Pathology (December 2015) 47(7), pp. 678–682
MICROBIOLOGY
Antibiotic susceptibility of diverse Mycobacterium abscessus complex strains in New South Wales, Australia KYRA Y. L. CHUA1, ANDREA BUSTAMANTE1, PETER JELFS1, SHARON C-A. CHEN1,2 1,2 AND VITALI SINTCHENKO 1Centre for Infectious Diseases and Microbiology Laboratory Services, Institute of Clinical Pathology and Medical Research - Pathology West, Westmead Hospital, Westmead, and 2Marie Bashir Institute for Infectious Diseases and
Biosecurity, The University of Sydney, Sydney, NSW, Australia
Summary Members of the Mycobacterium abscessus complex are emerging pathogens of increasing importance, causing both respiratory and soft tissue infections, but precise speciation is problematic. This study was performed to examine the subspecies and antibiotic susceptibility of M. abscessus complex isolates collected during 2013 at the statewide New South Wales Mycobacterium Reference Laboratory (NSW MRL), Australia. Mycobacterium abscessus subsp. abscessus accounted for more than half of all M. abscessus isolates (n ¼ 24, 57.1%), and M. abscessus subsp. massiliense comprised the remainder of the isolates (n ¼ 18, 42.9%). There were no M. abscessus subsp. bolletii isolates. The prevalence of antibiotic resistance to all antibiotics, apart from amikacin was high, with 26.3% of isolates being reliably susceptible to only amikacin. Most M. abscessus subsp. abscessus isolates (80%) demonstrated inducible clarithromycin resistance whereas the majority of M. abscessus subsp. massiliense isolates (94.4%) remained susceptible to clarithromycin. There was a good correlation between the erm(41) genotype and clarithromycin susceptibility results after 14 days of incubation for most isolates with only three exceptions. Further studies correlating in vitro susceptibility profiles with clinical outcomes of M. abscessus infections treated with combination antimicrobial therapy are warranted. Key words: Antibiotic resistance, Australia, clarithromycin, Mycobacterium abscessus. Received 7 May, revised 3 July, accepted 8 July 2015
INTRODUCTION Mycobacterium abscessus complex is a rapidly growing mycobacterium that is increasing in importance globally, in particular in patients with cystic fibrosis and other chronic suppurative lung disease, where it causes pulmonary infections.1,2 Although there have been a number of taxonomic changes, whole genome sequencing of this species complex supports its division into three subspecies: M. abscessus subsp. abscessus (M. abscessus sensu stricto), M. abscessus subsp. bolletii, and M. abscessus subsp. massiliense.2,3 Differentiation of these subspecies in routine diagnostic laboratories remains difficult and has traditionally relied on amplification and DNA sequencing of multiple genetic loci including hsp65, rpoB, secA1, sodA, and the internal transcribed spacer (ITS) region between the 16S and 23S rRNA genes.4 – 6 Inference of Print ISSN 0031-3025/Online ISSN 1465-3931 Copyright DOI: 10.1097/PAT.0000000000000327
#
horizontal gene transfer within the M. abscessus complex has been described and therefore differences at a single locus cannot be used to reliably determine the subspecies within this complex.7 It is perhaps for this reason that there has been no previous Australian study describing to a subspecies level the molecular epidemiology of this important Mycobacterium species that has significantly increased in prevalence in Australia.8 Precise speciation of M. abscessus complex has become clinically relevant as these bacteria may demonstrate resistance to multiple antibiotics including macrolide agents such as clarithromycin and azithromycin, which are key drugs in the treatment of infections caused by this organism complex.9–11 Macrolide resistance may be mediated by a number of mechanisms and susceptibility is often linked to the different subspecies within the M. abscessus complex.12 Point mutations at positions A2058 and A2059 in the rrl gene that encodes for the 23S rRNA peptidyltransferase region results in macrolide resistance that is apparent by phenotypic susceptibility testing after 72 hours of incubation.13,14 In addition, M. abscessus complex may also demonstrate inducible macrolide resistance.15 Phenotypic detection of inducible macrolide resistance requires prolonged incubation and a final growth reading at 14 days.14 Inducible resistance is mediated by the erythromycin ribosomal methylase gene, erm(41). A single nucleotide polymorphism at base position 28 of this gene allows for inducible clarithromycin resistance; a C-to-T mutation (T28) results in inducible resistance whereas isolates containing C28 remain clarithromycin susceptible.15 In contrast, isolates containing deletions in erm(41), resulting in a non-functional gene, are clarithromycin susceptible.15 In general, M. abscessus subsp. abscessus, and M. abscessus subsp. bolletii often demonstrate inducible macrolide resistance. Mycobacterium abscessus subsp. massiliense are often clarithromycin susceptible due to deletions in erm(41).15 However, M. abscessus subsp. massiliense isolates containing the full length erm(41) gene have been described, and these isolates demonstrated inducible clarithromycin resistance.16 The purpose of this study was to examine the subspecies and antibiotic susceptibility of sequential and non-duplicate Mycobacterium abscessus complex isolates collected during 2013 at the statewide New South Wales Mycobacterium Reference Laboratory (NSW MRL), Australia. The NSW MRL receives isolates from private and public pathology providers that serve eight paediatric and adult cystic fibrosis treatment units, and all tertiary teaching hospitals in the state.
2015 Royal College of Pathologists of Australasia. All rights reserved.
Copyright © Royal College of pathologists of Australasia. Unauthorized reproduction of this article is prohibited.
MYCOBACTERIUM ABSCESSUS IN AUSTRALIA
MATERIALS AND METHODS Isolates Mycobacterium abscessus complex isolates referred to the NSW MRL between January 2013 and February 2014 were examined. Duplicate isolates from the same patient (n ¼ 16), isolates contaminated by fungal growth on the plate (n ¼ 1), and missing isolates (n ¼ 3) were excluded from the study. Therefore, there were 42 isolates included in the study for subspeciation. All isolates, apart from four M. abscessus subsp. abscessus isolates that were unable to be revived after retrieval from storage, were also subjected to susceptibility testing. DNA extraction Bacterial DNA was extracted according to the manufacturer’s instructions using InstaGene matrix (Bio-Rad Laboratories, USA). Briefly, two to four M. abscessus colonies were resuspended in 1 mL of sterile water. This suspension was sonicated for 20 min. The bacterial pellet obtained by centrifugation was resuspended in IstaGene matrix (Bio-Rad), incubated at 568C for 20 min, and then boiled for a further 8 min. This suspension was spun down by centrifugation and the supernatant used as template DNA for polymerase chain reaction (PCR) amplification. Identification of M. abscessus complex All Mycobacterium isolates referred to the NSW MRL were initially identified by high performance liquid chromatography (HPLC).17 Following HPLC, to differentiate between M. abscessus complex and M. chelonae, a real-time multiplex PCR targeting the ITS region was performed, as previously described.18
679
Analysis of the erm(41) gene Amplification and sequencing of the erm(41) gene was performed as previously described.12,15 The primer sequences were MC8-22, 50 GAGCGCCGTCACAAGATGCACA; and MC8-27, 50 GCGCCGCCTGCGCCGCCTGATCACCAGCAC. PCR cycling conditions were as previously described.12 PCR products were sequenced using the same primers employed for amplification. Interpretation of the resulting sequences was performed as per Nash et al.15 Where relevant, these sequences were also analysed by conducting a pairwise alignment using NCBI BLASTN against previously described erm(41) gene sequevars (1–10).23
RESULTS Identification of clinical isolates There were 24 M. abscessus subsp. abscessus isolates and 18 M. abscessus subsp. massiliense isolates identified. No M. abscessus subsp. bolletii isolates were identified in this collection. All isolates were recovered from human infections. All isolates were from the respiratory tract (sputum or bronchoscopy-obtained specimens), apart from six isolates; five were recovered from tissue or pus specimens from skin/soft tissue infections (breast, finger, shoulder, neck, thigh), and one was from urine. Four of the skin and soft tissue isolates were M. abscessus subsp. massiliense and one was M. abscessus subsp. abscessus. The urine isolate was M. abscessus subsp. massiliense. All isolates were obtained from patients aged >16 years (median age 58 years, range 6–86 years) except one M. abscessus subsp. abscessus strain isolated from the respiratory tract of a 6-year-old with cystic fibrosis.
