237
ARTICLE Antimicrobial resistance patterns and characterization of integrons in clinical isolates of Shigella from China Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by UNIV OF MANCHESTER on 10/11/14 For personal use only.
Haifei Yang, Yachao Pan, Lifen Hu, Yanyan Liu, Ying Ye, Jun Cheng, and Jiabin Li
Abstract: One hundred fifty-three Shigella isolates were examined for multiple antibiotic resistance phenotypes and prevalence of class 1 and class 2 integron sequences. The gene cassettes dfrA17-aadA5, dfrA12-orfF-aadA2, and arr-3-aacA4 were found in typical class 1 integrons. The gene cassettes blaOXA-1-aadA1 and dfrA1-sat1-aadA1 were detected in atypical class 1 integrons and in class 2 integrons, respectively. This is the first report of arr-3-aacA4 cassette detected in typical class 1 integrons among Shigella isolates. Rates of antibiotic resistance were different between integron-positive and integron-negative strains (P < 0.05), and all integronpositive isolates were resistant to at least 3 different antimicrobial agents. Typical class 1 integron-positive isolates showed higher resistance rates to cefotaxime and ciprofloxacin than did integron-negative ones (P < 0.05). Typical class 1 integrons and -lactamase genes were found in conjugative plasmids, otherwise class 2 and atypical class 1 integrons were located on chromosome. This study demonstrated the wide distribution of class 1 integrons in Shigella spp., which may lead resistance to cefotaxime and ciprofloxacin in China. Key words: Shigella spp., antimicrobial susceptibility, integron, -lactamase. Résumé : On a examiné les phénotypes d’antibiorésistance multiple et la prévalence de séquences d’intégrons de classe 1 et 2 chez 153 isolats de Shigella. Les cassettes géniques de dfrA17-aadA5, dfrA12-orfF-aadA2 et arr-3-aacA4 ont été retrouvées dans des intégrons de classe 1 typiques. Les segments blaOXA-1-aadA1 et dfrA1-sat1-aadA1 ont été détectés dans des intégrons de classe 1 atypiques et de classe 2, respectivement. Il s’agit du premier rapport signalant une cassette arr-3-aacA4 dans un intégron de classe 1 typique chez des isolats de Shigella. Les taux d’antibiorésistance étaient différents chez les souches intégron positives et négatives (P < 0,05), et tous les isolats recelant un intégron résistaient a` au moins 3 antimicrobiens distincts. Les isolats a` intégron typique de classe 1 étaient liés a` des taux de résistance au cefotaxime et a` la ciprofloxacine supérieurs aux isolats dépourvus de cet type d’intégron (P < 0,05). On a retrouvé les intégrons typiques de classe 1 et les gènes de la -lactamase dans des plasmides de conjugaison; a` l’opposé, les intégrons de classe 2 et de classe 1 atypiques étaient situés dans le chromosome. Cette étude a fait état d’une distribution élargie d’intégrons de classe 1 chez Shigella spp., ce qui pourrait donner lieu a` une résistance au cefotaxime et a` la ciprofloxacine en Chine. [Traduit par la Rédaction] Mots-clés : Shigella spp., susceptibilité aux antimicrobiens, intégron, -lactamase.
Introduction Shigellosis is a common diarrhoeal disease of both developed and developing countries. Global studies suggest there are 164.7 million episodes of shigellosis per year, of which 163.2 million are in developing countries and 1.5 million in developed countries. These episodes result in 1.1 million deaths, particularly among children in developing countries (Kotloff et al. 1999). In China, 0.8–1.7 million episodes of shigellosis were reported in 2000 and the predominant species was Shigella flexneri (Wang et al. 2006). Treatment with antimicrobial agents has been effective in alleviating the dysenteric syndrome of shigellosis, in reducing the duration of pathogen excretion to prevent disease transmission, and in lowering the risk of potential complications, for the past several decades. But the problem of antimicrobial resistance, especially multidrug resistance (resistance to 3 or more different kinds of antimicrobial agents), in Shigella continues to be alarming.
It is of great concern that integrons with resistance gene cassettes have been identified in plasmids, transposons, and chromosome (Bennish et al. 1992; Rajakumar et al. 1997). Mobile genetic elements may facilitate the dissemination of resistance determinants among species, even genera. Integrons are genecapture systems that harbour antibiotic resistance genes and may provide a flexible approach for bacteria to adapt to the pressure caused by antibiotics. The resistance to some antibiotics in Shigella species is associated with the presence of class 1 and class 2 integrons that contain resistance gene cassettes. The class 1 and class 2 integrons remain the most common integrons associated with resistance in clinical isolates (Goldstein et al. 2001; Sabaté and Prats 2002). Integrons and -lactamase-coding genes are responsible for the horizontal transfer of antimicrobial resistance among Gram-negative bacilli (Hall and Collis 1995; White et al. 2001).
