Antagonism of the STING Pathway via Activation of the AIM2 Inflammasome by Intracellular DNA Leticia Corrales, Seng-Ryong Woo, Jason B. Williams, Sarah M. McWhirter, Thomas W. Dubensky, Jr. and Thomas F. Gajewski J Immunol published online 29 February 2016 http://www.jimmunol.org/content/early/2016/02/26/jimmun ol.1502538
Supplementary Material
http://www.jimmunol.org/content/suppl/2016/02/26/jimmunol.150253 8.DCSupplemental.html
Subscriptions
Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscriptions
Permissions Email Alerts
Submit copyright permission requests at: http://www.aai.org/ji/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/cgi/alerts/etoc
The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 9650 Rockville Pike, Bethesda, MD 20814-3994. Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ at George Mason Univ Acq Dept/MSN/2 Fl on February 29, 2016
This information is current as of February 29, 2016.
Published February 29, 2016, doi:10.4049/jimmunol.1502538 The Journal of Immunology
Antagonism of the STING Pathway via Activation of the AIM2 Inflammasome by Intracellular DNA Leticia Corrales,* Seng-Ryong Woo,* Jason B. Williams,* Sarah M. McWhirter,† Thomas W. Dubensky, Jr.,† and Thomas F. Gajewski*,‡
S
pontaneous T cell responses against a growing tumor frequently occur, despite the absence of infectious agents; and the presence of activated CD8+ T cells in the tumor microenvironment correlates with improved prognosis (1). We and others have identified that production of host type I IFN has a critical role in the spontaneous activation of specific tumor CD8+ T cells (2, 3). Mechanistic studies using transplantable tumors in mice deficient in key innate sensing molecules showed that deficiency in the adaptor stimulator of IFN genes (STING) or the downstream transcription factor IFN regulatory factor (IRF) 3, blunted T cell priming, and impaired rejection of immunogenic tumors (4). Moreover, presence of DNA was found in the cytosol of intratumoral DCs, which correlated with IRF3 translocation to the nucleus and expression of IFN-b. These data suggest that activation of the STING pathway plays a critical role in the innate immune sensing of tumors in vivo, apparently through cytosolic sensing of DNA.
*Department of Pathology, The University of Chicago, Chicago, IL 60637; †Aduro Biotech, Berkeley, CA 94710; and ‡Section of Hematology/Oncology 2, Department of Medicine, The University of Chicago, Chicago, IL 60637 ORCIDs: 0000-0002-2800-4156 (L.C.); 0000-0002-4843-5113 (S.-R.W.); 00000001-7123-6940 (J.B.W.); 0000-0003-0726-4597 (T.W.D.). Received for publication December 7, 2015. Accepted for publication January 21, 2016. This work was supported by National Institutes of Health Grant R01CA181160. L.C. is supported by a Cancer Research Institute Irvington postdoctoral fellowship. Address correspondence and reprint requests to Dr. Thomas F. Gajewski, University of Chicago, 5841 South Maryland Avenue, MC2115, Chicago, IL 60637. E-mail address: [email protected] The online version of this article contains supplemental material. Abbreviations used in this article: Ac-YVAD-CMK, Ac-Tyr-Val-Ala-Asp-chloromethylketone; AIM, absent in melanoma 2; ALR, absent in melanoma 2–like receptor; ASC, apoptosis-associated specklike protein; BM-DC, bone marrow–derived dendritic cell; cGAMP, cyclic GMP-AMP; cGAS, sensor GMP-AMP synthase; HA, hemagglutinin; IRF, IFN regulatory factor; LC/MS/MS, liquid chromatography-tandem mass spectrometry; LDH, lactate dehydrogenase; STING, stimulator of IFN gene; TBK1, TANKbinding kinase 1; WT, wild-type. Copyright Ó 2016 by The American Association of Immunologists, Inc. 0022-1767/16/$30.00 www.jimmunol.org/cgi/doi/10.4049/jimmunol.1502538
STING is an adaptor protein located in the endoplasmic reticulum. In the presence of cytosolic DNA, the sensor GMP-AMP synthase (cGAS) produces cyclic GMP-AMP (cGAMP), which binds to STING and triggers its activation (5, 6). Aggregated STING translocates in vesicles from the endoplasmic reticulum to perinuclear sites (7). This is accompanied by TANK-binding kinase 1 (TBK1) recruitment, IRF3 phosphorylation and nuclear translocation (8), and transcription of type I IFN and other immune genes (9–11). Activation of the STING pathway is critical in the host defense against pathogens (12) and in the generation of an antitumor T cell response. However, its inappropriate activation leads to the generation of autoimmune diseases such as Aicardi-Goutie`res syndrome (13) or systemic lupus erythematosus (14). Thus, several regulatory mechanisms coexist to keep production of type I IFN in check. Two levels of negative regulation of the STING pathway have been described: elimination of aberrant DNA by DNases (15) and posttranslational modification of STING following its activation (16). However, the fact that the type I IFN response to DNA stimulation is enhanced in Aim2-deficient cells (17–20) suggests that another potential level of negative regulation of the STING pathway may occur when additional innate immune pathways are simultaneously activated. The presence of cytosolic DNA also triggers formation of the absent in melanoma 2 (AIM2) inflammasome, a heterocomplex that contains AIM2, the adaptor protein apoptosis-associated specklike protein (ASC), and caspase-1. This leads to activation of caspase-1 that generates matured forms of IL-1b and IL-18 (21), and pyroptosis, a form of cell death (22). Whether the AIM2 inflammasome influences STING pathway activation has not yet been described. In the current report, we investigated the regulatory role of the AIM2 inflammasome on STING pathway activation in vitro. We found increased cGAMP generation, STING aggregation, TBK1 and IRF3 phosphorylation, and IFN-b transcription in AIM2 inflammasome-deficient APCs upon cytosolic DNA exposure. Mechanistically, a major component of this effect could be the decreased cell death in inflammasomedeficient cells. Our results indicate an inhibitory effect of the AIM2
Downloaded from http://www.jimmunol.org/ at George Mason Univ Acq Dept/MSN/2 Fl on February 29, 2016
Recent evidence has indicated that innate immune sensing of cytosolic DNA in dendritic cells via the host STING pathway is a major mechanism leading to spontaneous T cell responses against tumors. However, the impact of the other major pathway triggered by intracellular DNA, the absent in melanoma 2 (AIM2) inflammasome, on the functional output from the stimulator of IFN genes (STING) pathway is poorly understood. We found that dendritic cells and macrophages deficient in AIM2, apoptosis-associated specklike protein, or caspase-1 produced markedly higher IFN-b in response to DNA. Biochemical analyses showed enhanced generation of cyclic GMP-AMP, STING aggregation, and TANK-binding kinase 1 and IFN regulatory factor 3 phosphorylation in inflammasome-deficient cells. Induction of pyroptosis by the AIM2 inflammasome was a major component of this effect, and inhibition of caspase-1 reduced cell death, augmenting phosphorylation of TANK-binding kinase 1/IFN regulatory factor 3 and production of IFN-b. Our data suggest that in vitro activation of the AIM2 inflammasome in murine macrophages and dendritic cells leads to reduced activation of the STING pathway, in part through promoting caspase-1–dependent cell death. The Journal of Immunology, 2016, 196: 000–000.
2
AIM2 INFLAMMASOME ANTAGONIZES THE STING PATHWAY
inflammasome on the STING pathway in response to cytosolic DNA and suggest that targeted inflammasome inhibition could represent a strategy for prolonging APC survival in the context of cytosolic DNA sensing, leading to potentiation of the STING pathway.
Murine IFN-b ELISA
Materials and Methods
Quantitative RT-PCR
Cells and cell isolations
Total RNA was isolated using the RNeasy kit (Qiagen) and incubated with DNase I, Amplification Grade (Invitrogen). cDNA was synthesized using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and expression of IFN-b, CXCL10, and GAPDH as endogenous control was measured by real-time quantitative RT-PCR with specific primers and universal probes from Roche for mouse IFN-b (59: GGAAAGATTGACGTGGGAGA; 39: CCTTTGCACCCTCCAGTAAT; and universal probe number 108), mouse CXCL10 (59: GCTGCCGTCATTTTCTGC; 39: TCTCACTGG CCCGTCATC; and universal probe number 3), and mouse GAPDH (59: AGCTTGTCATCAACGGGAAG; 39: TTTGATGTTAGTGGGGTCTCG; and universal probe number 9) using a 7300 Real Time PCR system (Applied Biosystems). The results are expressed as relative expression to GAPDH. The expression of Aim2, p204, and p202b was analyzed using the primers described in Brunette et al. (24).
Purification of tumor-derived DNA Tumor-derived DNA was used for all stimulations; for simplification, it is referred to as “DNA” throughout the manuscript. Genomic DNA from B16.F10 melanoma cells was purified using the QIAamp DNA Mini Kit according to the manufacturer’s instructions (Qiagen). To ensure DNA was free of other danger signals (i.e., LPS), immortalized STING2/2 macrophages were stimulated with the purified DNA to assess for STING dependence, and WT macrophages were stimulated with DNAse I–treated DNA. In both cases, there was no expression of IFN-b.
Stimulation of APCs with tumor-derived DNA or DMXAA Immortalized macrophages or BM-DCs were stimulated with different concentrations of DNA in the presence of Lipofectamine 2000 (Invitrogen). For some experiments, macrophages were stimulated with 50 mg/ml DMXAA (Selleckchem).
ImageStream analysis of STING aggregates Cells stimulated with 1 mg/ml DNA or 50 mg/ml DMXAA were stained with anti–CD11b-allophycocyanin (M1/70; BioLegend), rabbit anti-hemagglutinin (HA)-tag (C29F4; Cell Signaling Technology), anti-rabbit IgG-PE (Invitrogen), and DAPI (Invitrogen). Single-cell images were acquired in the ImageStreamxMark II (Amnis), and data were analyzed using IDEAS software.
Western blot analysis Whole-cell extracts were electrophoresed in 10% SDS-PAGE gels and transferred onto Immobilon-FL membranes (Millipore). Blots were incubated with Abs specific for p-TBK1 (Ser172), pIRF3 (Ser396), total TBK1, total IRF3, cGAS, STING, GAPDH, or b-actin (Cell Signaling Technology). For ASC-myc detection in ASC2/2 macrophages, anti-ASC (Millipore) was used. For p204-myc detection in WT macrophages, anti-myc (Cell Signaling Technology) was used. Anti-rabbit or anti-mouse IRDye 680RD label secondary Abs were used for visualization of bands with the Odyssey Imaging system (LI-COR).
FIGURE 1. IFN-b triggered by DNA is enhanced in Aim2-deficient cells. (A and B) Aim2+/+ and Aim22/2 BM-DCs were stimulated with tumor-derived DNA in the presence of Lipofectamine (Invitrogen). The relative expression of IFN-b after 4 h of incubation was assessed by quantitative PCR and normalized by GAPDH expression (A), and the amount of IFN-b in the supernatant after 8 h of incubation was measured by ELISA (B). (C) Aim2+/+ and Aim22/2 macrophages were stimulated with 0, 0.0001, 0.001, 0.01, 0.1, or 1 mg/ml of DNA in the presence of Lipofectamine for 4 h. The relative expression of IFN-b was assessed by quantitative PCR and normalized by GAPDH expression. Data represent a pool of three independent experiments (A and B) or a representative experiment of two repetitions (C). Results are shown as mean 6 SEM. **p , 0.01, ***p , 0.001.