Identification of subspecies within M. abscessus complex The hsp65, rpoB genes, and the ITS region were amplified as previously described.6,19–21 Briefly, the primer sequences were as follows. For hsp65 the primers were TB11, 50 ACCAACGATGGTGTGTCCAT; and TB12, 50 CTTGTCGAACCGCATACCCT.21 For rpoB, the primers were MabrpoF, 50 GAGGGTCAGACCACGATGAC; and MabrpoR, 50 AGCCGATCAAGCCGATCAGACCGATGTT.19 For the ITS region, the primers were ITSF, 50 TTGTACACACCGCCCGTCA; and ITSR, 50 TCTCGATGCCAAGGCATCTCGATGCCAAGGCATCCACC.6,20 Each PCR mixture contained 0.2 mM of each primer, MyTaq HS Red Mix (Bioline, USA), 5 mL of DMSO and 2 mL of nucleic acid template in a final 50 mL reaction. The PCR cycling conditions for amplification of hsp65 and rpoB were as follows: 958C for 10 min; followed by 40 cycles of 948C for 30 s, 588C for 60 s, 728C for 60 s; followed by 728C for 10 min. For amplification of the ITS region, the cycling conditions were 958C for 10 min; followed by 40 cycles of 948C for 30 s, 508C for 60 s, 728C for 60 s; followed by 728C for 10 min. The PCR products obtained were Sanger sequenced using the same primers used for amplification. To determine the M. abscessus subspecies, the sequences were analysed, as previously described, by performing a pairwise alignment using NCBI BLASTN against reference sequences from strains M. abscessus subsp. abscessus JCM 13569T, M. abscessus subsp. bolletii JCM 15297T, M. abscessus subsp. massiliense JCM 15300T and M. abscessus subsp. massiliense strain A1, that have been deposited into the International Nucleotide Sequence Databases (INSD) under accession numbers AB548592 to AB548607 as previously described by Nakanaga et al.6,22 Phenotypic susceptibility testing Susceptibility testing was performed using broth microdilution according to the manufacturer’s instructions and the Clinical and Laboratory Standards Institute (CLSI) guidelines using Sensititre Rapid Growing Mycobacteria Plates (TREK Diagnostic Systems, ThermoFischer Scientific, USA).14 Antibiotics tested included trimethoprim/sulfamethoxazole, ciprofloxacin, moxifloxacin, cefoxitin, amikacin, tobramycin, doxycycline, minocycline, tigecycline, clarithromycin, linezolid, imipenem, ceftriaxone, cefipime, and amoxicillin/clavulanic acid. Plates were read at 72 h for all antibiotics. In addition, for clarithromycin, plates were also read at 14 days to determine the presence of inducible macrolide resistance, unless the isolate was resistant at the earlier 72 h reading. Interpretation of susceptibility testing for all antibiotics was performed according CLSI guidelines.14
Phenotypic antibiotic susceptibility results This was performed on 20 M. abscessus subsp. abscessus isolates and 18 M. abscessus subsp. massiliense isolates. In general, isolates were highly resistant to most of the agents tested, with similar results for both M. abscessus subspecies (Table 1; Supplementary Table 1, http://links.lww.com/PAT/A40). Amikacin was the most active antimicrobial with only one isolate in each subspecies that tested resistant. Ten isolates were only susceptible to amikacin. Most isolates were either resistant or had intermediate susceptibility to tobramycin, another aminoglycoside. No isolate was tobramycin susceptible. Resistance to the fluoroquinolones was frequent. No isolate was susceptible to ciprofloxacin or moxifloxacin. Similarly, none of the isolates appeared susceptible to the beta-lactams or imipenem, apart from one M. abscessus subsp. massiliense isolate that was susceptible to imipenem (Table 1). Of these, cefoxitin had the highest activity in vitro with most isolates having intermediate susceptibility (MIC range 32–64 mg/mL; Table 1; Supplementary Table 1, http://links.lww.com/PAT/A40). Most isolates were resistant to trimethoprim-sulfamethoxazole. There was only one isolate (M. abscessus subsp. massiliense) that demonstrated susceptibility to the doxycycline. The MICs to minocycline were also elevated. There are no CLSI criteria for the interpretation of tigecycline.14 Other authors have used a resistance breakpoint of >4 mg/mL for tigecycline.24 Using this breakpoint, there was one isolate of each subspecies that was resistant. However, MICs were high with a MIC50 of 2 mg/mL and MIC90 of 4 mg/mL. There was a wide range of MICs to linezolid with a spread of isolates across the susceptible, intermediate and resistance ranges with most isolates being of intermediate susceptibility (M. abscessus subsp. abscessus, n ¼ 8, 40%; M. abscessus subsp. massiliense, n ¼ 9, 50%; Table 1; Supplementary Table 1, http://links.lww.com/PAT/A40).
Copyright © Royal College of pathologists of Australasia. Unauthorized reproduction of this article is prohibited.
*
16 (88.9) *
2 (11.1)
* *
* *
*
*
12 (66.7) 3 (16.7) 14 (77.8) 5 (27.8) 9 (50) 3 (16.7) 1 (5.6) 6 (33.3) 1 (5.6)
* *
* *
*
*
5 (27.8) 13 (72.2)
* *
0
*
1 (5.6) 0
* *
17 (94.4)
16 16 1 16 2 (11.1) 2 (11.1) 0 2 (11.1)
>4 >8 16 >16 0.5 2 >64/32 >128 >64 >32 >64 32 >16 >8 4 >8/152 19 (95) *
1 (5)
No CLSI interpretive criteria at the time of the study.
d, day; h, hour.
Ciprofloxacin Moxifloxacin Amikacin Tobramycin Clarithromycin after 72 h incubation Clarithromycin after 14 d incubation Amoxicillin-clavulanic acid (2:1 ratio) Cefoxitin Ceftriaxone Cefepime Imipenem Linezolid Doxycycline Minocycline Tigecycline Trimethoprim-sulfamethoxazole
*
* * *
* * *
14 (70) 4 (20) 18 (90) 6 (30) 8 (40) 2 (10) 0 8 (40) 0
* * *
* * *
*
2 (10)
*
18 (90)
*
*
17 (85)
*
0
*
3 (15)
0
20 (100) 19 (95) 1 (5) 6 (30) 0 1 (5) 0 14 (70) 0 0 19 (95) 0
>4 >8 16 8 1 >16 >64/32 64 >64 >32 64 32 >16 >8 4 >8/152 >4 >8 4 4 0.25 >16 >64/32 64 >64 >32 32 16 >16 >8 2 >8/152
DISCUSSION
4–>4 2–>8 4–>64 4–>16 16 0.5–>16 64/32–>64/32 32–>128 64–>64 >32 8–>64 32 2–>16 8–>8 1–>4 0.5/9.5–>8/152
MIC90 (mg/mL) MIC50 (mg/mL) MIC range (mg/mL) Drug
Clarithromycin susceptibility of M. abscessus complex isolates Similar clarithromycin susceptibility results after 72 h incubation were observed for both M. abscessus subspecies (Table 1). In contrast, after 14 days of incubation, most M. abscessus subsp. abscessus were classed as resistant (n ¼ 17, 85%), whereas most M. abscessus subsp. massiliense were susceptible (n ¼ 17, 94.4%). Specifically, there were three patterns of clarithromycin susceptibility observed (Table 2). The first group was that of clarithromycin resistance evident after 72 h incubation. There was one isolate of each M. abscessus subspecies that demonstrated this pattern. The second group comprised those isolates that were initially clarithromycin susceptible after 72 h, but following prolonged incubation, demonstrated resistance (MIC 8 mg/mL) at 14 days. All of these isolates were M. abscessus subsp. abscessus and this pattern was observed in the majority of this subspecies (n ¼ 16, 80%; Table 2). The erm(41) gene in these isolates demonstrated the T28 sequevar. The third group were isolates that remained susceptible after 14 days of incubation (Table 2). All but one of M. abscessus subsp. massiliense demonstrated this pattern. erm(41) genotyping indicated that deletions in this gene were present to account for clarithromycin susceptibility. There were also three M. abscessus subsp. abscessus isolates that demonstrated this susceptibility pattern. The C28 sequevar of the erm(41) gene was present in two of these M. abscessus subsp. abscessus isolates to account for the clarithromycin susceptibility observed. However, in one isolate, the T28 sequevar of the erm(41) gene was found. Both the phenotypic susceptibility testing and erm(41) genotyping was repeated on this isolate and the results remained unchanged; the clarithromycin MIC remained at 1 mg/mL after 14 days of incubation on repeat testing. Further analysis of the erm(41) gene demonstrated a type 1 erm sequevar, that is the sequevar present in the M. abscessus subsp. abscessus type strain, ATCC 19977.