Received 16 December 2013. Revision received 18 February 2014. Accepted 5 March 2014. H. Yang* and Y. Pan.* Department of Infectious Diseases, the First Affiliated Hospital of Anhui Medical University, Hefei, Anhui, People’s Republic of China. L. Hu.* Department of Center Laboratory, the First Affiliated Hospital of Anhui Medical University, Hefei, Anhui, People’s Republic of China; Institute of Bacterial Resistance, Anhui Medical University, Hefei, Anhui, People’s Republic of China; Anhui Center for Surveillance of Bacterial Resistance, Hefei, Anhui, People’s Republic of China. Y. Liu, Y. Ye, J. Cheng, and J. Li. Department of Infectious Diseases, the First Affiliated Hospital of Anhui Medical University, Hefei, Anhui, People’s Republic of China; Institute of Bacterial Resistance, Anhui Medical University, Hefei, Anhui, People’s Republic of China; Anhui Center for Surveillance of Bacterial Resistance, Hefei, Anhui, People’s Republic of China. Corresponding authors: Jun Cheng (e-mail: [email protected]) and Jiabin Li (e-mail: [email protected]). *These authors contributed equally to this work. Can. J. Microbiol. 60: 237–242 (2014) dx.doi.org/10.1139/cjm-2013-0893
Published at www.nrcresearchpress.com/cjm on 7 March 2014.
238
Can. J. Microbiol. Vol. 60, 2014
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by UNIV OF MANCHESTER on 10/11/14 For personal use only.
Table 1. Primers used for polymerase chain reaction. Primer
Sequence (5=¡3=)
Location
Product (bp)
Reference
intI1-F intI1-R intI2-F intI2-R intI3-F intI3-R In1-R In1-F In2-F In2-R intI1ca IS1 CTX-M-F CTX-M-R TEM-F TEM-R OXA-F OXA-R SHV-F SHV-R
ACATGTGATGGCGACGCACGA ATTTCTGTCCTGGCTGGCGA GTAGCAAACGAGTGACGAAATG CACGGATATGCGACAAAAAGGT AGTGGGTGGCGAATGAGTG TGTTCTTGTATCGGCAGGTG AAGCAGACTTGACCTGA GGCATCCAAGCAGCAAG GACGGCATGCACGATTTGTA GATGCCATCGCAAGTACGAG CGTAGA AGA ACAGCAAGG AGTGAGAGCAGAGATAGC ATGGTTAAAAAATCACTGCGCC TCCCGACGGCTTTCCGCCTT TTAGACGTCAGGTGGCACTT GGACCGGAGTTACCAATGCT AAGAAACGCTACTCGCCTGC CCACTCAACCCATCCTACCC TCTTTCCGATGCCGCCGCCAGTCA GCCGGGTTATTCTTATTTGTCGC
intI1 intI1 intI2 intI2 intI3 intI3 5= conserved sequence of class 1 integron 3= conserved sequence of class 1 integron 5= conserved sequence of class 2 integron 3= conserved sequence of class 2 integron intI1 IS1 blaCTX-M blaCTX-M blaTEM blaTEM blaOXA blaOXA blaSHV blaSHV
569
—
789
—
600
—
Variable
—
Variable
White et al. 2001
2453
—
833
—
1009
—
478
—
1115
—
The objectives of our study were to examine the molecular characteristics of class 1 and class 2 integrons, including their distribution and locations in the genome, and the correlation between gene cassettes and antibiotic resistance in Shigella isolates collected from Anhui, China, during a period of 5 years (2005–2009).
Materials and methods Bacterial isolates A total of 153 nonduplicate Shigella isolates were collected from 34 secondary level hospitals located in Anhui Province of China between September 2005 and September 2009. The patients included in this study were from 18 different cities in Anhui Province: Hefei, Wuhu, Bengbu, Huainan, Ma’anshan, Huaibei, Tongling, Anqing, Huangshan, Chuzhou, Fuyang, Suzhou, Lu’an, Bozhou, Chizhou, Chaohu, and Xuancheng, which distributed across the province. The ages of our patients ranged from 1 to 76. Stool specimens from patients with either diarrhea or dysentery were collected before the patients received antibiotics therapy and were then screened for Shigella spp. by conventional biochemical methods in local hospitals. All isolates were confirmed with API 20E (bioMérieux, Marcy l’Étoile, France) again in our laboratory. Of these Shigella isolates, 132 (86.3%) were S. flexneri, 19 (12.4%) Shigella sonnei, and 2 (0.7%) Shigella boydii. Escherichia coli ATCC 25922, E. coli ATCC 35218, E. coli V517, and sodium-azide-resistant E. coli J53 were stored at the Anhui Center for Surveillance of Bacterial Resistance (Hefei, Anhui, China). Antimicrobial susceptibility testing The minimum inhibitory concentrations (MICs) of ampicillin (AMP), cefotaxime (CTX), cefoxitin (FOX), ceftazidime (CAZ), cefepime (FEP), nalidixic acid (NA), ciprofloxacin (CIP), levofloxacin (LEV), norfloxacin (NOR), gatifloxacin (GAT), gentamicin (GM), amikacin (AMK), chloramphenicol (CHL), trimethoprim–sulfamethoxazole (SXT), tetracycline (TET), and imipenem (IMP) were determined by the agar dilution method, according to the guidelines of the Clinical Laboratory Standards Institute (2012). Escherichia coli ATCC 25922 and E. coli ATCC 35218 were used as a quality control strain. The susceptibility data of Shigella isolates tested were accepted only when the MIC for quality control strains tested in parallel was within the acceptable ranges given in the Clinical Laboratory Standards Institute guidelines. Multiple resistance was defined as resistance to 3 or more antimicrobials.