Downloaded from http://www.jimmunol.org/ at George Mason Univ Acq Dept/MSN/2 Fl on February 29, 2016
Immortalized wild-type (WT), Aim22/2, ASC2/2, and caspase-12/2/112/2 macrophages were obtained as described in Roberson and Walker (23). Cells were maintained in DMEM supplemented with 10% heat-inactivated FCS, penicillin, streptomycin, L-arginine, L-glutamine, folic acid, and L-asparagine. Bone marrow–derived dendritic cells (BM-DCs) were generated from the tibiae and femurs of WT, Aim22/2, ASC2/2, caspase-12/2/ 112/2 female mice of age 6 to 8 wk. Mice were housed in the specific pathogen-free animal facility at the University of Chicago. Cells were cultured in DMEM supplemented with 10% heat-inactivated FCS, penicillin, streptomycin, L-arginine, L-glutamine, folic acid, and L-asparagine and the presence of recombinant murine GM-CSF (20 ng/ml; BioLegend) for 9 d. All cells were maintained at 37˚C with 5% CO2. The macrophages used throughout the study were immortalized and the BM-DCs were primary cells. For stable overexpression of myc-ASC in ASC2/2 macrophages, the full-length mASC-myc DNA sequence was generated by PCR. Sequenceencoding full-length mASC was amplified from MGC Mouse Pycard cDNA (Dharmacon) using a 59 primer containing an EcoR1 site and atg and myc sequence: GAATTCTCGAGATGGAGCAGAAGCTGATTTCCGAGGAGGACCTGGGGCGGGCACGAGATGCCATCCTGGACGCTCTTGAAAACTTGTCAGGGGATGAACTCAAAAAGTTCAAGATGAAGCTGCTGACAGTGCAACTGC; and a 39 primer containing the NotI site: TATATGCGGCCGCTCAGCTCTGCTCCAGGTCCATCACCAAGT. For stable overexpression of myc-p204 in WT macrophages, the fulllength p204-myc DNA sequence was generated by PCR. Sequenceencoding full-length p204 was amplified from MGC Mouse p204 cDNA (Dharmacon) using a 59 primer containing an EcoR1 site and atg and myc sequence: GTGAATTCATGGAGCAGAAGCTGATTTCCGAGGAGGACCTGGTGAATGAATACAAGAGAATTGTTCTGCTGAGAGGACTTGAATGTATC; and a 39 primer containing the NotI site: atGCGGCCGCTCACTTTCTAGCATTGATGACCT. The mouse myc-ASC or myc-p204 PCR products were gel purified and double digested with EcoRI and NotI and then cloned into the multiple cloning site of pMXS-IRES-GFP with the Quick ligation kit (New England Biolabs).
Conditioned media from cells stimulated with DNA were collected after 12 (macrophages) or 8 (BM-DCs) h. IFN-b concentration was assessed using VeriKine Mouse IFN-b ELISA Kit (PBL InterferonSource) according to the manufacturer’s instructions.
The Journal of Immunology Bioanalytical method for detection of cGAS product cGAMP was quantified via liquid chromatography-tandem mass spectrometry (LC/MS/MS) at Climax Laboratories (San Jose, CA). Briefly, 1 million macrophages or BM-DCs were stimulated with DNA for 1 h and then resuspended in PBS. cGAMP was extracted with 100% acetonitrile and analyzed by an LC/MS/MS system, Sciex API-4000Qtrap Mass Spectrometer and a Shimadzu HPLC/Autosampler with an ACE C18 column (2.1 3 100 mm, 5 mm). Positive electronic spray ionization and multiple reactions monitor were used. The multiple reactions monitor transition of the test compound was 675/136 (m/z). The HPLC mobile phase A and B was 0.5% formic acid in 5 mmol NH4Ac solution and acetonitrile/water (9/1) with 0.5% formic acid. A related compound, Rp,Rp-c-diAMPSS, was used as an internal standard. The limit of quantification was 1.0 ng/ml, and the dynamic range was 1.0–500 ng/ml.
Culture medium from cells stimulated with DNA was collected and incubated with the reaction mixture from the LDH Cytotoxicity Assay Kit (Pierce) according to the manufacturer’s instructions. The rates of cell death were calculated using the absorbance values from DNA-stimulated
cells (experimental cell death), Triton X–treated cells (100% of cell death), and culture medium–treated (spontaneous cell death) and applying the formula: (experimental cell death 2 spontaneous cell death)/(100% cell death 2 spontaneous cell death) 3 100%.
Statistical analysis Differences between two treatment groups were analyzed with the twosided Student t test using Prism 6 software (GraphPad). Statistically significant p values are labeled in the figures and legends with asterisks.
Results Elimination of components of the AIM2 inflammasome potentiates STING-dependent production of IFN-b in APCs We previously had demonstrated that the introduction of DNA into the cytosol of DCs or macrophages resulted in IFN-b production by a mechanism dependent upon cGAS, STING, TBK1, and IRF3 (4). In order to study the potential impact of the AIM2 inflammasome on this process, we generated BM-DCs of WT mice
FIGURE 2. IFN-b triggered by DNA is enhanced in AIM2 inflammasome-deficient cells. (A and B) WT, ASC2/2, and caspase-12/2/112/2 BM-DCs were stimulated with tumor-derived DNA in the presence of Lipofectamine (Invitrogen). The relative expression of IFN-b after 4 h of incubation was assessed by quantitative PCR and normalized by GAPDH expression (A), and the amount of IFN-b in the supernatant after 8 h of incubation was measured by ELISA (B). (C) WT, ASC2/2, and caspase-12/2/112/2 macrophages were stimulated with 0, 0.0001, 0.001, 0.01, 0.1, or 1 mg/ml of DNA in the presence of Lipofectamine for 4 h. The relative expression of IFN-b was assessed by quantitative PCR and normalized by GAPDH expression. (D) WT or inflammasome-deficient macrophages were stimulated with tumor-derived DNA in the presence of Lipofectamine, and the amount of IFN-b in the supernatant after 12 h of incubation was measured by ELISA. (E and F) ASC2/2 macrophages transfected with empty vector or myc-tagged ASC were stimulated with tumor-derived DNA. The amount of IFN-b in the supernatant was measured by ELISA. Data represent a pool of two or three independent experiments or a representative experiment of two repetitions (D and E). Results are shown as mean 6 SEM. *p , 0.5, **p , 0.01, ***p , 0.001, #under the limit of detection.
Downloaded from http://www.jimmunol.org/ at George Mason Univ Acq Dept/MSN/2 Fl on February 29, 2016
Lactate dehydrogenase release assay
3
4
AIM2 INFLAMMASOME ANTAGONIZES THE STING PATHWAY deficient in other inflammasomes and observed that NLRP3- or NLRC4 (IPAF)-deficient macrophages showed only minimal changes in IFN-b production in response to DNA stimulation (Fig. 2D). In the case of BM-DCs, caspase-12/2/112/2 showed a weaker phenotype than with macrophages; however, it was still significantly different from WT BM-DCs (Fig. 2A–D). To be certain that the augmented IFN-b production seen in AIM2 inflammasomedeficient APCs was a direct result of the absence of this pathway and not a developmental alteration, we reintroduced ASC into ASC2/2 macrophages (Fig. 2E). Restoration of ASC expression completely eliminated the augmented IFN-b production seen in response to cytosolic DNA (Fig. 2F). Together, these results demonstrate that induction of IFN-b production in response to cytosolic DNA stimulation is inhibited by all components of the AIM2 inflammasome, not only AIM2. APCs deficient in the AIM2 inflammasome show augmented activation of the full cGAS–STING pathway To further explore the mechanism by which the AIM2 inflammasome might antagonize activation of induction of IFN-b production via the STING pathway, we analyzed the stages of activation of the STING pathway in WT and AIM2 inflammasome-deficient cells. Phosphorylation of TBK1 and IRF3 was assessed by Western blot analysis at multiple time points following DNA stimulation. Early
FIGURE 3. Activation of the STING pathway is augmented in AIM2 inflammasome-deficient cells. WT or AIM2 inflammasome-deficient macrophages were stimulated with 1 mg/ml DNA in the presence of Lipofectamine (Invitrogen) for different time points (A) or BM-DCs were stimulated with different concentrations of DNA in the presence of Lipofectamine for 3 h. (B) Whole-cell extracts were analyzed with Abs against p-TBK1, total TBK1, p-IRF3, total IRF3, and GAPDH. (C) WT or ASC2/2 macrophages that overexpress STING-HA tag were stimulated with DNA and stained for CD11b, HA-tag, and DAPI. Cells were acquired using the ImageStream instrument, and STING localization was analyzed with IDEAS software. (D) Graph representing the quantification of the percentage of total cells that displayed STING aggregates after one. Macrophages (E) or BM-DCs (F) from WT or inflammasome knockout mice were stimulated with DNA for 1 h. cGAMP levels were measured from cell extracts by LC/MS/MS. Data are representative of two independent experiments or a pool of at least two independent experiments. Results are shown as mean 6 SEM. The dashed line in (E) and (F) represents 1 ng/ml, which is the limit of detection. *p , 0.5, **p , 0.01, ***p , 0.001.
Downloaded from http://www.jimmunol.org/ at George Mason Univ Acq Dept/MSN/2 Fl on February 29, 2016
versus Aim2-deficient mice and stimulated them in vitro with DNA in the presence of Lipofectamine (Invitrogen). The induction of IFN-b mRNA was markedly enhanced with Aim2-deficient DCs as compared with DCs from WT mice (Fig. 1A). This result was also confirmed at the protein level through analysis of IFN-b secretion (Fig. 1B). To explore this phenomenon in a different cell type, we used immortalized bone marrow macrophages. Using a wide range of DNA doses, augmented induction of IFN-b expression was observed in AIM2 inflammasome-deficient macrophages (Fig. 1C). The expression of CXCL10 was also increased in a dose-dependent manner in AIM2 inflammasome-deficient cells (Supplemental Fig. 1A). To test if expression of IFN-b occurred with different kinetics in Aim2-sufficient and -deficient cells, a time course was performed over 24 h of stimulation with DNA. Aim2 deficiency resulted in higher IFN-b expression at all time points (Supplemental Fig. 1B). In order to determine whether the entire AIM2 inflammasome complex was involved in this regulatory mechanism, we also analyzed BM-DCs from ASC- or caspase-1/ 11–deficient mice. As observed with the Aim22/2 DCs, ASC2/2, and caspase12/2 /112/2 BM-DCs showed significantly greater IFN-b gene expression compared with WT DCs (Fig. 2A, 2B). Similarly, a DNA dose-response titration on macrophages showed increased expression of IFN-b in ASC2/2 and caspase12/2/112/2 compared with WT cells (Fig. 2C). We also analyzed macrophages
The Journal of Immunology
ASC2/2 macrophages were stably transfected with STING-HA for evaluation of induction of aggregates by ImageStream analysis using an anti-HA Ab. In response to cytosolic DNA stimulation, we found that the percentage of cells with perinuclear STING aggregates was markedly higher in ASC2/2 macrophages compared with WT macrophages (Fig. 3C, 3D). To confirm STING activation in cells without exogenous expression of STING-HA tag, we assessed the degradation of total STING after DNA stimulation by Western blot analysis, as it has been demonstrated that STING undergoes ubiquitination and degradation after its activation (16). Total levels of STING were reduced over time after DNA stimulation in ASC2/2 macrophages, but remained more constant in WT cells (Supplemental Fig. 2C). Given that STING aggregation seemed to be augmented in AIM2 inflammasome-deficient cells, we moved upstream to evaluate
FIGURE 4. Activation of the STING pathway in ASC2/2 macrophages is not enhanced compared with WT cells when using a direct STING agonist. (A) WT or ASC2/2 macrophages that overexpress STING-HA tag were stimulated with 50 mg/ml of DMXAA for 1 h and stained for CD11b, HA-tag, and DAPI. Cells were acquired using the ImageStream instrument, and STING localization was analyzed using IDEAS software. (B) Graph representing the quantification of the percentage of total cells that present STING aggregates after 1 h of stimulation with DNA. (C) WT and ASC2/2 macrophages were stimulated with 50 mg/ml of DMXAA at different time points. Whole-cell extracts were analyzed with Abs against STING and b-actin. (D) Graph representing the ratio of total STING to b-actin and normalized with the nonstimulated cells. (E) WT and ASC2/2 macrophages were stimulated with 1 mg/ml of tumor-derived DNA in the presence of Lipofectamine (Invitrogen) or 50 mg/ml of DMXAA at different time points. Whole-cell extracts were analyzed with Abs against p-TBK1, total TBK1, p-IRF3, total IRF3, and GAPDH. (F) Graphs representing the ratio of p-TBK1 to total TBK1 and p-IRF3 to total IRF3. Data are representative of at least three independent experiments. Results are shown as mean 6 SEM. *p , 0.5, **p , 0.01, ***p , 0.001.
