JOURNAL OF VIROLOGY, Aug. 1991, p. 4198-4203

Vol. 65, No. 8

0022-538X/91/084198-06$02.00/0 Copyright © 1991, American Society for Microbiology

Antigenicity of Rabies Virus Glycoprotein A. BENMANSOUR, H. LEBLOIS, P. COULON, C. TUFFEREAU, Y. GAUDIN, A. FLAMAND, AND F. LAFAY* Laboratoire de Genetique des Virus, Centre National de la Recherche Scientifique, 91198 Gif-sur- Yvette Cedex, France Received 25 March 1991/Accepted 30 April 1991

Although the number of antigenic sites on the rabies virus glycoprotein that have been described regularly increases with time, no attempt has been made to carefully evaluate the relative importance of each of these sites. Here we provide a more precise description of the antigenicity of the protein in mice of the H-2d haplotype; we developed this description by using 264 newly isolated monoclonal antibodies (MAbs) and a collection of neutralization-resistant (MAR) mutants. Most of the MAbs (97%) recognized antigenic sites previously described as II and III. One minor antigenic site separated from site III by three amino acids, including a proline, was identified (minor site a). Despite their proximity, there is no overlap between site III and minor site a; i.e., site III-specific MAR mutants were neutralized by the six MAbs defining minor site a, and vice versa. One of our MAbs, lDl, reacted with sodium dodecyl sulfate-treated glycoprotein in Western blots (immunoblots) under reducing conditions and was therefore probably directed against a linear epitope. A MAR mutant selected with this MAb was still neutralized by MAbs of other specificities. This linear epitope was called Gl (G, Gif). As a general rule, we propose to reserve the term "antigenic site" (either major or minor) for regions of the protein which are defined by several MAbs originating from different fusions and to describe regions of the protein which are defined by a single MAb as epitopes. It would be interesting to test whether the same regions of the rabies virus glycoprotein are antigenic in mice of different haplotypes or in other species. The glycoprotein of rabies virus is believed to form polymeric structures that project from the surface of the virus particle. These surface spikes are responsible for induction and binding of virus-neutralizing antibodies (7, 23), determination of virulence (5, 6, 8), and stimulation of lymphocytes (3, 4). Neutralizing monoclonal antibodies (MAbs) raised in BALB/c mice immunized with rabies virus were shown to delineate numerous epitopes on the viral glycoprotein (11, 24). Their pattern of cross-reactivity with MAb-resistant (MAR) mutants selected with some of these MAbs was used to define three groups of epitopes on the challenge virus standard (CVS) glycoprotein and five on the ERA glycoprotein (14, 15). Some groups contained a single epitope recognized by a unique MAb, while others contained many epitopes defined by a collection of MAbs isolated from several laboratories. Several overlapping epitopes certainly define an antigenic site. This is the case for antigenic sites II and III of the rabies virus glycoprotein. Antigenic mutants selected for resistance to MAbs delineating site II were found to have one amino acid substitution located between positions 34 and 42 or 198 and 200 of the glycoprotein, with the exception of two mutants which each had a mutation in an intermediate position (19). If most of those mutations are within the region where MAbs bind to the protein, as postulated for the majority of MAR mutants, then site II is a discontinuous, conformational antigenic site. In contrast, mutants resistant to MAbs delineating site III were found to have amino acid substitutions that were clustered in a short linear stretch between positions 330 and 338, except for one mutant with an amino acid substitution in position 357 (22, 26). Several isolated epitopes were also identified on the rabies virus *