Polymerase chain reaction (PCR) amplification All Shigella isolates were screened for the class 1, class 2, and class 3 integrase genes (intI1, intI2, and intI3, respectively) and the extended-spectrum -lactamases genes (blaCTX-M, blaOXA, blaTEM, and blaSHV) using the primer pairs described in Table 1. All integron-positive Shigella isolates were screened for the presence of plasmid-mediated quinolone resistance (PMQR) genes (qnrA, qnrB, qnrS, qnrC, qnrD, aac(6=)-Ib-cr, and qepA) using methods described previously (Yamane et al. 2007; Xiong et al. 2008; Cavaco et al. 2009; Wang et al. 2009). The mutations in the quinoloneresistance-determining regions of the gyrA, gyrB, parC, and parE genes, in 16S rRNA methylase genes (armA, rmtB, rmtC, and npmA), and in plasmid-mediated ampC were determined by PCR with the methods described previously for the PMQR-positive isolates (Dutta et al. 2005; Cattoir et al. 2007; Doi and Arakawa 2007; Dallenne et al. 2010; Hu et al. 2011). All the purified PCR products were sequenced on an ABI Prism 3730 sequencer (Applied Biosystems, Foster City, California, USA). Sequence alignment was compared with the GenBank nucleotide database using the nucleotide BLAST program. The sequences of blaCTX-M-3, blaCTX-M-15, and blaCTX-M-55 have been submitted to GenBank under accession Nos. JN646780, JN627489, and JN627490, respectively. Conjugation experiments Conjugation experiments were carried out for all isolates positive for integrons and the -lactamase gene, with sodiumazide-resistant E. coli J53 as the recipient. Transconjugants were selected on Luria–Bertani agar plates supplemented with sodium azide (200 mg/L) (Sigma Chemical Co., St. Louis, Missouri, USA) and AMP (16 mg/L). Transconjugants were tested by biochemical method and confirmed using API 20E (bioMérieux) as E. coli. Plasmid DNA extraction from donors and transconjugants was performed using Qiagen Plasmid Purification kit (QIAGEN, Hilden, Germany). The transconjugants were examined by PCR for the presence of integrons and the -lactamase gene using plasmid DNA as the template and were tested for susceptibility as described above. Southern blot hybridization The plasmid sizes of donors and transconjugants were estimated by agarose gel electrophoresis as previously described (Wang et al. 2003). The presence of integron sequences were conPublished by NRC Research Press
Yang et al.
239
Table 2. The antimicrobial resistance of Shigella isolated from China.
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by UNIV OF MANCHESTER on 10/11/14 For personal use only.
No. of resistant isolates (%) Antimicrobial agent
S. flexneri (n = 132)
S. sonnei (n = 19)
Total (n = 153)
AMP CTX FOX CAZ FEP NA CIP LEV NOR GAT GM AMK CHL SXT TET IMP
129 (97.7) 33 (25.0) 4 (3.0) 7 (5.0) 9 (6.8) 130 (98.5) 40 (30.3) 15 (11.4) 130 (98.5) 13 (9.8) 58 (43.9) 4 (3.0) 93 (70.5) 91 (68.9) 128 (97.0) 0 (0.0)
15 (78.9) 5 (26.3) 0 (0.0) 2 (10.5) 3 (15.8) 8 (42.1) 8 (42.1) 2 (10.5) 8 (42.1) 3 (15.8) 6 (31.6) 2 (10.5) 1 (5.3) 3 (15.8) 10 (52.6) 0 (0.0)
144 (94.1) 38 (24.8) 5 (3.3) 9 (5.9) 11 (7.2) 138 (90.2) 48 (31.4) 17 (11.1) 138 (90.2) 16 (10.4) 64 (41.8) 6 (3.9) 95 (62.1) 94 (61.4) 138 (90.2) 0 (0.0)
Fig. 1. Profiles of plasmid and Southern hybridization of donors and transconjugants with the intI1 probe. Lanes: M, Escherichia coli V517 molecular marker; A, intI1-positive clinical strain; B, transconjugant; C, hybridization signal of clinical strain; and D, hybridization signal of corresponding transconjugant.