Downloaded from http://www.jimmunol.org/ at George Mason Univ Acq Dept/MSN/2 Fl on February 29, 2016
after DNA introduction, Aim2-deficient macrophages showed markedly augmented TBK1 and IRF3 phosphorylation compared with WT macrophages (Fig. 3A). To confirm the higher activation of TBK1 and IRF3 in a different cell type, BM-DCs from WT and Aim22/2, ASC2/2, and caspase-12/2/112/2 mice were stimulated with two different concentrations of DNA. The phosphorylation of TBK1 and IRF3 correlated with the amount of DNA used for stimulation and was higher in the AIM2 inflammasome-deficient cells (Fig. 3B). The augmented activation of the STING pathway was not due to a higher expression of the upstream proteins, the DNA sensor cGAS, or the adapter STING, as the level of expression of these proteins was similar in AIM2 inflammasome-sufficient and -deficient cells (Supplemental Fig. 2A, 2B). To examine a potential regulatory effect of AIM2 upstream of phosphorylation of TBK1, we analyzed STING aggregation after treatment with DNA. WT or
5
6
AIM2 INFLAMMASOME ANTAGONIZES THE STING PATHWAY
Inhibition of caspase-1 recovers activation of the STING pathway by DNA stimulation Having shown that the STING pathway is antagonized by the AIM2 inflammasome, we sought to determine the mechanism of this inhibition. It has been shown that members of the AIM2-like receptor (ALR) gene family influence the STING or the inflammasome pathways (24). We compared the basal expression of p204 and p202b in APCs, two ALRs related to the activation of the STING pathway, and also Aim2 expression as control. The basal expression of these three ALRs was similar in WT and ASC2/2 BM-DCs (Supplemental Fig. 3A); however, the expression of p204 was higher in ASC-deficient macrophages
FIGURE 5. Inhibition of caspase-1 increases activation of TBK1/IRF3 and generation of IFN-b in WT cells. (A) WT and ASC2/2 macrophages were preincubated with caspase-1 (Ac-YVAD-CMK) or caspase-3 (Z-AspGlu-Val-Asp-chloromethylketone [Z-DEVD-CMK]) inhibitors for 1 h and then stimulated with 1 mg/ml DNA in the presence of Lipofectamine (Invitrogen). Whole-cell extracts were analyzed with Abs against p-TBK1, total TBK1, p-IRF3, total IRF3, and GAPDH. (B and C) WT macrophages were treated as in (A). The relative expression of IFN-b after 4 h of incubation was assessed by quantitative PCR (B), and the amount of produced IFN-b after 12 h of incubation was measured by ELISA (C). (D) BM-DCs from WT mice were treated as in (A), and the amount of produced IFN-b after 12 h of incubation was measured by ELISA. Data are representative of two independent experiments or a pool of at least two independent experiments. Results are shown as mean 6 SEM. *p , 0.5, **p , 0.01, ***p , 0.001.
(Supplemental Fig. 3B). To evaluate whether the lower level of p204 in WT macrophages could be limiting the induction of IFN-b upon DNA stimulation, we overexpressed p204 to restore its expression (Supplemental Fig. 3C, 3D). However, overexpression of p204 did not result in higher production of IFN-b in response to DNA stimulation (Supplemental Fig. 3E), suggesting that differential levels of p204 between WT and ASC-deficient macrophages does not explain the lower production of IFN-b in WT cells stimulated with DNA. We then tested if the enzymatic activity of caspase-1 was involved in this inhibitory mechanism. For this purpose, WT and ASC2/2 macrophages were preincubated for 1 h with the caspase-1 inhibitor Ac-Tyr-Val-Ala-Asp-chloromethylketone (Ac-YVAD-CMK), or with the caspase-3 inhibitor Z-Asp-Glu-Val-Asp-chloromethylketone as a control, before stimulation with DNA. We found that WT macrophages preincubated with caspase-1 inhibitor showed increased phosphorylation of TBK1 and IRF3, whereas ASC2/2 macrophages failed to show any further increase in p-TBK1 or p-IRF3 (Fig. 5A). Expression and secretion of IFN-b after DNA stimulation was also augmented upon caspase-1 inhibition in WT macrophages (Fig. 5B, 5C). IFN-b production was also enhanced with WT BM-DCs preincubated with caspase-1 inhibitor (Fig. 5D). Together, these data demonstrate that the enzymatic output from AIM2 inflammasome activation by DNA, namely caspase-1 activation, could explain most of the antagonistic effect on STING pathway activation. AIM2 inflammasome-deficient cells are protected from pyroptosis in response to DNA stimulation Two potential mechanisms could explain how activation of the AIM2 inflammasome antagonize the activation of the STING pathway: the production of a factor processed by caspase-1 that could negatively regulate the activation of the STING pathway, or cell death via pyroptosis, resulting from the activation of the inflammasome that would limit the number of viable cells able to activate the STING pathway. In order to evaluate the presence of a
Downloaded from http://www.jimmunol.org/ at George Mason Univ Acq Dept/MSN/2 Fl on February 29, 2016
activation of the DNA sensor cGAS in the absence of the AIM2 inflammasome. For this purpose, intracellular cGAMP produced enzymatically by endogenous cGAS was measured by LC/MS/MS in extracts from WT and ASC2/2 macrophages stimulated with DNA. cGAMP levels were below the limit of detection in WT cells, whereas ASC2/2 cells produced robust levels of cGAMP (Fig. 3E). To confirm this result, extracts from DNAstimulated BM-DCs from WT, Aim22/2, ASC2/2, and caspase12/2/112/2 mice were also analyzed for cGAMP generation. Consistent with the results with macrophages, induced levels of cGAMP were markedly augmented in Aim22/2, ASC2/2, and caspase-12/2/112/2 BM-DCs compared with WT BM-DCs (Fig. 3F). It was important to exclude whether the activity of STING itself was affected by the absence of the AIM2 inflammasome. To this end, we used DMXAA, a direct agonist of mouse STING (25), to bypass cGAMP formation. WT and ASC2/2 macrophages stimulated with DMXAA showed similar STING aggregation in perinuclear sites, STING degradation, and phosphorylation of TBK1/ IRF3 in response to DMXAA stimulation (Fig. 4A–F). Together, these data demonstrate that the inhibition of the STING pathway by the AIM2 inflammasome impacts STING upstream, thus affecting the entire STING pathway activation cascade.
The Journal of Immunology
FIGURE 6. AIM2 inflammasome-deficient cells are protected from pyroptosis. (A) AIM22/2 BM-DCs were stimulated with tumor-derived DNA in the presence of supernatants from STING2/2 BM-DCs previously stimulated with DNA. The amount of produced IFN-b by AIM22/2 BM-DCS was measured by ELISA. (B) AIM22/2 or ASC2/2 macrophages were cultured with IRF32/2/72/2 macrophages, separated by transwell membranes, and stimulated with DNA. IFN-b production from the inflammasome-deficient macrophages was measured by ELISA. WT and inflammasome-deficient macrophages (C) or BM-DCs (D) were stimulated with DNA. Released LDH was measured in the supernatant of cells 45 min after stimulation. WT macrophages (E) or BM-DCs (F) were prestimulated with caspase-1 (Ac-YVAD-CMK) inhibitors for 1 h and then stimulated with DNA. Released LDH was measured in the supernatant of cells 45 min after stimulation. Data represent a pool of two or three independent experiments. Results are shown as mean 6 SEM. ***p , 0.001.
ulation in WT and inflammasome-deficient macrophages. DNA stimulation induced release of LDH in WT cells; however, inflammasome-deficient macrophages showed minimal levels of LDH release (Fig. 6C). Similar results were observed using BMDCs from WT or inflammasome-deficient mice (Fig. 6D). Preincubation of WT macrophages or BM-DCs with the caspase-1 inhibitor abolished the release of LDH after DNA stimulation (Fig. 6E, 6F). Together with our observation that caspase-1 inhibition restored STING-dependent signaling and IFN-b production, these results support the notion that pyroptosis induced by activation of the Aim2 inflammasome upon DNA stimulation plays a significant role in controlling the activation of the STING pathway.
Discussion Our data provide clear evidence that concurrent activation of the AIM2 inflammasome and the STING pathway by cytosolic DNA in APCs leads to reduced IFN-b production. The STING pathway was hyperactivated in AIM2 inflammasome-deficient macrophages and DCs, and the activity of caspase-1 was found to contribute to this mechanism. Although it is well established that pro–IL-1 and pro–IL-18 are major substrates for caspase-1, different bioinformatic approaches have been developed to predict potential substrates of caspases (26). To date, there are only three substrates for caspase-1: pro–IL-1b, pro–IL-18, and gsdmd (27),
Downloaded from http://www.jimmunol.org/ at George Mason Univ Acq Dept/MSN/2 Fl on February 29, 2016
soluble inhibitory factor, BM-DCs from STING2/2 mice were stimulated with DNA, or only Lipofectamine (Invitrogen) as a control, and the conditioned media was collected 24 h later. STING2/2 macrophages or BM-DCs do not produce IFN-b upon DNA stimulation (4) (Supplemental Fig. 4A). Thus, the culture medium from stimulated STING2/2 cells contains no IFN-b, but could contain a potential inhibitory factor. BM-DCs from Aim22/2 mice were stimulated with DNA in the presence or absence of conditioned media from STING2/2 cells, and the amount of IFN-b was measured by ELISA. We found no difference in the production of IFN-b from Aim22/2 BM-DCs coincubated with the different conditioned media (Fig. 6A). To confirm this result, IRF3/72/2 macrophages, which do not produce IFN-b upon DNA stimulation (Supplemental Fig. 4B), were placed in the upper chamber of a 4-mm pore-size transwell; and Aim22/2 or ASC2/2 macrophages were placed in the lower chamber of the transwell. The presence of IRF3/72/2 macrophages in the upper chamber did not reduce the production of IFN-b by the inflammasomedeficient cells in the lower chamber (Fig. 6B). Together, these results argue against a mechanism mediated by an inflammasomederived soluble factor. Next, we evaluated the role of pyroptosis induced by inflammasome activation. Cell death was assessed by measuring the release of lactate dehydrogenase (LDH) 45 min after DNA stim-
7
8
AIM2 INFLAMMASOME ANTAGONIZES THE STING PATHWAY
5.