2–>4 2–>8 4–>64 4–>16 16 16 >64/32 32–>128 64–>64 >32 4–>64 32 1–>16 8 0.5–>4 2/38–>8/152
>4 >8 8 16 0.12 0.5 >64/32 64 >64 >32 32 16 >16 8 2 >8/152
0 0 17 (94.4) 0
Intermediate n (%) Susceptible n (%) MIC90 (mg/mL) MIC50 (mg/mL) Intermediate n (%) Susceptible n (%)
Resistant n (%)
MIC range (mg/mL)
M. abscessus subsp. massiliense (n ¼ 18) M. abscessus subsp. abscessus (n ¼ 20)
Phenotypic susceptibility results for M. abscessus subsp. abscessus and M. abscessus subsp. massiliense by broth microdilution Table 1
Pathology (2015), 47(7), December
(88.9) (88.9) (5.6) (88.9)
CHUA et al.
Resistant n (%)
680
In this study, we identified that M. abscessus subsp. abscessus (n ¼ 24, 57.1%) was more common than M. abscessus subsp. massiliense (n ¼ 18, 42.9%). There were no M. abscessus subsp. bolletii isolates identified. Previous studies have demonstrated that the prevalence of different subspecies varies by geography. Mycobacterium abscessus subsp. abscessus predominates in USA, France and Japan, whereas in South Korea M. abscessus subsp. massiliense is more common.5,6,25–27 Mycobacterium abscessus subsp. bolletii is less common in these regions, except in Brazil, where an epidemic clone causing post-surgical infections has been reported.28 Recently, M. abscessus subsp. massiliense was demonstrated by whole genome sequencing to cause outbreaks of difficult-to-treat infection in patients with cystic fibrosis in the UK.2 This present study was not designed as an outbreak investigation and epidemiological information on the isolates was unavailable in most instances. However, the patient median age of 58 years was suggestive that most of these isolates were obtained from non-cystic fibrosis patients. The isolates characterised in this study can be used as a reference collection to evaluate methods described in the literature to perform routine subspeciation of M. abscessus complex isolates in our laboratory. These methods include PCR amplification of a number of different loci and MALDI-TOF.6,16,29
Copyright © Royal College of pathologists of Australasia. Unauthorized reproduction of this article is prohibited.
MYCOBACTERIUM ABSCESSUS IN AUSTRALIA
Table 2
681
Clarithromycin susceptibility results for M. abscessus subsp. abscessus and M. abscessus subsp. massiliense isolates
Group 1 2
3
Clarithromycin susceptibility phenotype Resistant after 72 h incubation* Susceptible after 72 h incubation, but resistant after 14 d incubation Susceptible after 72 h incubation, and remain susceptible after 14 d incubation
M. abscessus subsp. abscessus isolates (n ¼ 20)
erm(41) genotype
M. abscessus subsp. massiliense isolates (n ¼ 18)
erm(41) genotype Deletions
1
T28 sequevar
1
16
T28 sequevar
0
2
C28 sequevar
17
1
T28 sequevar
Deletions
d, day; h, hour. * These isolates are presumed to contain mutations in the rrl gene to account for clarithromycin resistance but experiments to demonstrate this were not performed in this study.
In this culture collection, M. abscessus subspecies demonstrated high levels of in vitro resistance to almost all antibiotics tested, with ten isolates (26.3%) being reliably susceptible to only amikacin. Isolates here also demonstrated higher rates of resistance to linezolid, cefoxitin and imipenem, in comparison with other studies.10,30,31 A broad spectrum class A betalactamase, BlaMAB, in M. abscessus has been recently characterised that allows for resistance to beta-lactams and imipenem.32 Avibactam, a novel beta-lactamase inhibitor has been shown to inhibit the BlaMAB and combination therapy with this agent may provide additional therapeutic options for managing M. abscessus infections.33 The MICs to tigecycline in this study were high with an MIC90 of 4 mg/mL. This is in contrast to reports from the USA where an MIC90 of 0.25 mg/mL (range 0.06–1 mg/mL) was reported.24 In the US setting, tigecycline has been demonstrated to be a useful agent in salvage therapy for M. abscessus infections.34 Clarithromycin susceptibility is important in determining treatment outcome with patients infected with clarithromycin-susceptible isolates having better treatment response than those harbouring clarithromycin resistant isolates.35,36 In a Korean study, in vitro clarithromycin susceptibility after prolonged incubation (14 days) was demonstrated to be associated with favourable outcomes from combination therapy of clarithromycin and amikacin, possibly combined with cefoxitin.27 Clarithromycin susceptibility patterns observed in this present study (Table 2) were as expected from the literature. The two isolates that demonstrated resistance after only 72 h incubation were presumed to contain rrl point mutations but experiments to demonstrated this were not performed in this study.13 This pattern of resistance is less common compared to the other two patterns.12,37 The isolates that were initially susceptible, but after 14 days demonstrated resistance, all contained the T28 sequevar in the erm(41) gene that allows for inducible resistance.15 There was one M. abscessus subsp. abscessus isolate that although containing the T28 sequevar, remained clarithromycin susceptible after prolonged incubation. Brown-Elliot and colleagues recently examined polymorphisms in the erm(41) gene in detail and described 10 different sequevars.23 In this study, the authors found that the correlation between erm(41) sequevars and phenotypic susceptibility to clarithromycin was not always so straightforward. There were isolates
with the T28 sequevar, including the type 1 erm sequevar contained by the isolate in our study, which demonstrated MICs 2 mg/mL (i.e., within the susceptible range) after 14 days incubation. Additionally, there were also isolates containing the C28 sequevar that initially demonstrated MICs of 4 mg/mL (i.e., intermediate susceptibility) and 8 mg/mL (i.e., resistant, by CLSI criteria).23 In our study, the two C28 sequevar containing isolates (both M. abscessus subsp. abscessus), were clarithromycin susceptible. All M. abscessus subsp. massiliense isolates in this study contained erm(41) deletions. All of these, apart from one isolate, remained clarithromycin susceptible after 14 days. This single M. abscessus subsp. massiliense isolate that displayed a different phenotype demonstrated resistance at 72 h incubation. Collectively, these results demonstrate the contribution of both phenotypic and genotypic testing for assessment of clarithromycin susceptibility. A limitation of this study was the relatively small number of isolates examined. In addition, because disease caused by nontuberculous mycobacteria is a not a public health-notifiable infection in the state of NSW, there may be some bias towards isolates causing more severe disease being referred to our centre for identification and characterisation. In conclusion, we have identified that for a large part of NSW, M. abscessus subsp. abscessus accounted for >50% of M. abscessus isolates, and that M. abscessus subsp. bolletii was rare. The prevalence of resistance to almost all antibiotics tested, apart from amikacin, was high. The majority (80%) of M. abscessus subsp. abscessus isolates in NSW demonstrated in vitro clarithromycin resistance whereas most M. abscessus subsp. massiliense (94.4%) remained susceptible to macrolides after prolonged incubation with a good correlation between the erm(41) genotype and clarithromycin susceptibility results for most isolates (Table 2). Similar future studies will allow for comparison of prevalence trends and evolution of antibiotic resistance patterns. Studies correlating in vitro susceptibility profiles with clinical outcomes of infections treated with multi-drug combination therapies caused by this emerging mycobacterium are warranted.
Acknowledgements: We would like to thank Qinning Wang from CIDMLS for technical advice.
Copyright © Royal College of pathologists of Australasia. Unauthorized reproduction of this article is prohibited.
682
CHUA et al.