Note: AMP, ampicillin; CTX, cefotaxime; FOX, cefoxitin; CAZ, ceftazidime; FEP, cefepime; NA, nalidixic acid; CIP, ciprofloxacin; LEV, levofloxacin; NOR, norfloxacin; GAT, gatifloxacin; GM, gentamicin; AMK, amikacin; CHL, chloramphenicol; SXT, trimethoprim–sulfamethoxazole; TET, tetracycline; IMP, imipenem.
Table 3. The main antibiotic resistance patterns of Shigella from China. Antibiotic resistance pattern
No. of isolates (%)
AMP-NA-NOR-CHL-SXT-TET-CTX AMP-NA-NOR-CHL-SXT-TET-CTX-CIP-GM AMP-NA-NOR-SXT-TET-GM AMP-NA-NOR-CHL-SXT-TET AMP-CTX-CAZ-FEP-NA-CIP-LEV-GAT-NOR-GM-TET-CHL-SXT
18 (11.8) 9 (5.9) 25 (16.3) 29 (19.0) 7 (4.6)
Note: For definition of antibiotic abbreviations, see Note in Table 2.
firmed with Southern blot hybridization using the DIG Nucleic Acid Detection kit (Roche Applied Science, Mannheim, Germany). The plasmid DNA extracted from E. coli V517 was used as a marker for Southern blot hybridization. Statistical analysis To analyze the relationship between the prevalence of integrase gene and multidrug resistance, the software of SPSS 13.0 for Windows (SPSS Inc., Chicago, Illinois, USA) was used to evaluate the P value of Fisher’s Exact test.
Results A total of 132 S. flexneri isolates showed high levels of resistance to AMP (97.7%), NA (98.5%), NOR (98.5%), and TET (97.0%). Among 19 S. sonnei isolates, high levels of resistance to AMP (78.9%), TET (52.6%), NA (42.1%), and CIP (42.1%) were found (Table 2). Overall, 145 (94.8 %) of the 153 isolates exhibited multiple resistance. A majority of Shigella isolates were resistant to AMP, CHL, and SXT, which are commonly recommended drugs for treatment of shigellosis, as shown in Table 2. The most prevalent antimicrobial resistance patterns were AMP-NA-NOR-CHL-SXT-TET, AMP-NA-NOR-SXT-TET-GM, and AMPNA-NOR-CHL-SXT-TET-CTX, as shown in Table 3. And 3.3%, 24.8%, and 31.4% of the multiresistant isolates were resistant to FOX, CTX, and CIP, respectively. All of the isolates were susceptible to IMP. Of the 153 isolates, 133 (86.9%) isolates harboured class 1 integron and 109 (71.2%) harboured class 2 integron. Of the 144 (94.1%)
isolates positive for either integron, 98 (64.1%) isolates were positive for both class 1 and class 2 integrons, 35 (22.9%) for class 1 integron only, and 11 (7.2%) for class 2 integron only. Nine isolates were absent of all integrons (Table 4). All the strains harbouring class 2 integron or accompanied with class 1 integron were resistant to at least 3 different antibiotics tested. Among the 133 intI1positive isolates, only 22 isolates were positive for the variable region of typical class 1 integron with the primer pair 5=conserved sequence and 3= conserved sequence. The gene cassettes of typical class 1 integrons dfrA17-aadA5, aar-3-aacA4, and dfrA12-orfF-aadA2 were detected in 19 isolates, 2 isolates, and 1 isolate, respectively. A total of 120 isolates were contained gene cassette arrays of blaOXA-1-aadA1. All 109 intI2-positive isolates contained constant gene cassette arrays of dfrA1-sat1-aadA1 (Table 4). There were no isolates positive for intI3 (data not shown). The prevalence of intI1 and intI2 was significantly higher in isolates with multidrug resistance to at least 3 antibiotics than that in isolates with resistance to ≤2 antibiotics (P < 0.05) (Table 5). Among the 153 isolates, 102 (66.7%) contained the blaOXA-1 gene, 35 (22.9%) the blaTEM-1 gene, and 83 (54.2%) the blaCTX-M gene (including blaCTX-M-3, blaCTX-M-15, and blaCTX-M-55). The blaSHV gene was not detected in any isolates. Five Shigella isolates (S12, S21, S43, S120, and S121) positive for both class 1 and class 2 integrons and for PMQR carried 3 or more resistance determinants on the same strain. All 5 isolates also had at least one mutation in gyrA (S83L or D87Y) or parC (S80I) genes, which caused CIP resistance (MICs ≥ 4 g/mL) (Table 6). All of these typical class 1 integron-positive isolates were able to transfer gene cassettes to E. coli J53. Southern hybridization revealed that donors and transconjugants contained plasmids hybridizing with the intI1 probe. The intI1-positive plasmid was about 5.1 kb (Fig. 1). However, the negative results of conjugation experiments suggested that the atypical class 1 integron and the class 2 integron were only present in the chromosomes of these isolates. Published by NRC Research Press
240
Can. J. Microbiol. Vol. 60, 2014
Table 4. Profiles of integrons and gene cassettes in 153 Shigella isolates. Gene cassette Integrase gene
Typical class 1 integron
Atypical class 1 integron
Class 2 integron
Shigella serotype
No. of isolates
intI1
intI2
Both*
None
dfrA17-aadA5
aar-3-aacA4
dfrA12-orfF-aadA2
blaOXA-1-aadA1
dfrA1-sat1-aadA1
S. flexneri S. sonnei S. boydii
132 19 2
119 13 1
91 16 2
85 12 1
7 2 0
17 2 0
2 0 0
1 0 0
107 12 1
91 16 2
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by UNIV OF MANCHESTER on 10/11/14 For personal use only.
