; ns: no significant difference, n = 8).

405

4. Discussion

406 407

In this study we show for the first time evidence for the presence of an anion transport activated by calcium-ionophore or Angiotensin II in the plasma membrane of human cardiac fibroblasts. This anion flux has a pharmacological profile similar to that of calcium-dependent chloride channels which have already been described in other excitable and non-excitable cells [42]. It is sensitive to several calcium-activated chloride channel inhibitors such as 9-AC, FA, DIDS [11] and by A16inh-A01, a

393 394 395 396 397 398 399 400 401 402

408 409 410 411 412

R

R

O

391 392

C

389 390

N

388

U

386 387

E

403 404

Then, using a fluorescent calcium probe we determined whether Ang II was indeed able to increase intracellular calcium concentration. The recordings were made from three different cells. Fig. 5A shows a direct and transient increase in calcium concentration with a peak of 25 s after Ang II perfusion. The intensity of this sudden increase of fluorescence varied from one cell to another. The dose–response relationship between Ang II and iodide efflux was measured revealing a half maximal effective concentration (EC50) of 13.8 ± 1.3 nM and a Hill coefficient, nH of 2.1 ± 0.6 (Fig. 5B). In order to characterise the transduction pathway of iodide efflux induced by Ang II, cells were incubated in presence of losartan, an AT1 receptor antagonist and either the PKA inhibitor (H89) or the PKC inhibitors (calphostin C and BIM I) (Fig. 5C). BIM I has been reported to be potent and selective PKC inhibitor [41]. The Ang II-induced effect was significantly repressed (89.4%) in the presence of losartan indicating that Ang II effects are mediated through AT1 receptors [14]. Calphostin C and BIM I significantly reduced the Ang II-induced iodide efflux by 64% and 61.2%, respectively. In contrast, H89 had no effect on the Ang II response, excluding the implication of PKA. These findings suggest that after binding to AT1 receptors, Ang II activates the PKC transduction pathway via the activation of phospholipase C.

385

specific inhibitor of ANO1 [39]. Moreover, both A23187 and Ang II induced a current which shared common electrophysiological features with calcium-activated chloride currents, such as time-and voltagedependent activation and strong outward rectification. Nevertheless, considering Erev values obtained in the presence of high intracellular calcium concentration (500 nM) we cannot exclude a small participation of another calcium-activated component in certain experiments. Further experiments are needed to characterise this point. The RT-PCR results suggest that the channel could be a member of the anoctamine family, a newly identified group of Cl− channels [12–14]. Knockdown of ANO1 with siRNA strongly attenuated CaCC in human cardiac fibroblasts while ANO2 siRNA had no inhibiting effect. In addition, the electrophysiological signature of the channels expressed by the genes coding for ANO1 and Ang II or A23187-activated chloride current is comparable [13,14]. The data supports the hypothesis that ANO1 participates to CaCC in human atrial cardiac fibroblast. The iodide efflux results indicate that Ang II acts via the AT1 receptor to induce anion efflux. Calcium imaging revealed that Ang II transiently increased the free intracellular calcium concentration. Hafizi et al. [43,34] also showed that Ang II induced a transient increase of [Ca]i in atrial fibroblast via AT1 and not AT2 receptors. In our experimental conditions, we noticed that the A23187 response in whole cell current recordings was more rapid and more reproducible than the response to Ang II. Even though such a difference in the response time can be easily explained by the action of the ionophore compared to an agonist acting through a transduction pathway, it is also plausible that the variability of the response to Ang II resulted from down-regulation of Ang II receptors [43,34]. It is well known for cardiac and smooth muscle cells [11] that the stimulation of AT1 receptors by Ang II results in the activation of phospholipase C. In

Please cite this article as: El Chemaly A, et al, ANO1 contributes to Angiotensin-II-activated Ca2 +-dependent Cl− current in human atrial fibroblasts, J Mol Cell Cardiol (2014), http://dx.doi.org/10.1016/j.yjmcc.2013.12.027