Corresponding author. 4198

glycoprotein. For instance, sites I and IV have up to now been defined by a single MAb. More recently, a new epitope has been described for ERA and CVS strains. This epitope has been considered unique in that it was defined by a neutralizing MAb binding to the denatured glycoprotein (1). An escape mutant to this MAb was shown to have an amino acid substitution at position 264 of the glycoprotein (10). Two neutralizing MAbs of human origin have also recently been isolated (9, 16). Both failed to neutralize the same escape mutant (RV 2-22C5) selected with the murine MAb 2.22C5. One bound to the denatured glycoprotein, while the other did not. Whether the two human MAbs would recognize the same region of the glycoprotein as did MAb 2-22C5 was not investigated. Regions of the glycoprotein which are recognized by MAbs of new specificity have often been termed antigenic sites. As a result, as many as six or seven antigenic sites on the rabies virus glycoprotein have been described, which does not reflect the actual antigenic properties of the protein. Using 266 neutralizing MAbs derived from the fusion of spleen cells from BALB/c mice immunized with beta propiolactone-inactivated CVS virus and our collection of MAR mutants, we have made a more accurate evaluation of the relative importance of the different regions of the rabies virus glycoprotein in the stimulation of the B-cell response. In addition, this large number of neutralizing MAbs allowed us to delineate and map new regions of the glycoprotein which could also be antigenic. MATERIALS AND METHODS Cells and viruses. CER and BSR clones of BHK21 cells were grown in Eagle minimal essential medium supplemented with 8% calf serum. The myeloma cell line Sp2/0 was grown in Dulbecco modified minimal essential medium supplemented with 15% foal serum, 2 mM L-glutamine, and 10

VOL. 65, 1991

mM sodium pyruvate. Hybridomas were grown in the same medium with 0.1 mM hypoxanthine, 0.4 M aminopterin, and 16 mM thymidine. The CVS strain of rabies virus and its antigenic mutants were grown and purified by previously described procedures (19). MAb production and characterization. BALB/c mice (purchased from IFFA-Mdrieux) were immunized at a 6-week interval with two intraperitoneal injections of 100 ,g of purified, beta propiolactone-inactivated CVS. An intravenous booster injection was given 4 days before fusion. Spleen cells from immunized mice were fused with Sp2/0 myeloma cells, according to standard procedures (12). Hybridomas secreting anti-rabies virus antibodies were first characterized by an enzyme-linked immunosorbent assay (ELISA) against the whole virus (20) and then against 1% sodium dodecyl sulfate (SDS)-treated virus. Hybridomas secreting antiglycoprotein antibodies were detected with a membrane fluorescence assay performed against nonpermeabilized CVS-infected cells by using fluorescein-conjugated anti-mouse immunoglobulin (Silenus). Neutralizing MAbs were identified and characterized in a plaque neutralization test (2) performed first with CVS and then with a collection of representative mutants (19, 22). The following mutants were used for the characterization: J17, J12, J21, K2, K5, K3, K14, K18, A17, P3, and J26 (mutated in site II); AvOl, F67, and B1506 (mutated in site III); and D65 (mutated in site I). Any MAb which failed to neutralize at least one of the mutants listed above was considered specific for the corresponding site. When ascitic fluid was needed, the hybridomas were cloned once more by limiting dilution and then injected into the peritoneal cavity of pristane-treated BALB/c mice. SDS-polyacrylamide gel electrophoresis (PAGE) and immunoblot analysis. Purified rabies virus was boiled for 3 min in 2x Laemmli buffer with or without 2-,B-mercaptoethanol. Electrophoresis was carried out in a discontinuous SDSpolyacrylamide gel (13). Proteins were either stained with Coomassie blue or electrotransferred to nitrocellulose membranes. Membranes were prepared for immunostaining by blocking nonspecific sites with 5% defatted milk in Trisbuffered saline (TBS)-Tween (0.05 M Tris-HCI, pH 8-0.15 M NaCI-0.05% Tween 80). Blocked membranes were incubated overnight with appropriate dilutions of ascitic fluids. Membranes were washed twice in TBS-Tween, incubated for 1 h with alkaline phosphatase-conjugated anti-mouse immunoglobulin (Silenus), washed twice in TBS-Tween, washed twice in TBS, and stained with alkaline phosphatase substrate solution (1.2 mM fast blue BB salt [Sigma]-1.8 mM ,-naphthyl phosphate in borate buffer). Selection of antigenic mutants. Selection of new antigenic mutants was performed as previously described (22). Briefly, dilutions of either a 5-fluorouracil mutagenized stock or cloned stocks of CVS were incubated 1 h at room temperature with diluted ascitic fluid and then plated onto monolayers of CER cells. Well-separated plaques were picked, and small stocks of each putative mutant were prepared on BSR cells. Only stocks showing 90% resistance to the selecting MAbs were used in the present study. Direct RNA sequencing. Direct sequencing by the chain termination procedure of Sanger was performed as previously described (19). Reverse transcription was performed directly on the purified genomic RNA by using synthetic oligonucleotides to prime the reaction. Five primers spanning the extracellular domain of the glycoprotein gene were used: (i) AAAAGACTCAAGGAAAGATG, (ii) AGAGGC