*“Both” means isolates contain intI1 and intI2 simultaneously.
Table 5. The profiles of integron-positive and multiresistant Shigella from China. No. of isolates (%) Group
No.
Multiresistant to ≥3 antibiotics
Susceptive to all or resistant to ≤2 antibiotics
Positive for either integron Negative for all integrons Positive for intI1 gene Negative for intI1 gene Positive for intI2 gene Negative for intI2 gene
144 9 133 20 109 44
140 (97.2) 5 (55.6) 131 (98.5) 14 (70.0) 106 (97.2) 39 (88.6)
4 (2.8) 4 (44.4) 2 (1.5) 6 (30.0) 3 (2.8) 5 (11.4)
P* 0.000 0.000 0.044
*Fisher's Exact test.
Table 6. Profile of 5 Shigella isolates positive for both class 1 and class 2 integrons. Mutation in QRDRs
-Lactamase
PMQR Isolate blaCTX-M15 blaOXA-1 blaTEM-1 blaSHV determinants gyrA S12 S21 S43 S120 S121
+ – + + +
+ + – + +
– – – – +
– – – – –
aac(6=)-Ib-cr qepA aac(6=)-Ib-cr qnrS2 qnrS2
parC Methylase Antibiotic resistance pattern
S83L D87Y S80I rmtB S83L S83L S80I S83L S80I rmtB
AMP-CTX-NA-LEV-GAT-GM-TET-CHL-SXT AMP-NA-CIP-LEV-NOR-GM, AMK-TET-CHL-SXT AMP-CTX-NA-TET-SXT AMP-CTX-FEP-NA-CIP-LEV-GAT-NOR-GM-TET-CHL-SXT AMP-CTX-CAZ-FEP-NA-CIP-LEV-GAT-NOR-GM-AMK-TET-CHL-SXT
Note: PMQR, plasmid-mediated quinolone resistance; QRDRs, quinolone-resistance-determining regions. For definition of antibiotic abbreviations, see Note in Table 2.
Discussion Among Shigella isolates, S. flexneri is the major agent that causes bacterial diarrhea in most Asian countries (Kotloff et al. 1999; Choi et al. 2007). Our study also showed that S. flexneri remains the predominant serotype among Shigella strains in Anhui Province. Antimicrobial resistance in Shigella is common nowadays; it is particularly resistant to TET and sulfonamides–trimethoprim (Peirano et al. 2005). However, the resistance rates to AMP, CHL, and NA vary greatly (Jafari et al. 2009; Rosewell et al. 2010). In our study, Shigella isolates had a high prevalence of resistance to all of these commonly used antimicrobial agents. The most frequent antimicrobial resistance pattern was AMP-NA-NOR-CHL-SXT-TET. Our findings illustrated that more than two thirds of Shigella isolates were resistant to at least 6 antimicrobials, which confirmed that these antimicrobial agents are now generally inefficient in the empirical treatment of shigellosis. Shigella had good sensitivity to CIP and CTX in vitro, but the resistance rates were still high in our study in contrast with studies for some other countries (Oh et al. 2003; Rosewell et al. 2010). Although AMP and SXT have been recommended for treating shigellosis in the past, they are currently considered ineffective for empirical therapy (Niyogi 2005). In our study, we found a high prevalence of Shigella isolates with resistance to many kinds of antimicrobials. In China, patients with diarrhea have commonly been treated with antimicrobials by doctors without the result of bacterial culture. In many cases, patients with diarrhea took antimicrobials by themselves before they saw a doctor, regardless of whether the diarrhea was caused by bacteria or virus. Therefore, antibiotic abuse and misuse is very serious.