6.
7. 8.
9.
10. 11. 12.
13.
14.
15. 16.
17.
18.
19.
20.
21. 22.
Acknowledgments
23.
We thank Kate Fitzgerald for the inflammasome-deficient macrophage cells and Michael Leung and Ryan Duggan for technical assistance.
24.
Disclosures
25.
T.F.G., S.-R.W., and L.C. are inventors on a patent application pending on the therapeutic potential for STING agonists in the cancer setting (The University of Chicago, assignee. Use of Sting Agonist as Cancer Treatment. United States patent application PCT/US14/66436, Publication No. WO2015077354 A1. 2014 Nov 19.). S.M.M. and T.W.D. are paid employees of Aduro Biotech. J.B.W. has no financial conflict of interest.
26. 27.
28.
References 1. Galon, J., A. Costes, F. Sanchez-Cabo, A. Kirilovsky, B. Mlecnik, C. LagorcePage`s, M. Tosolini, M. Camus, A. Berger, P. Wind, et al. 2006. Type, density, and location of immune cells within human colorectal tumors predict clinical outcome. Science 313: 1960–1964. 2. Diamond, M. S., M. Kinder, H. Matsushita, M. Mashayekhi, G. P. Dunn, J. M. Archambault, H. Lee, C. D. Arthur, J. M. White, U. Kalinke, et al. 2011. Type I interferon is selectively required by dendritic cells for immune rejection of tumors. J. Exp. Med. 208: 1989–2003. 3. Fuertes, M. B., A. K. Kacha, J. Kline, S. R. Woo, D. M. Kranz, K. M. Murphy, and T. F. Gajewski. 2011. Host type I IFN signals are required for antitumor CD8+ T cell responses through CD8alpha+ dendritic cells. J. Exp. Med. 208: 2005–2016. 4. Woo, S. R., M. B. Fuertes, L. Corrales, S. Spranger, M. J. Furdyna, M. Y. Leung, R. Duggan, Y. Wang, G. N. Barber, K. A. Fitzgerald, et al. 2014.
29. 30.
31.
32.
STING-dependent cytosolic DNA sensing mediates innate immune recognition of immunogenic tumors. [Published erratum appears in 2015 Immunity 1: 199.] Immunity 41: 830–842. Sun, L., J. Wu, F. Du, X. Chen, and Z. J. Chen. 2013. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science 339: 786–791. Wu, J., L. Sun, X. Chen, F. Du, H. Shi, C. Chen, and Z. J. Chen. 2013. Cyclic GMP-AMP is an endogenous second messenger in innate immune signaling by cytosolic DNA. Science 339: 826–830. Ishikawa, H., Z. Ma, and G. N. Barber. 2009. STING regulates intracellular DNAmediated, type I interferon-dependent innate immunity. Nature 461: 788–792. Liu, S., X. Cai, J. Wu, Q. Cong, X. Chen, T. Li, F. Du, J. Ren, Y. T. Wu, N. V. Grishin, and Z. J. Chen. 2015. Phosphorylation of innate immune adaptor proteins MAVS, STING, and TRIF induces IRF3 activation. Science 347: aaa2630. Burdette, D. L., K. M. Monroe, K. Sotelo-Troha, J. S. Iwig, B. Eckert, M. Hyodo, Y. Hayakawa, and R. E. Vance. 2011. STING is a direct innate immune sensor of cyclic di-GMP. Nature 478: 515–518. Burdette, D. L., and R. E. Vance. 2013. STING and the innate immune response to nucleic acids in the cytosol. Nat. Immunol. 14: 19–26. Ishikawa, H., and G. N. Barber. 2008. STING is an endoplasmic reticulum adaptor that facilitates innate immune signalling. Nature 455: 674–678. Schoggins, J. W., D. A. MacDuff, N. Imanaka, M. D. Gainey, B. Shrestha, J. L. Eitson, K. B. Mar, R. B. Richardson, A. V. Ratushny, V. Litvak, et al. 2014. Pan-viral specificity of IFN-induced genes reveals new roles for cGAS in innate immunity. Nature 505: 691–695. Crow, Y. J., B. E. Hayward, R. Parmar, P. Robins, A. Leitch, M. Ali, D. N. Black, H. van Bokhoven, H. G. Brunner, B. C. Hamel, et al. 2006. Mutations in the gene encoding the 39-59 DNA exonuclease TREX1 cause Aicardi-Goutie`res syndrome at the AGS1 locus. Nat. Genet. 38: 917–920. Lee-Kirsch, M. A., M. Gong, D. Chowdhury, L. Senenko, K. Engel, Y. A. Lee, U. de Silva, S. L. Bailey, T. Witte, T. J. Vyse, et al. 2007. Mutations in the gene encoding the 39-59 DNA exonuclease TREX1 are associated with systemic lupus erythematosus. Nat. Genet. 39: 1065–1067. Ahn, J., D. Gutman, S. Saijo, and G. N. Barber. 2012. STING manifests self DNAdependent inflammatory disease. Proc. Natl. Acad. Sci. USA 109: 19386–19391. Konno, H., K. Konno, and G. N. Barber. 2013. Cyclic dinucleotides trigger ULK1 (ATG1) phosphorylation of STING to prevent sustained innate immune signaling. Cell 155: 688–698. Fernandes-Alnemri, T., J. W. Yu, C. Juliana, L. Solorzano, S. Kang, J. Wu, P. Datta, M. McCormick, L. Huang, E. McDermott, et al. 2010. The AIM2 inflammasome is critical for innate immunity to Francisella tularensis. Nat. Immunol. 11: 385–393. Jones, J. W., N. Kayagaki, P. Broz, T. Henry, K. Newton, K. O’Rourke, S. Chan, J. Dong, Y. Qu, M. Roose-Girma, et al. 2010. Absent in melanoma 2 is required for innate immune recognition of Francisella tularensis. Proc. Natl. Acad. Sci. USA 107: 9771–9776. Panchanathan, R., X. Duan, H. Shen, V. A. Rathinam, L. D. Erickson, K. A. Fitzgerald, and D. Choubey. 2010. Aim2 deficiency stimulates the expression of IFN-inducible Ifi202, a lupus susceptibility murine gene within the Nba2 autoimmune susceptibility locus. J. Immunol. 185: 7385–7393. Rathinam, V. A., Z. Jiang, S. N. Waggoner, S. Sharma, L. E. Cole, L. Waggoner, S. K. Vanaja, B. G. Monks, S. Ganesan, E. Latz, et al. 2010. The AIM2 inflammasome is essential for host defense against cytosolic bacteria and DNA viruses. Nat. Immunol. 11: 395–402. Schroder, K., and J. Tschopp. 2010. The inflammasomes. Cell 140: 821–832. Jorgensen, I., and E. A. Miao. 2015. Pyroptotic cell death defends against intracellular pathogens. Immunol. Rev. 265: 130–142. Roberson, S. M., and W. S. Walker. 1988. Immortalization of cloned mouse splenic macrophages with a retrovirus containing the v-raf/mil and v-myc oncogenes. Cell. Immunol. 116: 341–351. Brunette, R. L., J. M. Young, D. G. Whitley, I. E. Brodsky, H. S. Malik, and D. B. Stetson. 2012. Extensive evolutionary and functional diversity among mammalian AIM2-like receptors. J. Exp. Med. 209: 1969–1983. Conlon, J., D. L. Burdette, S. Sharma, N. Bhat, M. Thompson, Z. Jiang, V. A. K. Rathinam, B. Monks, T. Jin, T. S. Xiao, et al. 2013. Mouse, but not human STING, binds and signals in response to the vascular disrupting agent 5,6dimethylxanthenone-4-acetic acid. J. Immunol. 190: 5216–5225. duVerle, D. A., and H. Mamitsuka. 2012. A review of statistical methods for prediction of proteolytic cleavage. Brief. Bioinform. 13: 337–349. Shi, J., Y. Zhao, K. Wang, X. Shi, Y. Wang, H. Huang, Y. Zhuang, T. Cai, F. Wang, and F. Shao. 2015. Cleavage of GSDMD by inflammatory caspases determines pyroptotic cell death. Nature 526: 660–665. Mayer-Barber, K. D., B. B. Andrade, S. D. Oland, E. P. Amaral, D. L. Barber, J. Gonzales, S. C. Derrick, R. Shi, N. P. Kumar, W. Wei, et al. 2014. Hostdirected therapy of tuberculosis based on interleukin-1 and type I interferon crosstalk. Nature 511: 99–103. Sims, J. E., and D. E. Smith. 2010. The IL-1 family: regulators of immunity. Nat. Rev. Immunol. 10: 89–102. Man, S. M., Q. Zhu, L. Zhu, Z. Liu, R. Karki, A. Malik, D. Sharma, L. Li, R. K. Malireddi, P. Gurung, et al. 2015. Critical Role for the DNA Sensor AIM2 in Stem Cell Proliferation and Cancer. Cell 162: 45–58. Sivan, A., L. Corrales, N. Hubert, J. B. Williams, K. Aquino-Michaels, Z. M. Earley, F. W. Benyamin, Y. M. Lei, B. Jabri, M. L. Alegre, et al. 2015. Commensal Bifidobacterium promotes antitumor immunity and facilitates antiPD-L1 efficacy. Science 350: 1084–1089. Ve´tizou, M., J. M. Pitt, R. Daille`re, P. Lepage, N. Waldschmitt, C. Flament, S. Rusakiewicz, B. Routy, M. P. Roberti, C. P. Duong, et al. 2015. Anticancer immunotherapy by CTLA-4 blockade relies on the gut microbiota. Science 350: 1079–1084.
Downloaded from http://www.jimmunol.org/ at George Mason Univ Acq Dept/MSN/2 Fl on February 29, 2016
and indeed, we found no evidence for any secreted soluble factor mediating inhibition of the STING pathway. We also questioned whether cGAS or STING could be substrates of caspase-1, but Western blot analysis showed no degradation products of cGAS or STING after DNA stimulation (data not shown). However, the other defined outcome of caspase-1 activation, cell death, revealed a clear difference between inflammasome-sufficient and -deficient cells. Thus, the AIM2 inflammasome activation by cytosolic DNA likely reduces the viability of cells, limiting the activation of other inflammatory pathways in the same APCs. We have previously demonstrated that the activation of the STING pathway in the tumor microenvironment is critical for generating a spontaneous antitumor T cell response (4). Our current data suggest that a possible strategy for enhancing this response could be through targeted inhibition of the inflammasome. Indeed, it has been demonstrated that signaling though the IL-1R inhibits expression of IFN-b (28). However, we need to consider other factors that could influence the generation of an efficient antitumor T cell response in vivo. First, signals from inflammasome-related cytokines IL-1 and IL-18 might contribute to the generation of an antitumor immunity (29). Second, our studies focus on the consequences of concurrent activation of the AIM2 and cGAS/STING pathways within the same cell. It is conceivable that coordinated activation of these pathways in distinct cell types may occur in vivo, which could interact productively. In addition, it is also conceivable that this mechanism only occurs in some types of cells, such as DCs and macrophages that express both cGAS and AIM2, but may be absent in stromal cells in which AIM2 is not expressed or needs to be induced by type I IFN signaling (5, 20). Third, it was recently reported that Aim2deficient animals may maintain a dysbiotic gut microbiota that accelerates tumorigenesis in an inflammatory model of colorectal cancer (30). This last consideration is important, as recent evidence has indicated that the composition of the gut microbiota modulates the systemic immune response against distant tumors (31, 32). These considerations imply that the in vivo effect of this regulatory mechanism might be more complex, and future work will be necessary to dissect the potentially more multifaceted interplay between the AIM2 inflammasome and the cGAS/STING pathway in vivo.