ANTIGENICITY OF RABIES VIRUS GLYCOPROTEIN

4199

AGAGACCTA, (iii) GATTACACCATTTGGAT, (iv) AC CAAATGGTGCTCTCC, and (v) GTCCCAGGGTTTGGA AA. They were purchased from Appligene, except primer 5, which was kindly donated by D. H. L. Bishop. Reverse transcription, amplification, and sequencing. RNA extracted from purified viral particles was engaged in firststrand cDNA synthesis by the general method described by Sambrook et al. (21). Briefly, RNA in Tris-HCl, pH 8.3-50 mM KCl-5 mM MgCl2-1 mM each deoxynucleotide triphosphate (dNTP)-25 U of RNAsine (Promega)-7.5 U of avian myeloblastosis virus reverse transcriptase (Amersham)-50 pmol of messenger sense primer (primer 1), in 20 ,ul (final volume), was incubated for 45 min at 37°C. First-strand cDNA-RNA heteroduplexes were denatured for 5 min at 95°C, and polymerase chain reaction (PCR) was performed with 5 ,ul of the cDNA synthesis mixture in 100 ,ul (final volume) of 10 mM Tris-HCI, pH 8.3-50 mM KCl-2.5 mM MgCl2-200 ,uM each dNTP-0.1% gelatin-100 pmol of each primer-2.5 U of Taq DNA polymerase (Cetus PerkinElmer or Promega). Amplification was conducted for 30 cycles on a Hybaid thermocycler programmed to provide 15 s at 94°C, 45 s at 55°C, and 1.30 min at 74°C for each cycle. Two pairs of primers were used to amplify the glycoprotein gene in two overlapping fragments: A1-AAAAGACTCAA GGAAAGATG, B1-AGAACTCCACATAACTTGAG; and A2-GATTACACCATCTGGATGCC, B2-CTTGGATCGTT GAAAGGA. PCR products were subjected to electrophoresis on 2% Nusieve GTG agarose (FMC Corp.). A band of the expected size of double-stranded DNA was excised from the gel, melted for 15 min at 65°C, and diluted with 5 volumes of sterile H20. Five ,u1 of the melted agarose was subjected to PCR amplification as described above, except that the concentration of one primer was reduced to 1 pmol and PCR was conducted for 50 cycles. The product of single-strand amplification was extracted with chloroform and dialyzed four times on a Centricon 30 microconcentrator (Amicon). The final product (1 pmol) was sequenced with Sequenase V.2 (USB) according to the manufacturer's directions. The PCR oligonucleotides were used as sequencing primers. RESULTS Characterization of neutralizing MAbs. From one fusion, several hundred hybridomas secreting MAbs against rabies virus were established. Of these, 262 were characterized as neutralizing by a plaque neutralization test (data not shown). They also bound to the membrane of nonpermeabilized infected cells. The ability of the 262 MAbs to neutralize a panel of 11 antigenic mutants affected in site II and 3 mutants affected in site III of the glycoprotein was determined according to the method of Seif et al. (22). A total of 254 MAbs failed to neutralize at least one mutant affected in site II or in site III. We did not find any MAb which failed to neutralize mutants of site II and of site III, an observation which confirms the independence of the two sites. In view of these results, 190 MAbs were assigned to site II and 64 MAbs were assigned to site III. One mutant (D65), isolated in this laboratory with MAb 509.6 (from the Wistar collection), which defines the so-called antigenic site I, was also used in this study. Not one MAb failed to neutralize this mutant. Eight MAbs (40E1, 48C5, 40A1, 49C3, 52C4, 46D2, 49C2, and 52A4) neutralized all the mutants. These MAbs, as well as four unclassified MAbs (1D1, 7D2, 11C6, and 20A2) from previous fusions, were thus considered possibly directed

Neutralization with MAbs

Mutant

Cl.