According to the current study, the observed susceptibility of Shigella isolates to FOX, AMK, third-generation cephalosporins, and IMP indicated that these antibiotics may be the preferred empirical treatment options in Anhui, China. From our findings and that of others (Oh et al. 2003; Peirano et al. 2005; Jafari et al. 2009; Rosewell et al. 2010), we concluded that antimicrobial resistance in Shigella isolates may change over time and along with regions, so continuous surveillance of resistance is necessary, especially in developing countries. The prevalence of integrons found in Shigella varies from country to country. In our study, most Shigella isolates harboured classes 1 or 2 integrons, and class 1 integron was the most frequently detected, which is in keeping with the results of other studies (Dubois et al. 2007; Gassama Sow et al. 2010). However, some reports also revealed that class 2 integron was predominant in some countries (Peirano et al. 2005; Ahmed et al. 2006). The prevalence of class 1 and class 2 integrons in Shigella isolates in Anhui Province was higher than that in previous studies (Dubois et al. 2007). The resistance to antimicrobials in Shigella isolates with class 1 integron and (or) class 2 integron was far more common than that in Shigella isolates without them (P < 0.05). This demonstrates that horizontal gene transfer mediated by integrons contributes to the dissemination of antimicrobial drug resistance in Shigella isolates in Anhui, China. Our results proved that the majority of typical class 1 integrons contained the gene cassette dfrA17-aadA5. In addition, dfr12-orfF-aadA2 was detected in 1 Shigella isolate while arr-3-aacA4 was detected in 2 Shigella isolates. These cassettes have also been reported in different bacterial species worldwide (Chang et al. 2009; Krauland Published by NRC Research Press
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by UNIV OF MANCHESTER on 10/11/14 For personal use only.
Yang et al.
et al. 2009; Zhang et al. 2009). The typical class 1 integron-positive isolates showed higher resistance to CTX and CIP in contrast with class 1 integron-negative ones (P < 0.05). The typical class 1 integron-positive Shigella isolates had a higher incidence of blaTEM compared with atypical class 1 integron- or class 2 integronpositive isolates (P < 0.05). But the reason for this phenomenon is not clear, and thus needs further investigation. Conjugation experiments and Southern hybridization indicated the horizontal transfer of typical class 1 integron through conjugative plasmids. The present study also identified an atypical class 1 integron with an unusual 3= conserved sequence linked to an insertion sequence called IS1, which was first discovered on the chromosome of S. flexneri 2a strain YSH6000 isolated in Japan (Rajakumar et al. 1997). According to the previous report (Rajakumar et al. 1997), the atypical class 1 integron together with CHL and TET resistance determinants were located in the Shigella resistance locus. Our result showed that atypical class 1 integron-positive Shigella isolates had a higher resistance rates to AMP, CHL, and TET (P < 0.05), which also confirmed that the atypical class 1 integron was linked to CHL and TET resistance determinants. Previous studies have proved that class 2 integron was often associated with S. sonnei isolates (Chang et al. 2011). In our study, class 2 integrons were detected in a large quantity of S. flexneri and S. sonnei isolates indiscriminately. The only gene cassette array found in the class 2 integron was dfrA1-sat1-aadA1. Both the class 2 integron and atypical class 1 integron can not be transferred by conjugation. Moreover, the failure of hybridization confirmed their chromosome location, which indicated the transmission of clones carrying class 2 integron and atypical class 1 integron among isolates. The bla genes for TEM, CTX-M, and OXA were also detected in 153 isolates, and all the blaOXA-positive isolates were found to contain gene cassette arrays of blaOXA-1-aadA1. The presence of these resistance genes in combination with integrons may have important clinical implications, which will make the multidrug resistance more serious, as the resistance genes can widely and rapidly distribute within and between species. In our study, 5 Shigella isolates positive for both class 1 and class 2 integrons and for PMQR carried 3 or more resistance determinants on the same strain All 5 isolates had at least 1 mutation in gyrA (S83L or D87Y) or parC (S80I) genes, which caused CIP resistance (MICs ≥ 4 g/mL). So these mechanisms should be explored further to monitor and control antimicrobial resistance. In conclusion, this study demonstrated that multiple antibiotic resistance is common in clinical isolates of Shigella in Anhui, China, especially against widely used therapeutic agents for shigellosis. Multiple antibiotic resistance in the isolates was conferred by class 1 and class 2 integrons and other antimicrobial resistance genes. Therefore, further strengthening of surveillance of antimicrobial resistance in China is urgently needed.
Acknowledgements This study was supported by the Natural Science Foundation of China (Nos. 30972631 and 81172737) and Provincial Natural Science Foundation Key Program of Higher Education of China (Nos. KJ2011A180, KJ2012A177, and KJ2010A344). We are grateful to Huimin Ma, Xue Zhou, Liguang Liu and Xiuying Miao for assistance in antimicrobial susceptibility testing. Authors declare no conflict of interest.
References Ahmed, A.M., Furuta, K., Shimomura, K., Kasama, Y., and Shimamoto, T. 2006. Genetic characterization of multidrug resistance in Shigella spp. from Japan. J. Med. Microbiol. 55: 1685–1691. doi:10.1099/jmm.0.46725-0. PMID:17108272. Bennish, M.L., Salam, M.A., Hossain, M.A., Myaux, J., Khan, E.H., Chakraborty, J., et al. 1992. Antimicrobial resistance of Shigella isolates in Bangladesh, 19831990: increasing frequency of strains multiply resistant to ampicillin, trimethoprim–sulfamethoxazole, and nalidixic acid. J. Infect. Dis. 14: 1055– 1060. doi:10.1093/clinids/14.5.1055. PMID:1600006.