Conflicts of interest and sources of funding: The authors state that there are no conflicts of interest to disclose. Address for correspondence: Dr Kyra Y. L. Chua, Department of Microbiology and Immunology, The University of Melbourne, Parkville, Vic 3010, Australia. E-mail: [email protected]
References 1. Howard ST. Recent progress towards understanding genetic variation in the Mycobacterium abscessus complex. Tuberculosis (Edinb) 2013; 93 (Suppl): S15–20. 2. Bryant JM, Grogono DM, Greaves D, et al. Whole-genome sequencing to identify transmission of Mycobacterium abscessus between patients with cystic fibrosis: a retrospective cohort study. Lancet 2013; 381: 1551–60. 3. Sassi M, Drancourt M. Genome analysis reveals three genomospecies in Mycobacterium abscessus. BMC Genomics 2014; 15: 359. 4. Macheras E, Roux AL, Ripoll F, et al. Inaccuracy of single-target sequencing for discriminating species of the Mycobacterium abscessus group. J Clin Microbiol 2009; 47: 2596–600. 5. Zelazny AM, Root JM, Shea YR, et al. Cohort study of molecular identification and typing of Mycobacterium abscessus, Mycobacterium massiliense, and Mycobacterium bolletii. J Clin Microbiol 2009; 47: 1985–95. 6. Nakanaga K, Sekizuka T, Fukano H, et al. Discrimination of Mycobacterium abscessus subsp. massiliense from Mycobacterium abscessus subsp. abscessus in clinical isolates by multiplex PCR. J Clin Microbiol 2014; 52: 251–9. 7. Macheras E, Roux AL, Bastian S, et al. Multilocus sequence analysis and rpoB sequencing of Mycobacterium abscessus (sensu lato) strains. J Clin Microbiol 2011; 49: 491–9. 8. Thomson RM. Changing epidemiology of pulmonary nontuberculous mycobacteria infections. Emerg Infect Dis 2010; 16: 1576–83. 9. Griffith DE, Aksamit T, Brown-Elliott BA, et al. An official ATS/IDSA statement: diagnosis, treatment, and prevention of nontuberculous mycobacterial diseases. Am J Respir Crit Care Med 2007; 175: 367–416. 10. Nessar R, Cambau E, Reyrat JM, Murray A, Gicquel B. Mycobacterium abscessus: a new antibiotic nightmare. J Antimicrob Chemother 2012; 67: 810–8. 11. Jarand J, Levin A, Zhang L, Huitt G, Mitchell JD, Daley CL. Clinical and microbiologic outcomes in patients receiving treatment for Mycobacterium abscessus pulmonary disease. Clin Infect Dis 2011; 52: 565–71. 12. Hanson KE, Slechta ES, Muir H, Barker AP. Rapid molecular detection of inducible macrolide resistance in Mycobacterium chelonae and M. abscessus strains: a replacement for 14-day susceptibility testing? J Clin Microbiol 2014; 52: 1705–7. 13. Wallace RJ Jr, Meier A, Brown BA, et al. Genetic basis for clarithromycin resistance among isolates of Mycobacterium chelonae and Mycobacterium abscessus. Antimicrob Agents Chemother 1996; 40: 1676–81. 14. Clinical and Laboratory Standards Institute. Susceptibility testing of Mycobacteria, Nocardiae, and other Aerobic Actinomycetes; Approved Standard - Second Edition. CLSI document M24-A2. Wayne, PA: CLSI, 2011. 15. Nash KA, Brown-Elliott BA, Wallace RJ Jr. A novel gene, erm(41), confers inducible macrolide resistance to clinical isolates of Mycobacterium abscessus but is absent from Mycobacterium chelonae. Antimicrob Agents Chemother 2009; 53: 1367–76. 16. Shallom SJ, Gardina PJ, Myers TG, et al. New rapid scheme for distinguishing the subspecies of the Mycobacterium abscessus group and identifying Mycobacterium massiliense isolates with inducible clarithromycin resistance. J Clin Microbiol 2013; 51: 2943–9. 17. Butler WR, Guthertz LS. Mycolic acid analysis by high-performance liquid chromatography for identification of Mycobacterium species. Clin Microbiol Rev 2001; 14: 704–26. 18. Xiong L, Kong F, Yang Y, Cheng J, Gilbert GL. Use of PCR and reverse line blot hybridization macroarray based on 16S-23S rRNA gene internal transcribed spacer sequences for rapid identification of 34 Mycobacterium species. J Clin Microbiol 2006; 44: 3544–50.
Pathology (2015), 47(7), December
19. Nakanaga K, Hoshino Y, Era Y, et al. Multiple cases of cutaneous Mycobacterium massiliense infection in a ‘‘hot spa’’ in Japan. J Clin Microbiol 2011; 49: 613–7. 20. Roth A, Fischer M, Hamid ME, Michalke S, Ludwig W, Mauch H. Differentiation of phylogenetically related slowly growing mycobacteria based on 16S-23S rRNA gene internal transcribed spacer sequences. J Clin Microbiol 1998; 36: 139–47. 21. Telenti A, Marchesi F, Balz M, Bally F, Bottger EC, Bodmer T. Rapid identification of mycobacteria to the species level by polymerase chain reaction and restriction enzyme analysis. J Clin Microbiol 1993; 31: 175–8. 22. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol 1990; 215: 403–10. 23. Brown-Elliott BA, Vasireddy S, Vasireddy R, et al. Utility of sequencing the erm(41) gene in isolates of Mycobacterium abscessus subsp. abscessus with low and intermediate clarithromycin MICs. J Clin Microbiol 2015; 53: 1211–5. 24. Wallace RJ Jr, Brown-Elliott BA, Crist CJ, Mann L, Wilson RW. Comparison of the in vitro activity of the glycylcycline tigecycline (formerly GAR936) with those of tetracycline, minocycline, and doxycycline against isolates of nontuberculous mycobacteria. Antimicrob Agents Chemother 2002; 46: 3164–7. 25. Roux AL, Catherinot E, Ripoll F, et al. Multicenter study of prevalence of nontuberculous mycobacteria in patients with cystic fibrosis in France. J Clin Microbiol 2009; 47: 4124–8. 26. Harada T, Akiyama Y, Kurashima A, et al. Clinical and microbiological differences between Mycobacterium abscessus and Mycobacterium massiliense lung diseases. J Clin Microbiol 2012; 50: 3556–61. 27. Koh WJ, Jeon K, Lee NY, et al. Clinical significance of differentiation of Mycobacterium massiliense from Mycobacterium abscessus. Am J Respir Crit Care Med 2011; 183: 405–10. 28. NunesLde S, Baethgen LF, Ribeiro MO, et al. Outbreaks due to Mycobacterium abscessus subsp. bolletii in southern Brazil: persistence of a single clone from 2007 to 2011. J Med Microbiol 2014; 63: 1288 – 93. 29. Teng SH, Chen CM, Lee MR, et al. Matrix-assisted laser desorption ionization-time of flight mass spectrometry can accurately differentiate between Mycobacterium masilliense (M. abscessus subspecies bolletti) and M. abscessus (sensu stricto). J Clin Microbiol 2013; 51: 3113 – 6. 30. Broda A, Jebbari H, Beaton K, Mitchell S, Drobniewski F. Comparative drug resistance of Mycobacterium abscessus and M. chelonae isolates from patients with and without cystic fibrosis in the United Kingdom. J Clin Microbiol 2013; 51: 217–23. 31. Yoshida S, Tsuyuguchi K, Suzuki K, et al. Further isolation of Mycobacterium abscessus subsp. abscessus and subsp. bolletii in different regions of Japan and susceptibility of these isolates to antimicrobial agents. Int J Antimicrob Agents 2013; 42: 226–31. 32. Soroka D, Dubee V, Soulier-Escrihuela O, et al. Characterization of broadspectrum Mycobacterium abscessus class A beta-lactamase. J Antimicrob Chemother 2014; 69: 691–6. 33. Dubee V, Bernut A, Cortes M, et al. Beta-Lactamase inhibition by avibactam in Mycobacterium abscessus. J Antimicrob Chemother 2015; 70: 1051–8. 34. Wallace RJ Jr, Dukart G, Brown-Elliott BA, Griffith DE, Scerpella EG, Marshall B. Clinical experience in 52 patients with tigecycline-containing regimens for salvage treatment of Mycobacterium abscessus and Mycobacterium chelonae infections. J Antimicrob Chemother 2014; 69: 1945– 53. 35. Jeon K, Kwon OJ, Lee NY, et al. Antibiotic treatment of Mycobacterium abscessus lung disease: a retrospective analysis of 65 patients. Am J Respir Crit Care Med 2009; 180: 896–902. 36. Roux AL, Catherinot E, Soismier N, et al. Comparing Mycobacterium massiliense and Mycobacterium abscessus lung infections in cystic fibrosis patients. J Cyst Fibros 2015; 14: 63–9. 37. Bastian S, Veziris N, Roux AL, et al. Assessment of clarithromycin susceptibility in strains belonging to the Mycobacterium abscessus group by erm(41) and rrl sequencing. Antimicrob Agents Chemother 2011; 55: 775–81.
Copyright © Royal College of pathologists of Australasia. Unauthorized reproduction of this article is prohibited.