12 12

7 2

1

3

1

4

1

5

5

6

1

Site II

Unclassified

Nb.

14 in X 510~ u 0 o OD

en C)) at

N 0 o

IV

IV

Nq

o lev

1

J. VIROL.

BENMANSOUR ET AL.

4200

-W U .~0 0 n C4 ..a 14

s

0 a i r1 UZ

2D 5 %O

N4

0

vW

atN

-w

91

1

n

In

50C. u

r-

C4 N

IV

Site III

r-

%0

0 Un

4

a

0 o CN In

a m

000 00000 000 000 0 0 00000 0 000 00 o ( 00 00 00 00 0 * 0 C0 0 0 00 0 0 0 0 0 0 0 0 0 0 0 0 0 0 00 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 00 00 0 0 0 0 0 0 0 0 0 0 0 O O0 O @ 0 * 00 0 0 0 0 0 0 000 0 0 C) O * *0 00 0 0 0 0 0 00 0 0 0 0 @ 0 0 0 0

0

FIG. 1. Pattern of neutralization of mutants isolated with unclassified MAbs. Data show resistance to neutralization by the selecting MAb (0) and by other MAbs (0) and neutralization (0). Abbreviations: Cl, class; Nb, number of mutants per class.

towards new epitopes and were retained for further investigation. Nine of them were used to select antigenic mutants as described in Material and Methods. We were able to select 40 antigenic mutants with seven of the MAbs. We selected 12 with 40E1, 12 with 48C5, 7 with 40A1, 1 with 11C6, 1 with lDl, 1 with 46D2, and 6 with 52A4. In spite of several attempts, we were not able to isolate any mutant with 52C4 or 7D2. Characterization of new antigenic regions of the glycoprotein. Newly selected mutants were cross-reacted with all the unclassified MAbs as well as with selected MAbs specific for sites II and III. They were divided into six classes, according to their pattern of neutralization by the MAbs (Fig. 1). The first class contains 31 mutants which were resistant to neutralization by 40E1, 48C5, 40A1, 49C3, 20A2, and 11C6. This result indicates that these six MAbs belong to the same specificity group. They cannot derive from the same clone of B cells since (i) two of them (11C6 and 20A2) were isolated in a separate fusion and (ii) 48C5 and 40A1, which still neutralized the mutant selected with 11C6, certainly differ from the other four. This group of six MAbs thus clearly delineates an antigenic region, referred to as minor site a,