Supplementary Material
http://www.jimmunol.org/content/suppl/2016/02/26/jimmunol.150253 8.DCSupplemental.html
Subscriptions
Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscriptions
Permissions Email Alerts
Submit copyright permission requests at: http://www.aai.org/ji/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/cgi/alerts/etoc
The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 9650 Rockville Pike, Bethesda, MD 20814-3994. Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ at George Mason Univ Acq Dept/MSN/2 Fl on February 29, 2016
This information is current as of February 29, 2016.
Published February 29, 2016, doi:10.4049/jimmunol.1502538 The Journal of Immunology
Antagonism of the STING Pathway via Activation of the AIM2 Inflammasome by Intracellular DNA Leticia Corrales,* Seng-Ryong Woo,* Jason B. Williams,* Sarah M. McWhirter,† Thomas W. Dubensky, Jr.,† and Thomas F. Gajewski*,‡
S
pontaneous T cell responses against a growing tumor frequently occur, despite the absence of infectious agents; and the presence of activated CD8+ T cells in the tumor microenvironment correlates with improved prognosis (1). We and others have identified that production of host type I IFN has a critical role in the spontaneous activation of specific tumor CD8+ T cells (2, 3). Mechanistic studies using transplantable tumors in mice deficient in key innate sensing molecules showed that deficiency in the adaptor stimulator of IFN genes (STING) or the downstream transcription factor IFN regulatory factor (IRF) 3, blunted T cell priming, and impaired rejection of immunogenic tumors (4). Moreover, presence of DNA was found in the cytosol of intratumoral DCs, which correlated with IRF3 translocation to the nucleus and expression of IFN-b. These data suggest that activation of the STING pathway plays a critical role in the innate immune sensing of tumors in vivo, apparently through cytosolic sensing of DNA.
*Department of Pathology, The University of Chicago, Chicago, IL 60637; †Aduro Biotech, Berkeley, CA 94710; and ‡Section of Hematology/Oncology 2, Department of Medicine, The University of Chicago, Chicago, IL 60637 ORCIDs: 0000-0002-2800-4156 (L.C.); 0000-0002-4843-5113 (S.-R.W.); 00000001-7123-6940 (J.B.W.); 0000-0003-0726-4597 (T.W.D.). Received for publication December 7, 2015. Accepted for publication January 21, 2016. This work was supported by National Institutes of Health Grant R01CA181160. L.C. is supported by a Cancer Research Institute Irvington postdoctoral fellowship. Address correspondence and reprint requests to Dr. Thomas F. Gajewski, University of Chicago, 5841 South Maryland Avenue, MC2115, Chicago, IL 60637. E-mail address: [email protected] The online version of this article contains supplemental material. Abbreviations used in this article: Ac-YVAD-CMK, Ac-Tyr-Val-Ala-Asp-chloromethylketone; AIM, absent in melanoma 2; ALR, absent in melanoma 2–like receptor; ASC, apoptosis-associated specklike protein; BM-DC, bone marrow–derived dendritic cell; cGAMP, cyclic GMP-AMP; cGAS, sensor GMP-AMP synthase; HA, hemagglutinin; IRF, IFN regulatory factor; LC/MS/MS, liquid chromatography-tandem mass spectrometry; LDH, lactate dehydrogenase; STING, stimulator of IFN gene; TBK1, TANKbinding kinase 1; WT, wild-type. Copyright Ó 2016 by The American Association of Immunologists, Inc. 0022-1767/16/$30.00 www.jimmunol.org/cgi/doi/10.4049/jimmunol.1502538
STING is an adaptor protein located in the endoplasmic reticulum. In the presence of cytosolic DNA, the sensor GMP-AMP synthase (cGAS) produces cyclic GMP-AMP (cGAMP), which binds to STING and triggers its activation (5, 6). Aggregated STING translocates in vesicles from the endoplasmic reticulum to perinuclear sites (7). This is accompanied by TANK-binding kinase 1 (TBK1) recruitment, IRF3 phosphorylation and nuclear translocation (8), and transcription of type I IFN and other immune genes (9–11). Activation of the STING pathway is critical in the host defense against pathogens (12) and in the generation of an antitumor T cell response. However, its inappropriate activation leads to the generation of autoimmune diseases such as Aicardi-Goutie`res syndrome (13) or systemic lupus erythematosus (14). Thus, several regulatory mechanisms coexist to keep production of type I IFN in check. Two levels of negative regulation of the STING pathway have been described: elimination of aberrant DNA by DNases (15) and posttranslational modification of STING following its activation (16). However, the fact that the type I IFN response to DNA stimulation is enhanced in Aim2-deficient cells (17–20) suggests that another potential level of negative regulation of the STING pathway may occur when additional innate immune pathways are simultaneously activated. The presence of cytosolic DNA also triggers formation of the absent in melanoma 2 (AIM2) inflammasome, a heterocomplex that contains AIM2, the adaptor protein apoptosis-associated specklike protein (ASC), and caspase-1. This leads to activation of caspase-1 that generates matured forms of IL-1b and IL-18 (21), and pyroptosis, a form of cell death (22). Whether the AIM2 inflammasome influences STING pathway activation has not yet been described. In the current report, we investigated the regulatory role of the AIM2 inflammasome on STING pathway activation in vitro. We found increased cGAMP generation, STING aggregation, TBK1 and IRF3 phosphorylation, and IFN-b transcription in AIM2 inflammasome-deficient APCs upon cytosolic DNA exposure. Mechanistically, a major component of this effect could be the decreased cell death in inflammasomedeficient cells. Our results indicate an inhibitory effect of the AIM2
Downloaded from http://www.jimmunol.org/ at George Mason Univ Acq Dept/MSN/2 Fl on February 29, 2016
Recent evidence has indicated that innate immune sensing of cytosolic DNA in dendritic cells via the host STING pathway is a major mechanism leading to spontaneous T cell responses against tumors. However, the impact of the other major pathway triggered by intracellular DNA, the absent in melanoma 2 (AIM2) inflammasome, on the functional output from the stimulator of IFN genes (STING) pathway is poorly understood. We found that dendritic cells and macrophages deficient in AIM2, apoptosis-associated specklike protein, or caspase-1 produced markedly higher IFN-b in response to DNA. Biochemical analyses showed enhanced generation of cyclic GMP-AMP, STING aggregation, and TANK-binding kinase 1 and IFN regulatory factor 3 phosphorylation in inflammasome-deficient cells. Induction of pyroptosis by the AIM2 inflammasome was a major component of this effect, and inhibition of caspase-1 reduced cell death, augmenting phosphorylation of TANK-binding kinase 1/IFN regulatory factor 3 and production of IFN-b. Our data suggest that in vitro activation of the AIM2 inflammasome in murine macrophages and dendritic cells leads to reduced activation of the STING pathway, in part through promoting caspase-1–dependent cell death. The Journal of Immunology, 2016, 196: 000–000.
2
AIM2 INFLAMMASOME ANTAGONIZES THE STING PATHWAY
inflammasome on the STING pathway in response to cytosolic DNA and suggest that targeted inflammasome inhibition could represent a strategy for prolonging APC survival in the context of cytosolic DNA sensing, leading to potentiation of the STING pathway.
Murine IFN-b ELISA
Materials and Methods
Quantitative RT-PCR
Cells and cell isolations
Total RNA was isolated using the RNeasy kit (Qiagen) and incubated with DNase I, Amplification Grade (Invitrogen). cDNA was synthesized using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and expression of IFN-b, CXCL10, and GAPDH as endogenous control was measured by real-time quantitative RT-PCR with specific primers and universal probes from Roche for mouse IFN-b (59: GGAAAGATTGACGTGGGAGA; 39: CCTTTGCACCCTCCAGTAAT; and universal probe number 108), mouse CXCL10 (59: GCTGCCGTCATTTTCTGC; 39: TCTCACTGG CCCGTCATC; and universal probe number 3), and mouse GAPDH (59: AGCTTGTCATCAACGGGAAG; 39: TTTGATGTTAGTGGGGTCTCG; and universal probe number 9) using a 7300 Real Time PCR system (Applied Biosystems). The results are expressed as relative expression to GAPDH. The expression of Aim2, p204, and p202b was analyzed using the primers described in Brunette et al. (24).
Purification of tumor-derived DNA Tumor-derived DNA was used for all stimulations; for simplification, it is referred to as “DNA” throughout the manuscript. Genomic DNA from B16.F10 melanoma cells was purified using the QIAamp DNA Mini Kit according to the manufacturer’s instructions (Qiagen). To ensure DNA was free of other danger signals (i.e., LPS), immortalized STING2/2 macrophages were stimulated with the purified DNA to assess for STING dependence, and WT macrophages were stimulated with DNAse I–treated DNA. In both cases, there was no expression of IFN-b.
Stimulation of APCs with tumor-derived DNA or DMXAA Immortalized macrophages or BM-DCs were stimulated with different concentrations of DNA in the presence of Lipofectamine 2000 (Invitrogen). For some experiments, macrophages were stimulated with 50 mg/ml DMXAA (Selleckchem).
ImageStream analysis of STING aggregates Cells stimulated with 1 mg/ml DNA or 50 mg/ml DMXAA were stained with anti–CD11b-allophycocyanin (M1/70; BioLegend), rabbit anti-hemagglutinin (HA)-tag (C29F4; Cell Signaling Technology), anti-rabbit IgG-PE (Invitrogen), and DAPI (Invitrogen). Single-cell images were acquired in the ImageStreamxMark II (Amnis), and data were analyzed using IDEAS software.
Western blot analysis Whole-cell extracts were electrophoresed in 10% SDS-PAGE gels and transferred onto Immobilon-FL membranes (Millipore). Blots were incubated with Abs specific for p-TBK1 (Ser172), pIRF3 (Ser396), total TBK1, total IRF3, cGAS, STING, GAPDH, or b-actin (Cell Signaling Technology). For ASC-myc detection in ASC2/2 macrophages, anti-ASC (Millipore) was used. For p204-myc detection in WT macrophages, anti-myc (Cell Signaling Technology) was used. Anti-rabbit or anti-mouse IRDye 680RD label secondary Abs were used for visualization of bands with the Odyssey Imaging system (LI-COR).
FIGURE 1. IFN-b triggered by DNA is enhanced in Aim2-deficient cells. (A and B) Aim2+/+ and Aim22/2 BM-DCs were stimulated with tumor-derived DNA in the presence of Lipofectamine (Invitrogen). The relative expression of IFN-b after 4 h of incubation was assessed by quantitative PCR and normalized by GAPDH expression (A), and the amount of IFN-b in the supernatant after 8 h of incubation was measured by ELISA (B). (C) Aim2+/+ and Aim22/2 macrophages were stimulated with 0, 0.0001, 0.001, 0.01, 0.1, or 1 mg/ml of DNA in the presence of Lipofectamine for 4 h. The relative expression of IFN-b was assessed by quantitative PCR and normalized by GAPDH expression. Data represent a pool of three independent experiments (A and B) or a representative experiment of two repetitions (C). Results are shown as mean 6 SEM. **p , 0.01, ***p , 0.001.