413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442

7

T

E

D

P

R O

O

F

A. El Chemaly et al. / Journal of Molecular and Cellular Cardiology xxx (2014) xxx–xxx

448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471

R

R

446 447

this case it is expected that PKC/inositol 1,4,5-triphosphate (IP3) represents the central pathway able to induce and regulate the calcium signal of human cardiac fibroblasts. It has been reported that ANO1 presents the same properties of regulation. For example, Ang II is able to activate CaCC in HEK cells co-transfected with ANO1 and the AT1 receptor [13]. In this study, consensus analysis predicted that ANO1 has multiple protein kinase C sites at intracellular segments. In addition to its role as a potent vasoconstrictive peptide, Ang II has been shown to stimulate cardiac fibroblast collagen synthesis [34] and proliferation [44] via the AT1 receptor subtype. ANO1 is considered as a regulator of proliferation [17]. The selective inhibitor of ANO1 (T16Ainh-A01) which inhibits the anion transport activated by calcium-ionophore or Ang II in human cardiac fibroblasts reduced the number of proliferating interstitial cells of Cajal in culture and inhibited proliferation in the pancreatic cancer cell line CFPAC-1 [16]. Experiments using the ANO1 selective inhibitor are required to examine the role of CaCC in fibrosis and in the proliferation of human cardiac fibroblasts. Kiseleva et al. [45,10] suggested that mechanically induced Ca2+ influx, induced through stretch-activated channels in the plasma membrane, and release of Ca2 + from the endoplasmic reticulum, play key roles in the genesis of the mechanically induced potential in rat cardiac fibroblasts. The calcium-activated chloride conductance that we report here might limit the depolarization induced by calcium entry via the activation of non-specific stretch-activated channels. Recently, it has been proposed that calcium influx through TRP channels such as TRPM7 [24] and TRPC3 [25] would play a central role in fibrogenesis and thus structural remodelling during human atrial fibrillation, suggesting a functional relation between ANO1 and TRP channels.

N C O

444 445

U

443

E

C

Fig. 5. Characterisation of the transduction pathway of iodide efflux induced by Ang II. (A) Fluorescence intensity of Fluo-4 dye in three cells before and during application of Ang II (0.1 μM). (B) Dose–response curve of Ang II stimulation of iodide efflux from human cardiac fibroblasts. (C) The transduction pathway of iodide efflux induced by Ang II (0.1 μM). Histograms presenting Ang II induced iodide efflux after incubation with losartan (10 μM), H89 (10 μM), Calphostin C (1 μM) and BIM I n = 4 for each condition. Each inhibition was normalized to its own control. The statistical analysis was a one way ANOVA followed by a Bonferroni's multiple comparison test (⁎⁎⁎p b 0.001; ⁎⁎p b 0.01; ns: no significant difference).

In conclusion, we identify the calcium-dependent chloride conductance of ANO1 in human cardiac fibroblasts. The contribution of this ion channel to the regulation of secretion by cardiac fibroblasts of growth factors, collagen and pro-inflammatory mediators released in certain pathological conditions such as ischemia, fibrosis and hypertrophy remains to be determined.

472

Disclosures

478

None declared. Acknowledgments

473 474 475 476 477

479 480

Grateful thanks are due to C. Combes and J. Habrioux for their excel- 481 lent technical assistance. A. El Chemaly was supported by LNCSR Scholar. 482 C. Norez was supported by VLM. 483 References [1] Kohl P, Noble D. Mechanosensitive connective tissue. Potential influence on heart rhythm. Cardiovasc Res 1996;32:62–8. [2] MacKenna D, Summerour SR, Villarreal FJ. Role of mechanical factors in modulating cardiac fibroblast function and extracellular matrix synthesis. Cardiovasc Res 2000;46:257–63. [3] Sun Y, Kiani MF, Postlethwaite AE, Weber KT. Infarct scar as living tissue. Basic Res Cardiol 2002;97:343–7. [4] Camelliti P, Borg TK, Kohl P. Structural and functional characterisation of cardiac fibroblasts. Cardiovasc Res 2005;65:40–51. [5] Baudino TA, Carver W, Giles W, Borg TK. Cardiac fibroblasts: friend or foe? Am J Physiol Heart Circ Physiol 2006;14:H1015–26. [6] Brilla CG, Maisch B, Zhou G, Weber KT. Hormonal regulation of cardiac fibroblast function. Eur Heart J 1995;16:45–50.

Please cite this article as: El Chemaly A, et al, ANO1 contributes to Angiotensin-II-activated Ca2 +-dependent Cl− current in human atrial fibroblasts, J Mol Cell Cardiol (2014), http://dx.doi.org/10.1016/j.yjmcc.2013.12.027