a

that is nonoverlapping with those already described for the CVS strain. The mutant selected with lDl was neutralized by all of the MAbs tested so far except the selecting MAb, suggesting that this MAb is directed toward a new epitope, referred to as epitope Gl (G, Gif). Mutants selected with 46D2 or 52A4 (class 4, 5, or 6 in Fig. 1) were also resistant to MAbs specific to site II, indicating that these mutants were affected within antigenic site II. MAbs 46D2 and 52A4 should thus be considered site II specific. The mutant selected with 46D2 also failed to be neutralized by 49C2. This indicates that 49C2 is also directed against site II. The 40 mutants were neutralized by 52C4 and 7D2. The specificities of the two MAbs which neutralized all categories of MAR mutants remain to be determined. MAb reactivity with SDS-treated glycoprotein. The reactivity of the 262 MAbs was studied in an ELISA with intact or 1% SDS-treated virus as antigen. All the MAbs recognized the intact virus, but only lDl was positive when the plates were coated with SDS-treated virus, indicating that this MAb is probably directed toward a continuous epitope. We also studied the binding of 39 representative MAbs in Western blots (immunoblots) after separation of the proteins of purified virus in SDS-PAGE with and without 2-1-mercaptoethanol (Fig. 2). Only lDl bound to the denatured glycoprotein under reducing conditions. However, when the reducing agent was omitted, all the MAbs specific to minor site a and to epitope Gl, as well as the two unclassified MAbs, bound to the denatured protein. Under the same conditions, 5 of the 11 site 1I-specific MAbs recognized the glycoprotein, while only 1 of 19 site III-specific MAbs did so. Mapping of mutations in antigenic mutants. To map the mutations of our antigenic mutants, we partially sequenced two class 1 mutants, one class 2 mutant, one class 3 mutant, and one class 4 mutant (Table 1). Results supported the prediction that mutants of classes 1 and 2 are closely related and are affected at sites different from those already described. We found the same substitution at position 343 for two class 1 mutants (Gly to Glu) and a substitution at position 342 for the class 2 mutant (Lys to Thr). It should be noted that although the two class 1 mutants came from a mutagenized stock of CVS, they could still derive from a subclone of mutants which existed in the viral stock prior to the mutagenesis. Alteration at position 343 confers resis-

Number of neutralizing MAbs reacting to PAGE-separated glycopr*ntei n

Treatment with SDS

Treatment with SDS + 2BME

Site II

5/11

0/11

MAb

specifity

Site III

1/19

0/19

Minor Site a

6/6

0/6

Epitope Gl

1/1

1/1

Undetermined

2/2

0/2

b C

B

A 1

2

1

2

1

2

C2

FIG. 2. Binding of 39 representative neutralizing MAbs to the viral glycoprotein in Western blots. (a) Summary table; (b) representative immunoblots showing binding in the presence (lanes 1) or absence (lanes 2) of 2-p-mercaptoethanol: binding in both condtions (A), binding only in the absence of the reducing agent (B), or no binding (C). The positions of the five viral proteins were identified by staining the blot with Ponceau red. The dye was washed out before treatment with antibodies.

ANTIGENICITY OF RABIES VIRUS GLYCOPROTEIN

VOL. 65, 1991

4201

TABLE 1. Mapping of mutations in new antigenic mutants Mutation in:

MAb used in selection

Name of

Sequenced

mutant

region

Codon

Amino acid

1

40E1 48C5

1-8 AJ4

320-360 320-360

GGG to GAG GGG to GAG

Gly-343 to Glu Gly-343 to Glu

2

11C6

Ti

180-266 320-370

AAA to ACA

Lys-342 to Thr

3

lDl

Xi

258-380

Not found

Not found

4

46D2

AD8

15-80 185-268 314-392 423-495

AAC to GAC

Asn-37 to Asp

Class of mutant

tance to all six MAbs, while alteration at position 342 confers resistance to 11C6, 20A2, 49C3, and 40E1 but not to 48C5 and 40A1. Although these mutations were in close proximity to those delineating site III (330 to 338), we could not find any overlap between the two sites: the six MAbs defining minor site a neutralized selected site 111-specific mutants, and the two mutants affected in positions 342 and 343 were neutralized by eight site 111-specific MAbs. As the mutant selected with MAb lDl grew poorly in cell culture, direct RNA sequencing could not be performed. PCR was used to amplify the glycoprotein gene in two overlapping segments of 766 and 1,023 bp, respectively (Fig. 3). Direct sequencing of the amplified products revealed no amino acid changes between positions 258 and 380. The epitope defined by lDl is then probably different from the epitope described around position 264 by Dietzschold et al. (10). Sequencing of mutant AD8, a representative of class 4 mutants, revealed an amino acid change at position 37 of the glycoprotein (Asn to Asp). This finding supported the prediction made from the cross-reactivity pattern that the alteration in this class of mutants ought to be within antigenic site II (34 to 42 and 198 to 200). This mutation destroyed a potential glycosylation site present in the glycoproteins of all strains of rabies virus sequenced so far. The electrophoretic mobilities of the two forms (G1 and G2) of the glycoprotein were identical in the CVS strain and in the mutant, indiKating that glycosylation of site 37 does not take