Downloaded from http://www.jimmunol.org/ at George Mason Univ Acq Dept/MSN/2 Fl on February 29, 2016
Immortalized wild-type (WT), Aim22/2, ASC2/2, and caspase-12/2/112/2 macrophages were obtained as described in Roberson and Walker (23). Cells were maintained in DMEM supplemented with 10% heat-inactivated FCS, penicillin, streptomycin, L-arginine, L-glutamine, folic acid, and L-asparagine. Bone marrow–derived dendritic cells (BM-DCs) were generated from the tibiae and femurs of WT, Aim22/2, ASC2/2, caspase-12/2/ 112/2 female mice of age 6 to 8 wk. Mice were housed in the specific pathogen-free animal facility at the University of Chicago. Cells were cultured in DMEM supplemented with 10% heat-inactivated FCS, penicillin, streptomycin, L-arginine, L-glutamine, folic acid, and L-asparagine and the presence of recombinant murine GM-CSF (20 ng/ml; BioLegend) for 9 d. All cells were maintained at 37˚C with 5% CO2. The macrophages used throughout the study were immortalized and the BM-DCs were primary cells. For stable overexpression of myc-ASC in ASC2/2 macrophages, the full-length mASC-myc DNA sequence was generated by PCR. Sequenceencoding full-length mASC was amplified from MGC Mouse Pycard cDNA (Dharmacon) using a 59 primer containing an EcoR1 site and atg and myc sequence: GAATTCTCGAGATGGAGCAGAAGCTGATTTCCGAGGAGGACCTGGGGCGGGCACGAGATGCCATCCTGGACGCTCTTGAAAACTTGTCAGGGGATGAACTCAAAAAGTTCAAGATGAAGCTGCTGACAGTGCAACTGC; and a 39 primer containing the NotI site: TATATGCGGCCGCTCAGCTCTGCTCCAGGTCCATCACCAAGT. For stable overexpression of myc-p204 in WT macrophages, the fulllength p204-myc DNA sequence was generated by PCR. Sequenceencoding full-length p204 was amplified from MGC Mouse p204 cDNA (Dharmacon) using a 59 primer containing an EcoR1 site and atg and myc sequence: GTGAATTCATGGAGCAGAAGCTGATTTCCGAGGAGGACCTGGTGAATGAATACAAGAGAATTGTTCTGCTGAGAGGACTTGAATGTATC; and a 39 primer containing the NotI site: atGCGGCCGCTCACTTTCTAGCATTGATGACCT. The mouse myc-ASC or myc-p204 PCR products were gel purified and double digested with EcoRI and NotI and then cloned into the multiple cloning site of pMXS-IRES-GFP with the Quick ligation kit (New England Biolabs).
Conditioned media from cells stimulated with DNA were collected after 12 (macrophages) or 8 (BM-DCs) h. IFN-b concentration was assessed using VeriKine Mouse IFN-b ELISA Kit (PBL InterferonSource) according to the manufacturer’s instructions.
The Journal of Immunology Bioanalytical method for detection of cGAS product cGAMP was quantified via liquid chromatography-tandem mass spectrometry (LC/MS/MS) at Climax Laboratories (San Jose, CA). Briefly, 1 million macrophages or BM-DCs were stimulated with DNA for 1 h and then resuspended in PBS. cGAMP was extracted with 100% acetonitrile and analyzed by an LC/MS/MS system, Sciex API-4000Qtrap Mass Spectrometer and a Shimadzu HPLC/Autosampler with an ACE C18 column (2.1 3 100 mm, 5 mm). Positive electronic spray ionization and multiple reactions monitor were used. The multiple reactions monitor transition of the test compound was 675/136 (m/z). The HPLC mobile phase A and B was 0.5% formic acid in 5 mmol NH4Ac solution and acetonitrile/water (9/1) with 0.5% formic acid. A related compound, Rp,Rp-c-diAMPSS, was used as an internal standard. The limit of quantification was 1.0 ng/ml, and the dynamic range was 1.0–500 ng/ml.
Culture medium from cells stimulated with DNA was collected and incubated with the reaction mixture from the LDH Cytotoxicity Assay Kit (Pierce) according to the manufacturer’s instructions. The rates of cell death were calculated using the absorbance values from DNA-stimulated
cells (experimental cell death), Triton X–treated cells (100% of cell death), and culture medium–treated (spontaneous cell death) and applying the formula: (experimental cell death 2 spontaneous cell death)/(100% cell death 2 spontaneous cell death) 3 100%.
Statistical analysis Differences between two treatment groups were analyzed with the twosided Student t test using Prism 6 software (GraphPad). Statistically significant p values are labeled in the figures and legends with asterisks.
Results Elimination of components of the AIM2 inflammasome potentiates STING-dependent production of IFN-b in APCs We previously had demonstrated that the introduction of DNA into the cytosol of DCs or macrophages resulted in IFN-b production by a mechanism dependent upon cGAS, STING, TBK1, and IRF3 (4). In order to study the potential impact of the AIM2 inflammasome on this process, we generated BM-DCs of WT mice
FIGURE 2. IFN-b triggered by DNA is enhanced in AIM2 inflammasome-deficient cells. (A and B) WT, ASC2/2, and caspase-12/2/112/2 BM-DCs were stimulated with tumor-derived DNA in the presence of Lipofectamine (Invitrogen). The relative expression of IFN-b after 4 h of incubation was assessed by quantitative PCR and normalized by GAPDH expression (A), and the amount of IFN-b in the supernatant after 8 h of incubation was measured by ELISA (B). (C) WT, ASC2/2, and caspase-12/2/112/2 macrophages were stimulated with 0, 0.0001, 0.001, 0.01, 0.1, or 1 mg/ml of DNA in the presence of Lipofectamine for 4 h. The relative expression of IFN-b was assessed by quantitative PCR and normalized by GAPDH expression. (D) WT or inflammasome-deficient macrophages were stimulated with tumor-derived DNA in the presence of Lipofectamine, and the amount of IFN-b in the supernatant after 12 h of incubation was measured by ELISA. (E and F) ASC2/2 macrophages transfected with empty vector or myc-tagged ASC were stimulated with tumor-derived DNA. The amount of IFN-b in the supernatant was measured by ELISA. Data represent a pool of two or three independent experiments or a representative experiment of two repetitions (D and E). Results are shown as mean 6 SEM. *p , 0.5, **p , 0.01, ***p , 0.001, #under the limit of detection.
Downloaded from http://www.jimmunol.org/ at George Mason Univ Acq Dept/MSN/2 Fl on February 29, 2016
Lactate dehydrogenase release assay
3
4
AIM2 INFLAMMASOME ANTAGONIZES THE STING PATHWAY deficient in other inflammasomes and observed that NLRP3- or NLRC4 (IPAF)-deficient macrophages showed only minimal changes in IFN-b production in response to DNA stimulation (Fig. 2D). In the case of BM-DCs, caspase-12/2/112/2 showed a weaker phenotype than with macrophages; however, it was still significantly different from WT BM-DCs (Fig. 2A–D). To be certain that the augmented IFN-b production seen in AIM2 inflammasomedeficient APCs was a direct result of the absence of this pathway and not a developmental alteration, we reintroduced ASC into ASC2/2 macrophages (Fig. 2E). Restoration of ASC expression completely eliminated the augmented IFN-b production seen in response to cytosolic DNA (Fig. 2F). Together, these results demonstrate that induction of IFN-b production in response to cytosolic DNA stimulation is inhibited by all components of the AIM2 inflammasome, not only AIM2. APCs deficient in the AIM2 inflammasome show augmented activation of the full cGAS–STING pathway To further explore the mechanism by which the AIM2 inflammasome might antagonize activation of induction of IFN-b production via the STING pathway, we analyzed the stages of activation of the STING pathway in WT and AIM2 inflammasome-deficient cells. Phosphorylation of TBK1 and IRF3 was assessed by Western blot analysis at multiple time points following DNA stimulation. Early
FIGURE 3. Activation of the STING pathway is augmented in AIM2 inflammasome-deficient cells. WT or AIM2 inflammasome-deficient macrophages were stimulated with 1 mg/ml DNA in the presence of Lipofectamine (Invitrogen) for different time points (A) or BM-DCs were stimulated with different concentrations of DNA in the presence of Lipofectamine for 3 h. (B) Whole-cell extracts were analyzed with Abs against p-TBK1, total TBK1, p-IRF3, total IRF3, and GAPDH. (C) WT or ASC2/2 macrophages that overexpress STING-HA tag were stimulated with DNA and stained for CD11b, HA-tag, and DAPI. Cells were acquired using the ImageStream instrument, and STING localization was analyzed with IDEAS software. (D) Graph representing the quantification of the percentage of total cells that displayed STING aggregates after one. Macrophages (E) or BM-DCs (F) from WT or inflammasome knockout mice were stimulated with DNA for 1 h. cGAMP levels were measured from cell extracts by LC/MS/MS. Data are representative of two independent experiments or a pool of at least two independent experiments. Results are shown as mean 6 SEM. The dashed line in (E) and (F) represents 1 ng/ml, which is the limit of detection. *p , 0.5, **p , 0.01, ***p , 0.001.
Downloaded from http://www.jimmunol.org/ at George Mason Univ Acq Dept/MSN/2 Fl on February 29, 2016
versus Aim2-deficient mice and stimulated them in vitro with DNA in the presence of Lipofectamine (Invitrogen). The induction of IFN-b mRNA was markedly enhanced with Aim2-deficient DCs as compared with DCs from WT mice (Fig. 1A). This result was also confirmed at the protein level through analysis of IFN-b secretion (Fig. 1B). To explore this phenomenon in a different cell type, we used immortalized bone marrow macrophages. Using a wide range of DNA doses, augmented induction of IFN-b expression was observed in AIM2 inflammasome-deficient macrophages (Fig. 1C). The expression of CXCL10 was also increased in a dose-dependent manner in AIM2 inflammasome-deficient cells (Supplemental Fig. 1A). To test if expression of IFN-b occurred with different kinetics in Aim2-sufficient and -deficient cells, a time course was performed over 24 h of stimulation with DNA. Aim2 deficiency resulted in higher IFN-b expression at all time points (Supplemental Fig. 1B). In order to determine whether the entire AIM2 inflammasome complex was involved in this regulatory mechanism, we also analyzed BM-DCs from ASC- or caspase-1/ 11–deficient mice. As observed with the Aim22/2 DCs, ASC2/2, and caspase12/2 /112/2 BM-DCs showed significantly greater IFN-b gene expression compared with WT DCs (Fig. 2A, 2B). Similarly, a DNA dose-response titration on macrophages showed increased expression of IFN-b in ASC2/2 and caspase12/2/112/2 compared with WT cells (Fig. 2C). We also analyzed macrophages
The Journal of Immunology
ASC2/2 macrophages were stably transfected with STING-HA for evaluation of induction of aggregates by ImageStream analysis using an anti-HA Ab. In response to cytosolic DNA stimulation, we found that the percentage of cells with perinuclear STING aggregates was markedly higher in ASC2/2 macrophages compared with WT macrophages (Fig. 3C, 3D). To confirm STING activation in cells without exogenous expression of STING-HA tag, we assessed the degradation of total STING after DNA stimulation by Western blot analysis, as it has been demonstrated that STING undergoes ubiquitination and degradation after its activation (16). Total levels of STING were reduced over time after DNA stimulation in ASC2/2 macrophages, but remained more constant in WT cells (Supplemental Fig. 2C). Given that STING aggregation seemed to be augmented in AIM2 inflammasome-deficient cells, we moved upstream to evaluate
FIGURE 4. Activation of the STING pathway in ASC2/2 macrophages is not enhanced compared with WT cells when using a direct STING agonist. (A) WT or ASC2/2 macrophages that overexpress STING-HA tag were stimulated with 50 mg/ml of DMXAA for 1 h and stained for CD11b, HA-tag, and DAPI. Cells were acquired using the ImageStream instrument, and STING localization was analyzed using IDEAS software. (B) Graph representing the quantification of the percentage of total cells that present STING aggregates after 1 h of stimulation with DNA. (C) WT and ASC2/2 macrophages were stimulated with 50 mg/ml of DMXAA at different time points. Whole-cell extracts were analyzed with Abs against STING and b-actin. (D) Graph representing the ratio of total STING to b-actin and normalized with the nonstimulated cells. (E) WT and ASC2/2 macrophages were stimulated with 1 mg/ml of tumor-derived DNA in the presence of Lipofectamine (Invitrogen) or 50 mg/ml of DMXAA at different time points. Whole-cell extracts were analyzed with Abs against p-TBK1, total TBK1, p-IRF3, total IRF3, and GAPDH. (F) Graphs representing the ratio of p-TBK1 to total TBK1 and p-IRF3 to total IRF3. Data are representative of at least three independent experiments. Results are shown as mean 6 SEM. *p , 0.5, **p , 0.01, ***p , 0.001.