MICROBIOLOGY
Antibiotic susceptibility of diverse Mycobacterium abscessus complex strains in New South Wales, Australia KYRA Y. L. CHUA1, ANDREA BUSTAMANTE1, PETER JELFS1, SHARON C-A. CHEN1,2 1,2 AND VITALI SINTCHENKO 1Centre for Infectious Diseases and Microbiology Laboratory Services, Institute of Clinical Pathology and Medical Research - Pathology West, Westmead Hospital, Westmead, and 2Marie Bashir Institute for Infectious Diseases and
Biosecurity, The University of Sydney, Sydney, NSW, Australia
Summary Members of the Mycobacterium abscessus complex are emerging pathogens of increasing importance, causing both respiratory and soft tissue infections, but precise speciation is problematic. This study was performed to examine the subspecies and antibiotic susceptibility of M. abscessus complex isolates collected during 2013 at the statewide New South Wales Mycobacterium Reference Laboratory (NSW MRL), Australia. Mycobacterium abscessus subsp. abscessus accounted for more than half of all M. abscessus isolates (n ¼ 24, 57.1%), and M. abscessus subsp. massiliense comprised the remainder of the isolates (n ¼ 18, 42.9%). There were no M. abscessus subsp. bolletii isolates. The prevalence of antibiotic resistance to all antibiotics, apart from amikacin was high, with 26.3% of isolates being reliably susceptible to only amikacin. Most M. abscessus subsp. abscessus isolates (80%) demonstrated inducible clarithromycin resistance whereas the majority of M. abscessus subsp. massiliense isolates (94.4%) remained susceptible to clarithromycin. There was a good correlation between the erm(41) genotype and clarithromycin susceptibility results after 14 days of incubation for most isolates with only three exceptions. Further studies correlating in vitro susceptibility profiles with clinical outcomes of M. abscessus infections treated with combination antimicrobial therapy are warranted. Key words: Antibiotic resistance, Australia, clarithromycin, Mycobacterium abscessus. Received 7 May, revised 3 July, accepted 8 July 2015
INTRODUCTION Mycobacterium abscessus complex is a rapidly growing mycobacterium that is increasing in importance globally, in particular in patients with cystic fibrosis and other chronic suppurative lung disease, where it causes pulmonary infections.1,2 Although there have been a number of taxonomic changes, whole genome sequencing of this species complex supports its division into three subspecies: M. abscessus subsp. abscessus (M. abscessus sensu stricto), M. abscessus subsp. bolletii, and M. abscessus subsp. massiliense.2,3 Differentiation of these subspecies in routine diagnostic laboratories remains difficult and has traditionally relied on amplification and DNA sequencing of multiple genetic loci including hsp65, rpoB, secA1, sodA, and the internal transcribed spacer (ITS) region between the 16S and 23S rRNA genes.4 – 6 Inference of Print ISSN 0031-3025/Online ISSN 1465-3931 Copyright DOI: 10.1097/PAT.0000000000000327
#
horizontal gene transfer within the M. abscessus complex has been described and therefore differences at a single locus cannot be used to reliably determine the subspecies within this complex.7 It is perhaps for this reason that there has been no previous Australian study describing to a subspecies level the molecular epidemiology of this important Mycobacterium species that has significantly increased in prevalence in Australia.8 Precise speciation of M. abscessus complex has become clinically relevant as these bacteria may demonstrate resistance to multiple antibiotics including macrolide agents such as clarithromycin and azithromycin, which are key drugs in the treatment of infections caused by this organism complex.9–11 Macrolide resistance may be mediated by a number of mechanisms and susceptibility is often linked to the different subspecies within the M. abscessus complex.12 Point mutations at positions A2058 and A2059 in the rrl gene that encodes for the 23S rRNA peptidyltransferase region results in macrolide resistance that is apparent by phenotypic susceptibility testing after 72 hours of incubation.13,14 In addition, M. abscessus complex may also demonstrate inducible macrolide resistance.15 Phenotypic detection of inducible macrolide resistance requires prolonged incubation and a final growth reading at 14 days.14 Inducible resistance is mediated by the erythromycin ribosomal methylase gene, erm(41). A single nucleotide polymorphism at base position 28 of this gene allows for inducible clarithromycin resistance; a C-to-T mutation (T28) results in inducible resistance whereas isolates containing C28 remain clarithromycin susceptible.15 In contrast, isolates containing deletions in erm(41), resulting in a non-functional gene, are clarithromycin susceptible.15 In general, M. abscessus subsp. abscessus, and M. abscessus subsp. bolletii often demonstrate inducible macrolide resistance. Mycobacterium abscessus subsp. massiliense are often clarithromycin susceptible due to deletions in erm(41).15 However, M. abscessus subsp. massiliense isolates containing the full length erm(41) gene have been described, and these isolates demonstrated inducible clarithromycin resistance.16 The purpose of this study was to examine the subspecies and antibiotic susceptibility of sequential and non-duplicate Mycobacterium abscessus complex isolates collected during 2013 at the statewide New South Wales Mycobacterium Reference Laboratory (NSW MRL), Australia. The NSW MRL receives isolates from private and public pathology providers that serve eight paediatric and adult cystic fibrosis treatment units, and all tertiary teaching hospitals in the state.
2015 Royal College of Pathologists of Australasia. All rights reserved.
Copyright © Royal College of pathologists of Australasia. Unauthorized reproduction of this article is prohibited.
MYCOBACTERIUM ABSCESSUS IN AUSTRALIA
MATERIALS AND METHODS Isolates Mycobacterium abscessus complex isolates referred to the NSW MRL between January 2013 and February 2014 were examined. Duplicate isolates from the same patient (n ¼ 16), isolates contaminated by fungal growth on the plate (n ¼ 1), and missing isolates (n ¼ 3) were excluded from the study. Therefore, there were 42 isolates included in the study for subspeciation. All isolates, apart from four M. abscessus subsp. abscessus isolates that were unable to be revived after retrieval from storage, were also subjected to susceptibility testing. DNA extraction Bacterial DNA was extracted according to the manufacturer’s instructions using InstaGene matrix (Bio-Rad Laboratories, USA). Briefly, two to four M. abscessus colonies were resuspended in 1 mL of sterile water. This suspension was sonicated for 20 min. The bacterial pellet obtained by centrifugation was resuspended in IstaGene matrix (Bio-Rad), incubated at 568C for 20 min, and then boiled for a further 8 min. This suspension was spun down by centrifugation and the supernatant used as template DNA for polymerase chain reaction (PCR) amplification. Identification of M. abscessus complex All Mycobacterium isolates referred to the NSW MRL were initially identified by high performance liquid chromatography (HPLC).17 Following HPLC, to differentiate between M. abscessus complex and M. chelonae, a real-time multiplex PCR targeting the ITS region was performed, as previously described.18
679
Analysis of the erm(41) gene Amplification and sequencing of the erm(41) gene was performed as previously described.12,15 The primer sequences were MC8-22, 50 GAGCGCCGTCACAAGATGCACA; and MC8-27, 50 GCGCCGCCTGCGCCGCCTGATCACCAGCAC. PCR cycling conditions were as previously described.12 PCR products were sequenced using the same primers employed for amplification. Interpretation of the resulting sequences was performed as per Nash et al.15 Where relevant, these sequences were also analysed by conducting a pairwise alignment using NCBI BLASTN against previously described erm(41) gene sequevars (1–10).23
RESULTS Identification of clinical isolates There were 24 M. abscessus subsp. abscessus isolates and 18 M. abscessus subsp. massiliense isolates identified. No M. abscessus subsp. bolletii isolates were identified in this collection. All isolates were recovered from human infections. All isolates were from the respiratory tract (sputum or bronchoscopy-obtained specimens), apart from six isolates; five were recovered from tissue or pus specimens from skin/soft tissue infections (breast, finger, shoulder, neck, thigh), and one was from urine. Four of the skin and soft tissue isolates were M. abscessus subsp. massiliense and one was M. abscessus subsp. abscessus. The urine isolate was M. abscessus subsp. massiliense. All isolates were obtained from patients aged >16 years (median age 58 years, range 6–86 years) except one M. abscessus subsp. abscessus strain isolated from the respiratory tract of a 6-year-old with cystic fibrosis.