A

1023

B

C

bp-

place in the parent strain (Fig. 4). A similar conclusion was reached by Wunner et al. (27) by using chemical analysis of tryptic glycoprotein fragments. As we did not find any MAbs in 266 that failed to neutralize our site I mutant, the so-called antigenic site I remains defined by only one MAb, 509.6, from the Wistar collection. Direct RNA sequencing of the glycoprotein gene of this mutant revealed a single nucleotide change, resulting in an amino acid substitution at position 231 of the glycoprotein (Leu to Pro). The same substitution has been reported for another escape mutant selected with this MAb (25). DISCUSSION

Although it is generally considered that the rabies virus glycoprotein has six or seven antigenic sites, it is clear from this study of 266 neutralizing MAbs that the vast majority of these MAbs (97%) belong to sites II and III as initially defined by Lafon et al. (14) (Fig. 5). Clearly some regions of the glycoprotein are far more antigenic than others. A special effort was made to characterize the eight remaining MAbs plus four unclassified MAbs isolated in our laboratory from previous fusions. Six of those MAbs were directed toward a new region of the protein, probably covering amino acids 342 and 343. One MAb, lDl, defined a new epitope, which we called Gi. Given these results, which agree with those found on a smaller scale in other laboratories, we propose to reserve the term "antigenic site'" for sites II and III. Other groups of overlapping epitopes which can be A

B

w

_

"

766 bp.-

GM 2 FIG. 3. PCR amplification of two segments of the glycoprotein and B, amplification products; lane C, markers.

gene. Lanes A

FIG. 4. Electrophoretic mobilities of the proteins of CVS (B) and mutant AD8 (A). The destruction of the first putative glycosylation site by the substitution of an asparagine in position 37 does not change the electrophoretic mobility of the glycoprotein (Gl, G2).

4202

Other

J. VIROL.

BENMANSOUR ET AL.

Specificities Minor Site

(3) a

-0

(6)

FIG. 5. Relative importance of the antigenic sites of the rabies virus glycoprotein. The respective number of MAbs isolated in this laboratory delineating each antigenic site is indicated in parentheses.

recognized by several MAbs isolated in separate fusions or in different laboratories should be called minor antigenic sites. Our group of six MAbs therefore defines minor anti-

genic site a. Other regions of the protein are identified by a single MAb: this is the case for what were previously called antigenic sites I, IV, V, and VI. They should be called epitopes unless an exchange of MAbs and escape mutants between laboratories demonstrates that two or more of the

epitopes overlap. If so, they will constitute a new minor antigenic site. The relative importance of each of the antigenic sites does not seem to depend on the strain of virus or on the particular animal examined. For instance, the predominance of sites II and III has been observed in several fusions made with various strains of rabies virus at the Wistar Institute, at the Pasteur Institute and in our laboratory. It would be interesting to see whether the situation is different in mice of other haplotypes or in other species. It is quite possible that MAbs defining minor sites and rare epitopes are in fact raised against degraded forms of the glycoprotein. This assumption is supported by our finding that most of them bind to the glycoprotein in Western blots, provided that 2-3-mercaptoethanol is omitted (if not, only lDl binds to the protein). This property is shared by only a few MAbs specific for sites II or III, since six of them (of 30 tested) recognized the protein in immunoblots in the absence of reducing agent. Surprisingly, these MAbs did not react with SDS-treated but nonreduced protein in an ELISA. This discrepancy is probably due to partial renaturation of the

glycoprotein during electrotransfer, which is facilitated by the preservation of disulfide bridges. Alternatively, this lack of recognition may be explained by an added structural distortion to antigen coated on plastic wells. It is well known that antibodies directed against native proteins and therefore against structures with biological significance generally bind to complex conformational epitopes (for a review see reference 17). Our finding that only one neutralizing MAb among 266 binds to the completely unfolded form of the glycoprotein agrees with this. Although antigenic site III appears to be continuous regarding the short linear stretch of amino acids that are affected in antigenic mutants selected with site III-specific MAbs, not one MAb among the 64 that delineate it was able to bind to the unfolded protein. This could indicate that