Downloaded from http://www.jimmunol.org/ at George Mason Univ Acq Dept/MSN/2 Fl on February 29, 2016
after DNA introduction, Aim2-deficient macrophages showed markedly augmented TBK1 and IRF3 phosphorylation compared with WT macrophages (Fig. 3A). To confirm the higher activation of TBK1 and IRF3 in a different cell type, BM-DCs from WT and Aim22/2, ASC2/2, and caspase-12/2/112/2 mice were stimulated with two different concentrations of DNA. The phosphorylation of TBK1 and IRF3 correlated with the amount of DNA used for stimulation and was higher in the AIM2 inflammasome-deficient cells (Fig. 3B). The augmented activation of the STING pathway was not due to a higher expression of the upstream proteins, the DNA sensor cGAS, or the adapter STING, as the level of expression of these proteins was similar in AIM2 inflammasome-sufficient and -deficient cells (Supplemental Fig. 2A, 2B). To examine a potential regulatory effect of AIM2 upstream of phosphorylation of TBK1, we analyzed STING aggregation after treatment with DNA. WT or
5
6
AIM2 INFLAMMASOME ANTAGONIZES THE STING PATHWAY
Inhibition of caspase-1 recovers activation of the STING pathway by DNA stimulation Having shown that the STING pathway is antagonized by the AIM2 inflammasome, we sought to determine the mechanism of this inhibition. It has been shown that members of the AIM2-like receptor (ALR) gene family influence the STING or the inflammasome pathways (24). We compared the basal expression of p204 and p202b in APCs, two ALRs related to the activation of the STING pathway, and also Aim2 expression as control. The basal expression of these three ALRs was similar in WT and ASC2/2 BM-DCs (Supplemental Fig. 3A); however, the expression of p204 was higher in ASC-deficient macrophages
FIGURE 5. Inhibition of caspase-1 increases activation of TBK1/IRF3 and generation of IFN-b in WT cells. (A) WT and ASC2/2 macrophages were preincubated with caspase-1 (Ac-YVAD-CMK) or caspase-3 (Z-AspGlu-Val-Asp-chloromethylketone [Z-DEVD-CMK]) inhibitors for 1 h and then stimulated with 1 mg/ml DNA in the presence of Lipofectamine (Invitrogen). Whole-cell extracts were analyzed with Abs against p-TBK1, total TBK1, p-IRF3, total IRF3, and GAPDH. (B and C) WT macrophages were treated as in (A). The relative expression of IFN-b after 4 h of incubation was assessed by quantitative PCR (B), and the amount of produced IFN-b after 12 h of incubation was measured by ELISA (C). (D) BM-DCs from WT mice were treated as in (A), and the amount of produced IFN-b after 12 h of incubation was measured by ELISA. Data are representative of two independent experiments or a pool of at least two independent experiments. Results are shown as mean 6 SEM. *p , 0.5, **p , 0.01, ***p , 0.001.
(Supplemental Fig. 3B). To evaluate whether the lower level of p204 in WT macrophages could be limiting the induction of IFN-b upon DNA stimulation, we overexpressed p204 to restore its expression (Supplemental Fig. 3C, 3D). However, overexpression of p204 did not result in higher production of IFN-b in response to DNA stimulation (Supplemental Fig. 3E), suggesting that differential levels of p204 between WT and ASC-deficient macrophages does not explain the lower production of IFN-b in WT cells stimulated with DNA. We then tested if the enzymatic activity of caspase-1 was involved in this inhibitory mechanism. For this purpose, WT and ASC2/2 macrophages were preincubated for 1 h with the caspase-1 inhibitor Ac-Tyr-Val-Ala-Asp-chloromethylketone (Ac-YVAD-CMK), or with the caspase-3 inhibitor Z-Asp-Glu-Val-Asp-chloromethylketone as a control, before stimulation with DNA. We found that WT macrophages preincubated with caspase-1 inhibitor showed increased phosphorylation of TBK1 and IRF3, whereas ASC2/2 macrophages failed to show any further increase in p-TBK1 or p-IRF3 (Fig. 5A). Expression and secretion of IFN-b after DNA stimulation was also augmented upon caspase-1 inhibition in WT macrophages (Fig. 5B, 5C). IFN-b production was also enhanced with WT BM-DCs preincubated with caspase-1 inhibitor (Fig. 5D). Together, these data demonstrate that the enzymatic output from AIM2 inflammasome activation by DNA, namely caspase-1 activation, could explain most of the antagonistic effect on STING pathway activation. AIM2 inflammasome-deficient cells are protected from pyroptosis in response to DNA stimulation Two potential mechanisms could explain how activation of the AIM2 inflammasome antagonize the activation of the STING pathway: the production of a factor processed by caspase-1 that could negatively regulate the activation of the STING pathway, or cell death via pyroptosis, resulting from the activation of the inflammasome that would limit the number of viable cells able to activate the STING pathway. In order to evaluate the presence of a
Downloaded from http://www.jimmunol.org/ at George Mason Univ Acq Dept/MSN/2 Fl on February 29, 2016
activation of the DNA sensor cGAS in the absence of the AIM2 inflammasome. For this purpose, intracellular cGAMP produced enzymatically by endogenous cGAS was measured by LC/MS/MS in extracts from WT and ASC2/2 macrophages stimulated with DNA. cGAMP levels were below the limit of detection in WT cells, whereas ASC2/2 cells produced robust levels of cGAMP (Fig. 3E). To confirm this result, extracts from DNAstimulated BM-DCs from WT, Aim22/2, ASC2/2, and caspase12/2/112/2 mice were also analyzed for cGAMP generation. Consistent with the results with macrophages, induced levels of cGAMP were markedly augmented in Aim22/2, ASC2/2, and caspase-12/2/112/2 BM-DCs compared with WT BM-DCs (Fig. 3F). It was important to exclude whether the activity of STING itself was affected by the absence of the AIM2 inflammasome. To this end, we used DMXAA, a direct agonist of mouse STING (25), to bypass cGAMP formation. WT and ASC2/2 macrophages stimulated with DMXAA showed similar STING aggregation in perinuclear sites, STING degradation, and phosphorylation of TBK1/ IRF3 in response to DMXAA stimulation (Fig. 4A–F). Together, these data demonstrate that the inhibition of the STING pathway by the AIM2 inflammasome impacts STING upstream, thus affecting the entire STING pathway activation cascade.
The Journal of Immunology
FIGURE 6. AIM2 inflammasome-deficient cells are protected from pyroptosis. (A) AIM22/2 BM-DCs were stimulated with tumor-derived DNA in the presence of supernatants from STING2/2 BM-DCs previously stimulated with DNA. The amount of produced IFN-b by AIM22/2 BM-DCS was measured by ELISA. (B) AIM22/2 or ASC2/2 macrophages were cultured with IRF32/2/72/2 macrophages, separated by transwell membranes, and stimulated with DNA. IFN-b production from the inflammasome-deficient macrophages was measured by ELISA. WT and inflammasome-deficient macrophages (C) or BM-DCs (D) were stimulated with DNA. Released LDH was measured in the supernatant of cells 45 min after stimulation. WT macrophages (E) or BM-DCs (F) were prestimulated with caspase-1 (Ac-YVAD-CMK) inhibitors for 1 h and then stimulated with DNA. Released LDH was measured in the supernatant of cells 45 min after stimulation. Data represent a pool of two or three independent experiments. Results are shown as mean 6 SEM. ***p , 0.001.
ulation in WT and inflammasome-deficient macrophages. DNA stimulation induced release of LDH in WT cells; however, inflammasome-deficient macrophages showed minimal levels of LDH release (Fig. 6C). Similar results were observed using BMDCs from WT or inflammasome-deficient mice (Fig. 6D). Preincubation of WT macrophages or BM-DCs with the caspase-1 inhibitor abolished the release of LDH after DNA stimulation (Fig. 6E, 6F). Together with our observation that caspase-1 inhibition restored STING-dependent signaling and IFN-b production, these results support the notion that pyroptosis induced by activation of the Aim2 inflammasome upon DNA stimulation plays a significant role in controlling the activation of the STING pathway.
Discussion Our data provide clear evidence that concurrent activation of the AIM2 inflammasome and the STING pathway by cytosolic DNA in APCs leads to reduced IFN-b production. The STING pathway was hyperactivated in AIM2 inflammasome-deficient macrophages and DCs, and the activity of caspase-1 was found to contribute to this mechanism. Although it is well established that pro–IL-1 and pro–IL-18 are major substrates for caspase-1, different bioinformatic approaches have been developed to predict potential substrates of caspases (26). To date, there are only three substrates for caspase-1: pro–IL-1b, pro–IL-18, and gsdmd (27),
Downloaded from http://www.jimmunol.org/ at George Mason Univ Acq Dept/MSN/2 Fl on February 29, 2016
soluble inhibitory factor, BM-DCs from STING2/2 mice were stimulated with DNA, or only Lipofectamine (Invitrogen) as a control, and the conditioned media was collected 24 h later. STING2/2 macrophages or BM-DCs do not produce IFN-b upon DNA stimulation (4) (Supplemental Fig. 4A). Thus, the culture medium from stimulated STING2/2 cells contains no IFN-b, but could contain a potential inhibitory factor. BM-DCs from Aim22/2 mice were stimulated with DNA in the presence or absence of conditioned media from STING2/2 cells, and the amount of IFN-b was measured by ELISA. We found no difference in the production of IFN-b from Aim22/2 BM-DCs coincubated with the different conditioned media (Fig. 6A). To confirm this result, IRF3/72/2 macrophages, which do not produce IFN-b upon DNA stimulation (Supplemental Fig. 4B), were placed in the upper chamber of a 4-mm pore-size transwell; and Aim22/2 or ASC2/2 macrophages were placed in the lower chamber of the transwell. The presence of IRF3/72/2 macrophages in the upper chamber did not reduce the production of IFN-b by the inflammasomedeficient cells in the lower chamber (Fig. 6B). Together, these results argue against a mechanism mediated by an inflammasomederived soluble factor. Next, we evaluated the role of pyroptosis induced by inflammasome activation. Cell death was assessed by measuring the release of lactate dehydrogenase (LDH) 45 min after DNA stim-
7
8
AIM2 INFLAMMASOME ANTAGONIZES THE STING PATHWAY
5.
6.
7. 8.
9.
10. 11. 12.
13.
14.
15. 16.
17.
18.
19.
20.
21. 22.
Acknowledgments
23.