484 485 486 487 488 489 490 491 492 493 494 495 496 497

D

P

R O

O

F

[27] Ledoux J, Greenwood I, Villeneuve LR, Leblanc N. Modulation of Ca2+-dependent Cl − channels by calcineurin in rabbit coronary arterial myocytes. J Physiol 2003;552:701–14. [28] Shibukawa Y, Chilton EL, Maccannell KA, Clark RB, Giles WR. K+ currents activated by depolarization in cardiac fibroblasts. Biophys J 2005;88:3924–35. [29] Stockbridge LL, French AS. Characterization of a calcium-activated potassium channel in human fibroblasts. Can J Physiol Pharmacol 1989;67:1300–7. [30] Schreiber R, Uliyakina I, Kongsuphol P, Warth R, Mirza M, Martins JR, et al. Expression and function of epithelial anoctamins. J Biol Chem 2010;285(10):7838–45. [31] Kunzelmann K, Tian Y, Martins JR, Faria D, Kongsuphol P, Ousingsawat J, et al. Anoctamins. Pflugers Arch 2011;462(2):195–208. [32] Hatem SN, Benardeau A, Rucker-Martin C, Marty I, de Chamisso P, Villaz M, et al. Different compartments of sarcoplasmic reticulum participate in the excitation–contraction coupling process in human atrial myocytes. Circ Res 1997;80:345–53. [33] Eghbali M. Cardiac fibroblasts: function, regulation of gene expression, and phenotypic modulation. Basic Res Cardiol 1992;87:183–9. [34] Hafizi S, Wharton J, Morgan K, Allen S, Chester A, Catravas JD, et al. Expression of functional angiotensin-converting enzyme and AT1 receptors in cultured human cardiac fibroblasts. Circulation 1998;98:2553–9. [35] Norez C, Heda GD, Jensen T, Kogan I, Hughes LK, Auzanneau C, et al. Determination of CFTR chloride channel activity and pharmacology using radiotracer flux methods. J Cyst Fibros 2004;3:119–21. [36] Kunzelmann K, Kongsuphol P, Aldehni F, Tian Y, Ousingsawat J, Warth R, et al. Bestrophin and TMEM16-Ca(2+) activated Cl(−) channels with different functions. Cell Calcium 2009;46(4):233–41. [37] Lipecka J, Norez C, Bensalem N, Baudouin-Legros M, Planelles G, Becq F, et al. Rescue of DeltaF508-CFTR (Cystic fibrosis transmembrane conductance regulator) by curcumin: involvement of the keratin 18 network. J Pharmacol Exp Ther 2006;317:500–5. [38] Robert R, Norez C, Becq F. Disruption of CFTR chloride channel alters mechanical properties and cAMP-dependent Cl− transport of mouse aortic smooth muscle cells. J Physiol 2005;568:483–95. [39] Namkung W, Phuan PW, Verkman AS. TMEM16A inhibitors reveal TMEM16A as a minor component of calcium-activated chloride channel conductance in airway and intestinal epithelial cells. J Biol Chem 2011;286(3):2365–74. [40] Wang M, Yang H, Zheng LY, Zhang Z, Tang YB, Wang GL, et al. Downregulation of TMEM16A calcium-activated chloride channel contributes to cerebrovascular remodeling during hypertension by promoting basilar smooth muscle cell proliferation. Circulation 2012;125:697–707. [41] Toullec D, Pianetti P, Coste H, Bellevergue P, Grand-Perret T, Ajakane M, et al. The bisindolylmaleimide GF 109203X is a potent and selective inhibitor of protein kinase C. J Biol Chem 1991;266(24):15771–81. [42] Leblanc N, Ledoux J, Saleh S, Sanguinetti A, Angermann J, O'Discroll K, et al. Regulation of calcium-activated chloride channels in smooth muscle cells: a complex picture is emerging. Can J Physiol Pharmacol 2005;83:541–56. [43] Hafizi S, Chester AH, Yacoub MH. Differential response of human cardiac fibroblasts to angiotensin I and angiotensin II. Peptides 2004;25:1031–3. [44] Sadoshima J, Izumo S. Molecular characterization of angiotensin II-induced hypertrophy of cardiac myocytes and hyperplasia of cardiac fibroblasts. Critical role of the AT1 receptor subtype. Circ Res 2003;73:413–23. [45] Kiseleva I, Kamkin A, Kohl P, Lab MJ. Calcium and mechanically induced potentials in fibroblasts of rat atrium. Cardiovasc Res 1996;32:98–111.