those amino acids are part of a loop at the surface of the protein. In this case, the critical role of arginine 333 for neurovirulence is a strong indication that this loop could be directly implicated in the recognition of neuronal receptors. Alternatively, site III-specific MAbs could bind to another region of the protein, which would be dramatically modified by mutations occurring between amino acids 330 and 338. A possible mechanism for selection of this type of remote antigenic variation was recently described for foot-andmouth disease virus (18). Six MAbs were found to delineate a new antigenic site (minor site a), possibly located around positions 342 and 343 of the glycoprotein. If this location is relevant, then the fact that site III-specific mutants were all neutralized by MAbs specific for minor site a, and vice versa, despite the proximity of the mutations selected with both groups of MAbs, may be a consequence of the presence of a proline residue at position 340. The presence of this amino acid is often associated with a bending of the polypeptide chains. It would be interesting to see whether the mutant which has a substitution at amino acid 357 and was initially classified as site III specific (26) is neutralized by these MAbs. Failure to select antigenic mutants with MAbs 52C4 or 7D2 may indicate an incomplete cloning of the hybridomas, leading to mixed populations of neutralizing antibodies. Alternatively, it is possible that escape mutants are lethal. Thus, the possibility that these MAbs are directed toward critical regions of the protein cannot be excluded. Identification of such regions will require the development of new techniques. ACKNOWLEDGMENTS

The excellent technical assistance of J. Bdn6jean is gratefully acknowledged. This work was supported by the Centre National de la Recherche Scientifique (UPR A.2431). REFERENCES 1. Bunschoten, H., M. Gore, I. J. T. M. Claassen, F. G. C. M. Uytdehaag, B. Dietzschold, W. H. Wunner, and A. D. M. E. Osterhaus. 1989. Characterization of a new virus-neutralizing epitope that denotes a sequential determinant on the rabies virus glycoprotein. J. Gen. Virol. 70:291-298. 2. Bussereau, F., A. Flamand, and D. Pese-Part. 1982. Reproducible plaquing system for rabies virus in CER cells. J. Virol. Methods 4:277-282. 3. Celis, E., R. W. Miller, T. J. Wiktor, B. Dietzschold, and H. Koprowski. 1986. Isolation and characterization of human T cell lines and clones reactive to rabies virus: antigen specificity and production of interferon-y. J. Immunol. 136:692-697. 4. Celis, E., D. Ou, B. Dietzschold, and H. Koprowski. 1988. Recognition of rabies and rabies-related viruses by T cells derived from human vaccine recipients. J. Virol. 62:3128-3134. 5. Coulon, P., P. Rollin, M. Aubert, and A. Flamand. 1982. Molecular basis of rabies virus virulence. I. Selection of avirulent mutants of the CVS strain with anti-G monoclonal antibodies. J. Gen. Virol. 61:97-100. 6. Coulon, P., P. E. Rollin, and A. Flamand. 1983. Molecular basis of rabies virus virulence. II. Identification of a site on the CVS glycoprotein associated with virulence. J. Gen. Virol. 64:693696. 7. Cox, J. H., B. Dietzschold, and L. G. Schneider. 1977. Rabies virus glycoprotein. II. Biological and serological characterization. Infect. Immun. 16:754-759. 8. Dietzschold, B., M. Gore, P. Casali, Y. Ueki, C. E. Rupprecht, A. L. Notkins, and H. Koprowski. 1990. Biological characterization of human monoclonal antibodies to rabies virus. J. Virol. 64:3087-3090. 9. Dietzschold, B., M. Gore, D. Marchadier, H.-S. Niu, H. M.

VOL. 65, 1991

10.

11.

12. 13. 14.

15.

16. 17.

18.