We thank Kate Fitzgerald for the inflammasome-deficient macrophage cells and Michael Leung and Ryan Duggan for technical assistance.
24.
Disclosures
25.
T.F.G., S.-R.W., and L.C. are inventors on a patent application pending on the therapeutic potential for STING agonists in the cancer setting (The University of Chicago, assignee. Use of Sting Agonist as Cancer Treatment. United States patent application PCT/US14/66436, Publication No. WO2015077354 A1. 2014 Nov 19.). S.M.M. and T.W.D. are paid employees of Aduro Biotech. J.B.W. has no financial conflict of interest.
26. 27.
28.
References 1. Galon, J., A. Costes, F. Sanchez-Cabo, A. Kirilovsky, B. Mlecnik, C. LagorcePage`s, M. Tosolini, M. Camus, A. Berger, P. Wind, et al. 2006. Type, density, and location of immune cells within human colorectal tumors predict clinical outcome. Science 313: 1960–1964. 2. Diamond, M. S., M. Kinder, H. Matsushita, M. Mashayekhi, G. P. Dunn, J. M. Archambault, H. Lee, C. D. Arthur, J. M. White, U. Kalinke, et al. 2011. Type I interferon is selectively required by dendritic cells for immune rejection of tumors. J. Exp. Med. 208: 1989–2003. 3. Fuertes, M. B., A. K. Kacha, J. Kline, S. R. Woo, D. M. Kranz, K. M. Murphy, and T. F. Gajewski. 2011. Host type I IFN signals are required for antitumor CD8+ T cell responses through CD8alpha+ dendritic cells. J. Exp. Med. 208: 2005–2016. 4. Woo, S. R., M. B. Fuertes, L. Corrales, S. Spranger, M. J. Furdyna, M. Y. Leung, R. Duggan, Y. Wang, G. N. Barber, K. A. Fitzgerald, et al. 2014.
29. 30.
31.
32.
STING-dependent cytosolic DNA sensing mediates innate immune recognition of immunogenic tumors. [Published erratum appears in 2015 Immunity 1: 199.] Immunity 41: 830–842. Sun, L., J. Wu, F. Du, X. Chen, and Z. J. Chen. 2013. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science 339: 786–791. Wu, J., L. Sun, X. Chen, F. Du, H. Shi, C. Chen, and Z. J. Chen. 2013. Cyclic GMP-AMP is an endogenous second messenger in innate immune signaling by cytosolic DNA. Science 339: 826–830. Ishikawa, H., Z. Ma, and G. N. Barber. 2009. STING regulates intracellular DNAmediated, type I interferon-dependent innate immunity. Nature 461: 788–792. Liu, S., X. Cai, J. Wu, Q. Cong, X. Chen, T. Li, F. Du, J. Ren, Y. T. Wu, N. V. Grishin, and Z. J. Chen. 2015. Phosphorylation of innate immune adaptor proteins MAVS, STING, and TRIF induces IRF3 activation. Science 347: aaa2630. Burdette, D. L., K. M. Monroe, K. Sotelo-Troha, J. S. Iwig, B. Eckert, M. Hyodo, Y. Hayakawa, and R. E. Vance. 2011. STING is a direct innate immune sensor of cyclic di-GMP. Nature 478: 515–518. Burdette, D. L., and R. E. Vance. 2013. STING and the innate immune response to nucleic acids in the cytosol. Nat. Immunol. 14: 19–26. Ishikawa, H., and G. N. Barber. 2008. STING is an endoplasmic reticulum adaptor that facilitates innate immune signalling. Nature 455: 674–678. Schoggins, J. W., D. A. MacDuff, N. Imanaka, M. D. Gainey, B. Shrestha, J. L. Eitson, K. B. Mar, R. B. Richardson, A. V. Ratushny, V. Litvak, et al. 2014. Pan-viral specificity of IFN-induced genes reveals new roles for cGAS in innate immunity. Nature 505: 691–695. Crow, Y. J., B. E. Hayward, R. Parmar, P. Robins, A. Leitch, M. Ali, D. N. Black, H. van Bokhoven, H. G. Brunner, B. C. Hamel, et al. 2006. Mutations in the gene encoding the 39-59 DNA exonuclease TREX1 cause Aicardi-Goutie`res syndrome at the AGS1 locus. Nat. Genet. 38: 917–920. Lee-Kirsch, M. A., M. Gong, D. Chowdhury, L. Senenko, K. Engel, Y. A. Lee, U. de Silva, S. L. Bailey, T. Witte, T. J. Vyse, et al. 2007. Mutations in the gene encoding the 39-59 DNA exonuclease TREX1 are associated with systemic lupus erythematosus. Nat. Genet. 39: 1065–1067. Ahn, J., D. Gutman, S. Saijo, and G. N. Barber. 2012. STING manifests self DNAdependent inflammatory disease. Proc. Natl. Acad. Sci. USA 109: 19386–19391. Konno, H., K. Konno, and G. N. Barber. 2013. Cyclic dinucleotides trigger ULK1 (ATG1) phosphorylation of STING to prevent sustained innate immune signaling. Cell 155: 688–698. Fernandes-Alnemri, T., J. W. Yu, C. Juliana, L. Solorzano, S. Kang, J. Wu, P. Datta, M. McCormick, L. Huang, E. McDermott, et al. 2010. The AIM2 inflammasome is critical for innate immunity to Francisella tularensis. Nat. Immunol. 11: 385–393. Jones, J. W., N. Kayagaki, P. Broz, T. Henry, K. Newton, K. O’Rourke, S. Chan, J. Dong, Y. Qu, M. Roose-Girma, et al. 2010. Absent in melanoma 2 is required for innate immune recognition of Francisella tularensis. Proc. Natl. Acad. Sci. USA 107: 9771–9776. Panchanathan, R., X. Duan, H. Shen, V. A. Rathinam, L. D. Erickson, K. A. Fitzgerald, and D. Choubey. 2010. Aim2 deficiency stimulates the expression of IFN-inducible Ifi202, a lupus susceptibility murine gene within the Nba2 autoimmune susceptibility locus. J. Immunol. 185: 7385–7393. Rathinam, V. A., Z. Jiang, S. N. Waggoner, S. Sharma, L. E. Cole, L. Waggoner, S. K. Vanaja, B. G. Monks, S. Ganesan, E. Latz, et al. 2010. The AIM2 inflammasome is essential for host defense against cytosolic bacteria and DNA viruses. Nat. Immunol. 11: 395–402. Schroder, K., and J. Tschopp. 2010. The inflammasomes. Cell 140: 821–832. Jorgensen, I., and E. A. Miao. 2015. Pyroptotic cell death defends against intracellular pathogens. Immunol. Rev. 265: 130–142. Roberson, S. M., and W. S. Walker. 1988. Immortalization of cloned mouse splenic macrophages with a retrovirus containing the v-raf/mil and v-myc oncogenes. Cell. Immunol. 116: 341–351. Brunette, R. L., J. M. Young, D. G. Whitley, I. E. Brodsky, H. S. Malik, and D. B. Stetson. 2012. Extensive evolutionary and functional diversity among mammalian AIM2-like receptors. J. Exp. Med. 209: 1969–1983. Conlon, J., D. L. Burdette, S. Sharma, N. Bhat, M. Thompson, Z. Jiang, V. A. K. Rathinam, B. Monks, T. Jin, T. S. Xiao, et al. 2013. Mouse, but not human STING, binds and signals in response to the vascular disrupting agent 5,6dimethylxanthenone-4-acetic acid. J. Immunol. 190: 5216–5225. duVerle, D. A., and H. Mamitsuka. 2012. A review of statistical methods for prediction of proteolytic cleavage. Brief. Bioinform. 13: 337–349. Shi, J., Y. Zhao, K. Wang, X. Shi, Y. Wang, H. Huang, Y. Zhuang, T. Cai, F. Wang, and F. Shao. 2015. Cleavage of GSDMD by inflammatory caspases determines pyroptotic cell death. Nature 526: 660–665. Mayer-Barber, K. D., B. B. Andrade, S. D. Oland, E. P. Amaral, D. L. Barber, J. Gonzales, S. C. Derrick, R. Shi, N. P. Kumar, W. Wei, et al. 2014. Hostdirected therapy of tuberculosis based on interleukin-1 and type I interferon crosstalk. Nature 511: 99–103. Sims, J. E., and D. E. Smith. 2010. The IL-1 family: regulators of immunity. Nat. Rev. Immunol. 10: 89–102. Man, S. M., Q. Zhu, L. Zhu, Z. Liu, R. Karki, A. Malik, D. Sharma, L. Li, R. K. Malireddi, P. Gurung, et al. 2015. Critical Role for the DNA Sensor AIM2 in Stem Cell Proliferation and Cancer. Cell 162: 45–58. Sivan, A., L. Corrales, N. Hubert, J. B. Williams, K. Aquino-Michaels, Z. M. Earley, F. W. Benyamin, Y. M. Lei, B. Jabri, M. L. Alegre, et al. 2015. Commensal Bifidobacterium promotes antitumor immunity and facilitates antiPD-L1 efficacy. Science 350: 1084–1089. Ve´tizou, M., J. M. Pitt, R. Daille`re, P. Lepage, N. Waldschmitt, C. Flament, S. Rusakiewicz, B. Routy, M. P. Roberti, C. P. Duong, et al. 2015. Anticancer immunotherapy by CTLA-4 blockade relies on the gut microbiota. Science 350: 1079–1084.
Downloaded from http://www.jimmunol.org/ at George Mason Univ Acq Dept/MSN/2 Fl on February 29, 2016
and indeed, we found no evidence for any secreted soluble factor mediating inhibition of the STING pathway. We also questioned whether cGAS or STING could be substrates of caspase-1, but Western blot analysis showed no degradation products of cGAS or STING after DNA stimulation (data not shown). However, the other defined outcome of caspase-1 activation, cell death, revealed a clear difference between inflammasome-sufficient and -deficient cells. Thus, the AIM2 inflammasome activation by cytosolic DNA likely reduces the viability of cells, limiting the activation of other inflammatory pathways in the same APCs. We have previously demonstrated that the activation of the STING pathway in the tumor microenvironment is critical for generating a spontaneous antitumor T cell response (4). Our current data suggest that a possible strategy for enhancing this response could be through targeted inhibition of the inflammasome. Indeed, it has been demonstrated that signaling though the IL-1R inhibits expression of IFN-b (28). However, we need to consider other factors that could influence the generation of an efficient antitumor T cell response in vivo. First, signals from inflammasome-related cytokines IL-1 and IL-18 might contribute to the generation of an antitumor immunity (29). Second, our studies focus on the consequences of concurrent activation of the AIM2 and cGAS/STING pathways within the same cell. It is conceivable that coordinated activation of these pathways in distinct cell types may occur in vivo, which could interact productively. In addition, it is also conceivable that this mechanism only occurs in some types of cells, such as DCs and macrophages that express both cGAS and AIM2, but may be absent in stromal cells in which AIM2 is not expressed or needs to be induced by type I IFN signaling (5, 20). Third, it was recently reported that Aim2deficient animals may maintain a dysbiotic gut microbiota that accelerates tumorigenesis in an inflammatory model of colorectal cancer (30). This last consideration is important, as recent evidence has indicated that the composition of the gut microbiota modulates the systemic immune response against distant tumors (31, 32). These considerations imply that the in vivo effect of this regulatory mechanism might be more complex, and future work will be necessary to dissect the potentially more multifaceted interplay between the AIM2 inflammasome and the cGAS/STING pathway in vivo.