Identification of subspecies within M. abscessus complex The hsp65, rpoB genes, and the ITS region were amplified as previously described.6,19–21 Briefly, the primer sequences were as follows. For hsp65 the primers were TB11, 50 ACCAACGATGGTGTGTCCAT; and TB12, 50 CTTGTCGAACCGCATACCCT.21 For rpoB, the primers were MabrpoF, 50 GAGGGTCAGACCACGATGAC; and MabrpoR, 50 AGCCGATCAAGCCGATCAGACCGATGTT.19 For the ITS region, the primers were ITSF, 50 TTGTACACACCGCCCGTCA; and ITSR, 50 TCTCGATGCCAAGGCATCTCGATGCCAAGGCATCCACC.6,20 Each PCR mixture contained 0.2 mM of each primer, MyTaq HS Red Mix (Bioline, USA), 5 mL of DMSO and 2 mL of nucleic acid template in a final 50 mL reaction. The PCR cycling conditions for amplification of hsp65 and rpoB were as follows: 958C for 10 min; followed by 40 cycles of 948C for 30 s, 588C for 60 s, 728C for 60 s; followed by 728C for 10 min. For amplification of the ITS region, the cycling conditions were 958C for 10 min; followed by 40 cycles of 948C for 30 s, 508C for 60 s, 728C for 60 s; followed by 728C for 10 min. The PCR products obtained were Sanger sequenced using the same primers used for amplification. To determine the M. abscessus subspecies, the sequences were analysed, as previously described, by performing a pairwise alignment using NCBI BLASTN against reference sequences from strains M. abscessus subsp. abscessus JCM 13569T, M. abscessus subsp. bolletii JCM 15297T, M. abscessus subsp. massiliense JCM 15300T and M. abscessus subsp. massiliense strain A1, that have been deposited into the International Nucleotide Sequence Databases (INSD) under accession numbers AB548592 to AB548607 as previously described by Nakanaga et al.6,22 Phenotypic susceptibility testing Susceptibility testing was performed using broth microdilution according to the manufacturer’s instructions and the Clinical and Laboratory Standards Institute (CLSI) guidelines using Sensititre Rapid Growing Mycobacteria Plates (TREK Diagnostic Systems, ThermoFischer Scientific, USA).14 Antibiotics tested included trimethoprim/sulfamethoxazole, ciprofloxacin, moxifloxacin, cefoxitin, amikacin, tobramycin, doxycycline, minocycline, tigecycline, clarithromycin, linezolid, imipenem, ceftriaxone, cefipime, and amoxicillin/clavulanic acid. Plates were read at 72 h for all antibiotics. In addition, for clarithromycin, plates were also read at 14 days to determine the presence of inducible macrolide resistance, unless the isolate was resistant at the earlier 72 h reading. Interpretation of susceptibility testing for all antibiotics was performed according CLSI guidelines.14
Phenotypic antibiotic susceptibility results This was performed on 20 M. abscessus subsp. abscessus isolates and 18 M. abscessus subsp. massiliense isolates. In general, isolates were highly resistant to most of the agents tested, with similar results for both M. abscessus subspecies (Table 1; Supplementary Table 1, http://links.lww.com/PAT/A40). Amikacin was the most active antimicrobial with only one isolate in each subspecies that tested resistant. Ten isolates were only susceptible to amikacin. Most isolates were either resistant or had intermediate susceptibility to tobramycin, another aminoglycoside. No isolate was tobramycin susceptible. Resistance to the fluoroquinolones was frequent. No isolate was susceptible to ciprofloxacin or moxifloxacin. Similarly, none of the isolates appeared susceptible to the beta-lactams or imipenem, apart from one M. abscessus subsp. massiliense isolate that was susceptible to imipenem (Table 1). Of these, cefoxitin had the highest activity in vitro with most isolates having intermediate susceptibility (MIC range 32–64 mg/mL; Table 1; Supplementary Table 1, http://links.lww.com/PAT/A40). Most isolates were resistant to trimethoprim-sulfamethoxazole. There was only one isolate (M. abscessus subsp. massiliense) that demonstrated susceptibility to the doxycycline. The MICs to minocycline were also elevated. There are no CLSI criteria for the interpretation of tigecycline.14 Other authors have used a resistance breakpoint of >4 mg/mL for tigecycline.24 Using this breakpoint, there was one isolate of each subspecies that was resistant. However, MICs were high with a MIC50 of 2 mg/mL and MIC90 of 4 mg/mL. There was a wide range of MICs to linezolid with a spread of isolates across the susceptible, intermediate and resistance ranges with most isolates being of intermediate susceptibility (M. abscessus subsp. abscessus, n ¼ 8, 40%; M. abscessus subsp. massiliense, n ¼ 9, 50%; Table 1; Supplementary Table 1, http://links.lww.com/PAT/A40).
Copyright © Royal College of pathologists of Australasia. Unauthorized reproduction of this article is prohibited.
*
16 (88.9) *
2 (11.1)
* *
* *
*
*
12 (66.7) 3 (16.7) 14 (77.8) 5 (27.8) 9 (50) 3 (16.7) 1 (5.6) 6 (33.3) 1 (5.6)
* *
* *
*
*
5 (27.8) 13 (72.2)
* *
0
*
1 (5.6) 0
* *
17 (94.4)
16 16 1 16 2 (11.1) 2 (11.1) 0 2 (11.1)
>4 >8 16 >16 0.5 2 >64/32 >128 >64 >32 >64 32 >16 >8 4 >8/152 19 (95) *
1 (5)
No CLSI interpretive criteria at the time of the study.
d, day; h, hour.
Ciprofloxacin Moxifloxacin Amikacin Tobramycin Clarithromycin after 72 h incubation Clarithromycin after 14 d incubation Amoxicillin-clavulanic acid (2:1 ratio) Cefoxitin Ceftriaxone Cefepime Imipenem Linezolid Doxycycline Minocycline Tigecycline Trimethoprim-sulfamethoxazole
*
* * *
* * *
14 (70) 4 (20) 18 (90) 6 (30) 8 (40) 2 (10) 0 8 (40) 0
* * *
* * *
*
2 (10)
*
18 (90)
*
*
17 (85)
*
0
*
3 (15)
0
20 (100) 19 (95) 1 (5) 6 (30) 0 1 (5) 0 14 (70) 0 0 19 (95) 0
>4 >8 16 8 1 >16 >64/32 64 >64 >32 64 32 >16 >8 4 >8/152 >4 >8 4 4 0.25 >16 >64/32 64 >64 >32 32 16 >16 >8 2 >8/152
DISCUSSION
4–>4 2–>8 4–>64 4–>16 16 0.5–>16 64/32–>64/32 32–>128 64–>64 >32 8–>64 32 2–>16 8–>8 1–>4 0.5/9.5–>8/152
MIC90 (mg/mL) MIC50 (mg/mL) MIC range (mg/mL) Drug
Clarithromycin susceptibility of M. abscessus complex isolates Similar clarithromycin susceptibility results after 72 h incubation were observed for both M. abscessus subspecies (Table 1). In contrast, after 14 days of incubation, most M. abscessus subsp. abscessus were classed as resistant (n ¼ 17, 85%), whereas most M. abscessus subsp. massiliense were susceptible (n ¼ 17, 94.4%). Specifically, there were three patterns of clarithromycin susceptibility observed (Table 2). The first group was that of clarithromycin resistance evident after 72 h incubation. There was one isolate of each M. abscessus subspecies that demonstrated this pattern. The second group comprised those isolates that were initially clarithromycin susceptible after 72 h, but following prolonged incubation, demonstrated resistance (MIC 8 mg/mL) at 14 days. All of these isolates were M. abscessus subsp. abscessus and this pattern was observed in the majority of this subspecies (n ¼ 16, 80%; Table 2). The erm(41) gene in these isolates demonstrated the T28 sequevar. The third group were isolates that remained susceptible after 14 days of incubation (Table 2). All but one of M. abscessus subsp. massiliense demonstrated this pattern. erm(41) genotyping indicated that deletions in this gene were present to account for clarithromycin susceptibility. There were also three M. abscessus subsp. abscessus isolates that demonstrated this susceptibility pattern. The C28 sequevar of the erm(41) gene was present in two of these M. abscessus subsp. abscessus isolates to account for the clarithromycin susceptibility observed. However, in one isolate, the T28 sequevar of the erm(41) gene was found. Both the phenotypic susceptibility testing and erm(41) genotyping was repeated on this isolate and the results remained unchanged; the clarithromycin MIC remained at 1 mg/mL after 14 days of incubation on repeat testing. Further analysis of the erm(41) gene demonstrated a type 1 erm sequevar, that is the sequevar present in the M. abscessus subsp. abscessus type strain, ATCC 19977.