241
Cattoir, V., Poirel, L., Rotimi, V., Soussy, C.J., and Nordmann, P. 2007. Multiplex PCR for detection of plasmid-mediated quinolone resistance qnr genes in ESBL-producing enterobacterial isolates. J. Antimicrob. Chemother. 60: 394– 397. doi:10.1093/jac/dkm204. PMID:17561500. Cavaco, L.M., Hasman, H., Xia, S., and Aarestrup, F.M. 2009. qnrD, a novel gene conferring transferable quinolone resistance in Salmonella enterica serovar Kentucky and Bovismorbificans strains of human origin. Antimicrob. Agents Chemother. 53: 603–608. doi:10.1128/AAC.00997-08. PMID:19029321. Chang, C.Y., Fang, Y.T., Tsai, S.M., Chang, L.L., and Yu, W.L. 2009. Characterization of class 1 integrons and gene cassettes in clinical isolates of Klebsiella pneumoniae from Taiwan. Diagn. Microbiol. Infect. Dis. 65: 214–216. doi:10. 1016/j.diagmicrobio.2009.06.005. PMID:19748438. Chang, C.Y., Lu, P.L., Lin, C.C., Lee, T.M., Tsai, M.Y., and Chang, L.L. 2011. Integron types, gene cassettes, antimicrobial resistance genes and plasmids of Shigella sonnei isolates from outbreaks and sporadic cases in Taiwan. J. Med. Microbiol. 60: 197–204. doi:10.1099/jmm.0.022517-0. PMID:20947666. Choi, S.Y., Jeon, Y.S., Lee, J.H., Choi, B., Moon, S.H., von Seidlein, L., et al. 2007. Multilocus sequence typing analysis of Shigella flexneri isolates collected in Asian countries. J. Med. Microbiol. 56: 1460–1466. doi:10.1099/jmm.0.47322-0. PMID:17965345. Clinical and Laboratory Standards Institute. 2012. Performance Standards for Antimicrobial Susceptibility Testing; Nineteenth Information Supplement. M100-S22. CLSI, Wayne, Penn., USA. Dallenne, C., Da Costa, A., Decré, D., Favier, C., and Arlet, G. 2010. Development of a set of multiplex PCR assays for the detection of genes encoding important -lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 65: 490– 495. doi:10.1093/jac/dkp498. PMID:20071363. Doi, Y., and Arakawa, Y. 2007. 16S ribosomal RNA methylation: emerging resistance mechanism against aminoglycosides. Clin. Infect. Dis. 45: 88–94. doi: 10.1086/518605. PMID:17554708. Dubois, V., Parizano, M.P., Arpin, C., Coulange, L., Bezian, M.C., and Quentin, C. 2007. High genetic stability of integrons in clinical isolates of Shigella spp. of worldwide origin. Antimicrob. Agents Chemother. 51: 1333–1340. doi:10.1128/ AAC.01109-06. PMID:17242143. Dutta, S., Kawamura, Y., Ezaki, T., Nair, G.B., Lida, K., and Yoshida, S. 2005. Alteration in the GyrA subunit of DNA gyrase and the ParC subunit of topoisomerase IV in quinolone-resistant Shigella dysenteriae serotype I clinical isolates from Kolkata, India. Antimicrob. Agents Chemother. 49: 1660–1661. doi:10.1128/AAC.49.4.1660-1661.2005. PMID:15793166. Gassama Sow, A., Aïdara-Kane, A., Barraud, O., Gatet, M., Denis, F., and Ploy, M.C. 2010. High prevalence of trimethoprim-resistance cassettes in class 1 and 2 integrons in Senegalese Shigella isolates. J. Infect. Dev. Counttries, 4: 207–212. doi:10.3855/jidc.583. PMID:20440057. Goldstein, C., Lee, M.D., Sanchez, S., Hudson, C., Phillips, B., Register, B., et al. 2001. Incidence of class 1 and 2 integrases in clinical and commensal bacteria from livestock, companion animals and exotics. Antimicrob. Agents Chemother. 45: 723–726. doi:10.1128/AAC.45.3.723-726.2001. PMID:11181350. Hall, R.M., and Collis, C.M. 1995. Mobile gene cassettes and integrons: capture and spread of genes by site-specific recombination. Mol. Microbiol. 15: 593– 600. doi:10.1111/j.1365-2958.1995.tb02368.x. PMID:7783631. Hu, L.F., Chang, X., Ye, Y., Wang, Z.X., Shao, Y.B., Shi, W., et al. 2011. Stenotrophomonas maltophilia resistance to trimethoprim/sulfamethoxazole mediated by acquisition of sul and dfrA genes in a plasmid-mediated class 1 integron. Int. J. Antimicrob. Agents, 37: 230–234. doi:10.1016/j.ijantimicag.2010.10.025. PMID: 21296557. Jafari, F., Hamidian, M., Rezadehbashi, M., Doyle, M., Salmanzadeh-Ahrabi, S., Derakhshan, F., and Reza Zali, M. 2009. Prevalence and antimicrobial resistance of diarrheagenic Escherichia coli and Shigella species associated with acute diarrhea in Tehran, Iran. Can. J. Infect. Dis. Med. Microbiol. 