E

C

T

[7] Griffin M, Lee HW, Zhao L, Eghbali-Webb M. Gender-related differences in proliferative response of cardiac fibroblasts to hypoxia: effects of estrogen. Mol Cell Biochem 2000;215:21–30. [8] Kusachi S, Ninomiya Y. Myocardial infarction and cardiac fibrogenesis. Cellular and molecular basis. Razzaque Eurekah Press; 2003. [9] Olson ER, Shamhart PE, Naugle JE, Meszaros JG. Angiotensin II-induced extracellular signal-regulated kinase 1/2 activation is mediated by protein kinase Cdelta and intracellular calcium in adult rat cardiac fibroblasts. Hypertension 2008;51:704–11. [10] Kiseleva I, Kamkin A, Pylaev A, Kondratjev D, Leiterer KP, Theres H, et al. Electrophysiological properties of mechanosensitive atrial fibroblasts from chronic infarcted rat heart. J Mol Cell Cardiol 1998;30:1083–93. [11] Hartzell C, Putzier I, Arreola J. Calcium-activated chloride channels. Annu Rev Physiol 2005;67:719–58. [12] Caputo A, Caci E, Ferrera L, Pedemonte N, Barsanti C, Sondo E, et al. TMEM16A, a membrane protein associated with calcium-dependent chloride channel activity. Science 2008;322:590–4. [13] Yang YD, Cho H, Koo JY, Tak MH, Cho Y, Shim WS, et al. TMEM16A confers receptoractivated calcium-dependent chloride conductance. Nature 2008;455:1210–5. [14] Schroeder BC, Cheng T, Jan YN, Jan LY. Expression cloning of TMEM16A as a calciumactivated chloride channel subunit. Cell 2008;134:1019–29. [15] Lee CH, Liang CW, Espinosa I. The utility of discovered on gastrointestinal stromal tumor 1 (DOG1) antibody in surgical pathology-the GIST of it. Adv Anat Pathol 2010;17:222–32. [16] Mazzone A, Eisenman ST, Strege PR, Yao Z, Ordog T, Gibbons SJ, et al. Inhibition of cell proliferation by a selective inhibitor of the Ca2+-activated Cl− channel, Ano1. Biochem Biophys Res Commun 2012;427:248–53. [17] Stanich JE, Gibbons SJ, Eisenman ST, Bardsley MR, Rock JR, Harfe BD, et al. Ano1 as a regulator of proliferation. Am J Physiol Gastrointest Liver Physiol 2011;301:G1044–51. [18] Cho H, Yang YD, Lee J, Lee B, Kim T, Jang Y, et al. The calcium-activated chloride channel anoctamin 1 acts as a heat sensor in nociceptive neurons. Nat Neurosci 2012;15:1015–21. [19] Li GR, Sun HY, Chen JB, Zhou Y, Tse HF, Lau CP. Characterization of multiple ion channels in cultured human cardiac fibroblasts. PLoS One 2009;4(10):e7307. [20] Benamer N, Fares N, Bois P, Faivre JF. Electrophysiological and functional effects of sphingosine-1-phosphate in mouse ventricular fibroblasts. Biochem Biophys Res Commun 2011;408:6–11. [21] Chatelier A, Mercier A, Tremblier B, Thériault O, Moubarak M, Benamer N, et al. A distinct de novo expression of Nav1.5 sodium channels in human atrial fibroblasts differentiated into myofibroblasts. J Physiol 2012;590:4307–19. [22] Chilton L, Ohya S, Freed D, George E, Drobic V, Shibukawa Y, et al. K+ currents regulate the resting membrane potential, proliferation, and contractile responses in ventricular fibroblasts and myofibroblasts. Am J Physiol Heart Circ Physiol 2005;288:H2931–9. [23] El Chemaly A, Guinamard R, Demion M, Fares N, Jebara V, Faivre J-F, et al. A voltageactivated proton current in human cardiac fibroblasts. Biochem Biophys Res Commun 2006;340:512–6. [24] Du J, Xie J, Zhang Z, Tsujikawa H, Fusco D, Silverman D, et al. TRPM7-mediated Ca2+ signals confer fibrogenesis in human atrial fibrillation. Circ Res 2010;106:992–1003. [25] Harada M, Luo X, Qi XY, Tadevosyan A, Maguy A, Ordog B, et al. Transient receptor potential canonical-3 channel-dependent fibroblast regulation in atrial fibrillation. Circulation 2012;126:2051–64. [26] Kamkin A, Kiseleva, Isenberg G. Activation and inactivation of a non-selective cation conductance by local mechanical deformation of acutely isolated cardiac fibroblasts. Cardiovasc Res 2003;57:793–809.

R

498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 Q4 549 550

A. El Chemaly et al. / Journal of Molecular and Cellular Cardiology xxx (2014) xxx–xxx

E

8

U

N

C

O

R

605

Please cite this article as: El Chemaly A, et al, ANO1 contributes to Angiotensin-II-activated Ca2 +-dependent Cl− current in human atrial fibroblasts, J Mol Cell Cardiol (2014), http://dx.doi.org/10.1016/j.yjmcc.2013.12.027

551 552

553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604