2–>4 2–>8 4–>64 4–>16 16 16 >64/32 32–>128 64–>64 >32 4–>64 32 1–>16 8 0.5–>4 2/38–>8/152
>4 >8 8 16 0.12 0.5 >64/32 64 >64 >32 32 16 >16 8 2 >8/152
0 0 17 (94.4) 0
Intermediate n (%) Susceptible n (%) MIC90 (mg/mL) MIC50 (mg/mL) Intermediate n (%) Susceptible n (%)
Resistant n (%)
MIC range (mg/mL)
M. abscessus subsp. massiliense (n ¼ 18) M. abscessus subsp. abscessus (n ¼ 20)
Phenotypic susceptibility results for M. abscessus subsp. abscessus and M. abscessus subsp. massiliense by broth microdilution Table 1
Pathology (2015), 47(7), December
(88.9) (88.9) (5.6) (88.9)
CHUA et al.
Resistant n (%)
680
In this study, we identified that M. abscessus subsp. abscessus (n ¼ 24, 57.1%) was more common than M. abscessus subsp. massiliense (n ¼ 18, 42.9%). There were no M. abscessus subsp. bolletii isolates identified. Previous studies have demonstrated that the prevalence of different subspecies varies by geography. Mycobacterium abscessus subsp. abscessus predominates in USA, France and Japan, whereas in South Korea M. abscessus subsp. massiliense is more common.5,6,25–27 Mycobacterium abscessus subsp. bolletii is less common in these regions, except in Brazil, where an epidemic clone causing post-surgical infections has been reported.28 Recently, M. abscessus subsp. massiliense was demonstrated by whole genome sequencing to cause outbreaks of difficult-to-treat infection in patients with cystic fibrosis in the UK.2 This present study was not designed as an outbreak investigation and epidemiological information on the isolates was unavailable in most instances. However, the patient median age of 58 years was suggestive that most of these isolates were obtained from non-cystic fibrosis patients. The isolates characterised in this study can be used as a reference collection to evaluate methods described in the literature to perform routine subspeciation of M. abscessus complex isolates in our laboratory. These methods include PCR amplification of a number of different loci and MALDI-TOF.6,16,29
Copyright © Royal College of pathologists of Australasia. Unauthorized reproduction of this article is prohibited.
MYCOBACTERIUM ABSCESSUS IN AUSTRALIA
Table 2
681
Clarithromycin susceptibility results for M. abscessus subsp. abscessus and M. abscessus subsp. massiliense isolates
Group 1 2
3
Clarithromycin susceptibility phenotype Resistant after 72 h incubation* Susceptible after 72 h incubation, but resistant after 14 d incubation Susceptible after 72 h incubation, and remain susceptible after 14 d incubation
M. abscessus subsp. abscessus isolates (n ¼ 20)
erm(41) genotype
M. abscessus subsp. massiliense isolates (n ¼ 18)
erm(41) genotype Deletions
1
T28 sequevar
1
16
T28 sequevar
0
2
C28 sequevar
17
1
T28 sequevar
Deletions
d, day; h, hour. * These isolates are presumed to contain mutations in the rrl gene to account for clarithromycin resistance but experiments to demonstrate this were not performed in this study.
In this culture collection, M. abscessus subspecies demonstrated high levels of in vitro resistance to almost all antibiotics tested, with ten isolates (26.3%) being reliably susceptible to only amikacin. Isolates here also demonstrated higher rates of resistance to linezolid, cefoxitin and imipenem, in comparison with other studies.10,30,31 A broad spectrum class A betalactamase, BlaMAB, in M. abscessus has been recently characterised that allows for resistance to beta-lactams and imipenem.32 Avibactam, a novel beta-lactamase inhibitor has been shown to inhibit the BlaMAB and combination therapy with this agent may provide additional therapeutic options for managing M. abscessus infections.33 The MICs to tigecycline in this study were high with an MIC90 of 4 mg/mL. This is in contrast to reports from the USA where an MIC90 of 0.25 mg/mL (range 0.06–1 mg/mL) was reported.24 In the US setting, tigecycline has been demonstrated to be a useful agent in salvage therapy for M. abscessus infections.34 Clarithromycin susceptibility is important in determining treatment outcome with patients infected with clarithromycin-susceptible isolates having better treatment response than those harbouring clarithromycin resistant isolates.35,36 In a Korean study, in vitro clarithromycin susceptibility after prolonged incubation (14 days) was demonstrated to be associated with favourable outcomes from combination therapy of clarithromycin and amikacin, possibly combined with cefoxitin.27 Clarithromycin susceptibility patterns observed in this present study (Table 2) were as expected from the literature. The two isolates that demonstrated resistance after only 72 h incubation were presumed to contain rrl point mutations but experiments to demonstrated this were not performed in this study.13 This pattern of resistance is less common compared to the other two patterns.12,37 The isolates that were initially susceptible, but after 14 days demonstrated resistance, all contained the T28 sequevar in the erm(41) gene that allows for inducible resistance.15 There was one M. abscessus subsp. abscessus isolate that although containing the T28 sequevar, remained clarithromycin susceptible after prolonged incubation. Brown-Elliot and colleagues recently examined polymorphisms in the erm(41) gene in detail and described 10 different sequevars.23 In this study, the authors found that the correlation between erm(41) sequevars and phenotypic susceptibility to clarithromycin was not always so straightforward. There were isolates
with the T28 sequevar, including the type 1 erm sequevar contained by the isolate in our study, which demonstrated MICs 2 mg/mL (i.e., within the susceptible range) after 14 days incubation. Additionally, there were also isolates containing the C28 sequevar that initially demonstrated MICs of 4 mg/mL (i.e., intermediate susceptibility) and 8 mg/mL (i.e., resistant, by CLSI criteria).23 In our study, the two C28 sequevar containing isolates (both M. abscessus subsp. abscessus), were clarithromycin susceptible. All M. abscessus subsp. massiliense isolates in this study contained erm(41) deletions. All of these, apart from one isolate, remained clarithromycin susceptible after 14 days. This single M. abscessus subsp. massiliense isolate that displayed a different phenotype demonstrated resistance at 72 h incubation. Collectively, these results demonstrate the contribution of both phenotypic and genotypic testing for assessment of clarithromycin susceptibility. A limitation of this study was the relatively small number of isolates examined. In addition, because disease caused by nontuberculous mycobacteria is a not a public health-notifiable infection in the state of NSW, there may be some bias towards isolates causing more severe disease being referred to our centre for identification and characterisation. In conclusion, we have identified that for a large part of NSW, M. abscessus subsp. abscessus accounted for >50% of M. abscessus isolates, and that M. abscessus subsp. bolletii was rare. The prevalence of resistance to almost all antibiotics tested, apart from amikacin, was high. The majority (80%) of M. abscessus subsp. abscessus isolates in NSW demonstrated in vitro clarithromycin resistance whereas most M. abscessus subsp. massiliense (94.4%) remained susceptible to macrolides after prolonged incubation with a good correlation between the erm(41) genotype and clarithromycin susceptibility results for most isolates (Table 2). Similar future studies will allow for comparison of prevalence trends and evolution of antibiotic resistance patterns. Studies correlating in vitro susceptibility profiles with clinical outcomes of infections treated with multi-drug combination therapies caused by this emerging mycobacterium are warranted.
Acknowledgements: We would like to thank Qinning Wang from CIDMLS for technical advice.
Copyright © Royal College of pathologists of Australasia. Unauthorized reproduction of this article is prohibited.
682
CHUA et al.