Bunschoten, L. Otvos, Jr., W. H. Wunner, H. C. J. Ertl, A. D. M. E. Osterhaus, and H. Koprowski. 1990. Structural and immunological characterization of a linear virus-neutralizing epitope of the rabies virus glycoprotein and its possible use in a synthetic vaccine. J. Virol. 64:3804-3809. Dietzschold, B., W. H. Wunner, T. J. Wiktor, A. D. Lopes, M. Lafon, C. L. Smith, and H. Koprowski. 1983. Characterization of an antigenic determinant of the glycoprotein that correlates with pathogenicity of rabies virus. Proc. Natl. Acad. Sci. USA 80:70-74. Flamand, A., T. J. Wiktor, and H. Koprowski. 1980. Use of hybridoma monoclonal antibodies in the detection of antigenic differences between rabies and rabies-related virus proteins. II. The glycoprotein. J. Gen. Virol. 48:105-109. Kohler, G., and C. Milstein. 1975. Continuous cultures of fused cells secreting antibody of predefined specificity. Nature (London) 256:495-497. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227:680-685. Lafon, M., L. Edelman, J. P. Bouvet, M. Lafage, and E. Monchatre. 1990. Human monoclonal antibodies specific for the rabies virus glycoprotein and N protein. J. Gen. Virol. 71:16891696. Lafon, M., J. Ideler, and W. H. Wunner. 1991. Investigation of the antigenic structure of rabies virus glycoprotein by monoclonal antibodies. Dev. Biol. Stand. 57:219-225. Lafon, M., T. J. Wiktor, and R. I. Macfarian. 1983. Antigenic sites on the CVS rabies virus glycoprotein: analysis with monoclonal antibodies. J. Gen. Virol. 64:843-851. Laver, W. G., G. M. Air, R. G. Webster, and S. J. Smith-Gill. 1990. Epitopes on protein antigens: misconceptions and realities. Cell 61:553-556. Parry, N., G. Fox, D. Rowlands, F. Brown, E. Fry, R. Acharya,

ANTIGENICITY OF RABIES VIRUS GLYCOPROTEIN

19.

20. 21. 22.

23. 24.

25. 26.

27.

4203

D. Logan, and D. Stuart. 1990. Structural and serological evidence for a novel mechanism of antigenic variation in footand-mouth disease virus. Nature (London) 347:569-572. Prehaud, C., P. Coulon, A. Diallo, C. Martinet-Edelist, and A. Flamand. 1989. Characterization of a new temperature-sensitive and avirulent mutant of the rabies virus. J. Gen. Virol. 70:133143. Prehaud, C., P. Coulon, F. Lafay, C. Thiers, and A. Flamand. 1988. Antigenic site II of the rabies virus glycoprotein: structure and role in viral virulence. J. Virol. 62:1-7. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. Seif, I., P. Coulon, P. E. Rollin, and A. Flamand. 1985. Rabies virulence: effect on pathogenicity and sequence characterization of rabies virus mutations affecting antigenic site III of the glycoprotein. J. Virol. 53:926-934. Wiktor, T. J., E. Gyorgy, H. D. Schlumberger, F. Sokol, and H. Koprowski. 1973. Antigenic properties of rabies virus components. J. Immunol. 110:269-276. Wiktor, T. J., and H. Koprowski. 1978. Monoclonal antibodies against rabies virus produced by somatic cell hybridization: detection of antigenic variants. Proc. Natl. Acad. Sci. USA 75:3839-3842. Wunner, W. H. Personal communication. Wunner, W. H., and B. Dietzschold. 1987. Rabies virus infection: genetic mutations and the impact on viral pathogenicity and immunity, p. 103-124. In J. M. Cruse and R. E. Lewis, Jr. (ed.), Contributions to microbiology and immunology. Karger, Basel. Wunner, W. H., B. Dietzschold, C. L. Smith, M. Lafon, and E. Golub. 1985. Antigenic variants of CVS rabies virus with altered glycosylation sites. Virology 140:1-12.