Conflicts of interest and sources of funding: The authors state that there are no conflicts of interest to disclose. Address for correspondence: Dr Kyra Y. L. Chua, Department of Microbiology and Immunology, The University of Melbourne, Parkville, Vic 3010, Australia. E-mail: [email protected]
References 1. Howard ST. Recent progress towards understanding genetic variation in the Mycobacterium abscessus complex. Tuberculosis (Edinb) 2013; 93 (Suppl): S15–20. 2. Bryant JM, Grogono DM, Greaves D, et al. Whole-genome sequencing to identify transmission of Mycobacterium abscessus between patients with cystic fibrosis: a retrospective cohort study. Lancet 2013; 381: 1551–60. 3. Sassi M, Drancourt M. Genome analysis reveals three genomospecies in Mycobacterium abscessus. BMC Genomics 2014; 15: 359. 4. Macheras E, Roux AL, Ripoll F, et al. Inaccuracy of single-target sequencing for discriminating species of the Mycobacterium abscessus group. J Clin Microbiol 2009; 47: 2596–600. 5. Zelazny AM, Root JM, Shea YR, et al. Cohort study of molecular identification and typing of Mycobacterium abscessus, Mycobacterium massiliense, and Mycobacterium bolletii. J Clin Microbiol 2009; 47: 1985–95. 6. Nakanaga K, Sekizuka T, Fukano H, et al. Discrimination of Mycobacterium abscessus subsp. massiliense from Mycobacterium abscessus subsp. abscessus in clinical isolates by multiplex PCR. J Clin Microbiol 2014; 52: 251–9. 7. Macheras E, Roux AL, Bastian S, et al. Multilocus sequence analysis and rpoB sequencing of Mycobacterium abscessus (sensu lato) strains. J Clin Microbiol 2011; 49: 491–9. 8. Thomson RM. Changing epidemiology of pulmonary nontuberculous mycobacteria infections. Emerg Infect Dis 2010; 16: 1576–83. 9. Griffith DE, Aksamit T, Brown-Elliott BA, et al. An official ATS/IDSA statement: diagnosis, treatment, and prevention of nontuberculous mycobacterial diseases. Am J Respir Crit Care Med 2007; 175: 367–416. 10. Nessar R, Cambau E, Reyrat JM, Murray A, Gicquel B. Mycobacterium abscessus: a new antibiotic nightmare. J Antimicrob Chemother 2012; 67: 810–8. 11. Jarand J, Levin A, Zhang L, Huitt G, Mitchell JD, Daley CL. Clinical and microbiologic outcomes in patients receiving treatment for Mycobacterium abscessus pulmonary disease. Clin Infect Dis 2011; 52: 565–71. 12. Hanson KE, Slechta ES, Muir H, Barker AP. Rapid molecular detection of inducible macrolide resistance in Mycobacterium chelonae and M. abscessus strains: a replacement for 14-day susceptibility testing? J Clin Microbiol 2014; 52: 1705–7. 13. Wallace RJ Jr, Meier A, Brown BA, et al. Genetic basis for clarithromycin resistance among isolates of Mycobacterium chelonae and Mycobacterium abscessus. Antimicrob Agents Chemother 1996; 40: 1676–81. 14. Clinical and Laboratory Standards Institute. Susceptibility testing of Mycobacteria, Nocardiae, and other Aerobic Actinomycetes; Approved Standard - Second Edition. CLSI document M24-A2. Wayne, PA: CLSI, 2011. 15. Nash KA, Brown-Elliott BA, Wallace RJ Jr. A novel gene, erm(41), confers inducible macrolide resistance to clinical isolates of Mycobacterium abscessus but is absent from Mycobacterium chelonae. Antimicrob Agents Chemother 2009; 53: 1367–76. 16. Shallom SJ, Gardina PJ, Myers TG, et al. New rapid scheme for distinguishing the subspecies of the Mycobacterium abscessus group and identifying Mycobacterium massiliense isolates with inducible clarithromycin resistance. J Clin Microbiol 2013; 51: 2943–9. 17. Butler WR, Guthertz LS. Mycolic acid analysis by high-performance liquid chromatography for identification of Mycobacterium species. Clin Microbiol Rev 2001; 14: 704–26. 18. Xiong L, Kong F, Yang Y, Cheng J, Gilbert GL. Use of PCR and reverse line blot hybridization macroarray based on 16S-23S rRNA gene internal transcribed spacer sequences for rapid identification of 34 Mycobacterium species. J Clin Microbiol 2006; 44: 3544–50.
Pathology (2015), 47(7), December
19. Nakanaga K, Hoshino Y, Era Y, et al. Multiple cases of cutaneous Mycobacterium massiliense infection in a ‘‘hot spa’’ in Japan. J Clin Microbiol 2011; 49: 613–7. 20. Roth A, Fischer M, Hamid ME, Michalke S, Ludwig W, Mauch H. Differentiation of phylogenetically related slowly growing mycobacteria based on 16S-23S rRNA gene internal transcribed spacer sequences. J Clin Microbiol 1998; 36: 139–47. 21. Telenti A, Marchesi F, Balz M, Bally F, Bottger EC, Bodmer T. Rapid identification of mycobacteria to the species level by polymerase chain reaction and restriction enzyme analysis. J Clin Microbiol 1993; 31: 175–8. 22. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol 1990; 215: 403–10. 23. Brown-Elliott BA, Vasireddy S, Vasireddy R, et al. Utility of sequencing the erm(41) gene in isolates of Mycobacterium abscessus subsp. abscessus with low and intermediate clarithromycin MICs. J Clin Microbiol 2015; 53: 1211–5. 24. Wallace RJ Jr, Brown-Elliott BA, Crist CJ, Mann L, Wilson RW. Comparison of the in vitro activity of the glycylcycline tigecycline (formerly GAR936) with those of tetracycline, minocycline, and doxycycline against isolates of nontuberculous mycobacteria. Antimicrob Agents Chemother 2002; 46: 3164–7. 25. Roux AL, Catherinot E, Ripoll F, et al. Multicenter study of prevalence of nontuberculous mycobacteria in patients with cystic fibrosis in France. J Clin Microbiol 2009; 47: 4124–8. 26. Harada T, Akiyama Y, Kurashima A, et al. Clinical and microbiological differences between Mycobacterium abscessus and Mycobacterium massiliense lung diseases. J Clin Microbiol 2012; 50: 3556–61. 27. Koh WJ, Jeon K, Lee NY, et al. Clinical significance of differentiation of Mycobacterium massiliense from Mycobacterium abscessus. Am J Respir Crit Care Med 2011; 183: 405–10. 28. NunesLde S, Baethgen LF, Ribeiro MO, et al. Outbreaks due to Mycobacterium abscessus subsp. bolletii in southern Brazil: persistence of a single clone from 2007 to 2011. J Med Microbiol 2014; 63: 1288 – 93. 29. Teng SH, Chen CM, Lee MR, et al. Matrix-assisted laser desorption ionization-time of flight mass spectrometry can accurately differentiate between Mycobacterium masilliense (M. abscessus subspecies bolletti) and M. abscessus (sensu stricto). J Clin Microbiol 2013; 51: 3113 – 6. 30. Broda A, Jebbari H, Beaton K, Mitchell S, Drobniewski F. Comparative drug resistance of Mycobacterium abscessus and M. chelonae isolates from patients with and without cystic fibrosis in the United Kingdom. J Clin Microbiol 2013; 51: 217–23. 31. Yoshida S, Tsuyuguchi K, Suzuki K, et al. Further isolation of Mycobacterium abscessus subsp. abscessus and subsp. bolletii in different regions of Japan and susceptibility of these isolates to antimicrobial agents. Int J Antimicrob Agents 2013; 42: 226–31. 32. Soroka D, Dubee V, Soulier-Escrihuela O, et al. Characterization of broadspectrum Mycobacterium abscessus class A beta-lactamase. J Antimicrob Chemother 2014; 69: 691–6. 33. Dubee V, Bernut A, Cortes M, et al. Beta-Lactamase inhibition by avibactam in Mycobacterium abscessus. J Antimicrob Chemother 2015; 70: 1051–8. 34. Wallace RJ Jr, Dukart G, Brown-Elliott BA, Griffith DE, Scerpella EG, Marshall B. Clinical experience in 52 patients with tigecycline-containing regimens for salvage treatment of Mycobacterium abscessus and Mycobacterium chelonae infections. J Antimicrob Chemother 2014; 69: 1945– 53. 35. Jeon K, Kwon OJ, Lee NY, et al. Antibiotic treatment of Mycobacterium abscessus lung disease: a retrospective analysis of 65 patients. Am J Respir Crit Care Med 2009; 180: 896–902. 36. Roux AL, Catherinot E, Soismier N, et al. Comparing Mycobacterium massiliense and Mycobacterium abscessus lung infections in cystic fibrosis patients. J Cyst Fibros 2015; 14: 63–9. 37. Bastian S, Veziris N, Roux AL, et al. Assessment of clarithromycin susceptibility in strains belonging to the Mycobacterium abscessus group by erm(41) and rrl sequencing. Antimicrob Agents Chemother 2011; 55: 775–81.
Copyright © Royal College of pathologists of Australasia. Unauthorized reproduction of this article is prohibited.