20: e56– e62. PMID:20808457. Kotloff, K.L., Winickoff, J.P., Ivanoff, B., Clemens, J.D., Swerdlow, D.L., Sansonetti, P.J., et al. 1999. Global burden of Shigella infections: implications for vaccine development and implementation of control strategies. Bull. W. H. O. 77: 651–666. PMID:10516787. Krauland, M.G., Marsh, J.W., Paterson, D.L., and Harrison, L.H. 2009. Integronmediated multidrug resistance in a global collection of nontyphoidal Salmonella enterica isolates. Emerg. Infect. Dis. 15: 388–396. doi:10.3201/eid1503. 081131. PMID:19239750. Niyogi, S.K. 2005. Shigellosis. J. Microbiol. 43: 133–143. PMID:15880088. Oh, J.Y., Yu, H.S., Kim, S.K., Seol, S.Y., Cho, D.T., and Lee, J.C. 2003. Changes in patterns of antimicrobial susceptibility and integron carriage among Shigella sonnei isolates from southwestern Korea during epidemic periods. J. Clin. Microbiol. 41: 421–423. doi:10.1128/JCM.41.1.421-423.2003. PMID:12517883. Peirano, G., Agersø, Y., Aarestrup, F.M., and dos Prazeres Rodrigues, D. 2005. Occurrence of integrons and resistance genes among sulphonamideresistant Shigella spp. from Brazil. J. Antimicrob. Chemother. 55: 301–305. doi:10. 1093/jac/dki012. PMID:15681578. Rajakumar, K., Bulach, D., Davies, J., Ambrose, L., Sasakawa, C., and Adler, B. 1997. Identification of a chromosomal Shigella flexneri multi-antibiotic resistance locus which shares sequence and organizational similarity with the resistance region of the plasmid NR1. Plasmid, 37: 159–168. doi:10.1006/plas. 1997.1280. PMID:9200219. Rosewell, A., Ropa, B., Posanai, E., Dutta, S.R., Mola, G., Zwi, A., and Published by NRC Research Press
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by UNIV OF MANCHESTER on 10/11/14 For personal use only.
242
MacIntyre, C.R. 2010. Shigella spp. antimicrobial drug resistance, Papua New Guinea, 2000-2009. Emerg. Infect. Dis. 16: 1797–1799. doi:10.3201/eid1611. 101025. PMID:21029550. Sabaté, M., and Prats, G. 2002. Structure and function of integrons. Enferm. Infecc. Microbiol. Clin. 20: 341–345. doi:10.1016/S0213-005X(02)72813-9. PMID: 12237001. Wang, M., Tran, J.H., Jacoby, G.A., Zhang, Y.Y., Wang, F., and Hooper, D.C. 2003. Plasmid-mediated quinolone resistance in clinical isolates of Escherichia coli from Shanghai, China. Antimicrob. Agents Chemother. 47: 2242–2248. doi: 10.1128/AAC.47.7.2242-2248.2003. PMID:12821475. Wang, M., Guo, Q., Xu, X., Wang, X., Ye, X., Wu, S., et al. 2009. New plasmidmediated quinolone resistance gene, qnrC, found in a clinical isolate of Proteus mirabilis. Antimicrob. Agents Chemother. 53:1892–1897. doi:10.1128/ AAC.01400-08. PMID:19258263. Wang, X.Y., Tao, F, Xiao, D., Lee, H., Deen, J., Gong, J., et al. 2006. Trend and
Can. J. Microbiol. Vol. 60, 2014
disease burden of bacillary dysentery in China (1991-2000). Bull. W.H.O. 84: 561–568. doi:10.2471/BLT.05.023853. PMID:16878230. White, P.A., McIver, C.J., and Rawlinson, W.D. 2001. Integrons and gene cassettes in the Enterobacteriaceae. Antimicrob. Agents Chemother. 45: 2658–2661. doi: 10.1128/AAC.45.9.2658-2661.2001. PMID:11502548. Xiong, Z., Wang, P., Wei, Y., Wang, H., Cao, H., Huang, H., and Li, J. 2008. Investigation of qnr and aac(6=)-Ib-cr in Enterobacter cloacae isolates from Anhui Province, China. Diagn. Microbiol. Infect. Dis. 62: 457–459. doi:10.1016/j. diagmicrobio.2008.07.010. PMID:18814992. Yamane, K., Wachino, J., Suzuki, S., Kimura, K., Shibata, N., Kato, H., et al. 2007. New plasmid-mediated fluoroquinolone efflux pump, QepA, found in an Escherichia coli clinical isolate. Antimicrob. Agents Chemother. 51: 3354–3360. doi:10.1128/AAC.00339-07. PMID:17548499. Zhang, X.Y., Ding, L.J., and Yue, J. 2009. Occurrence and characteristics of class 1 and class 2 integrons in resistant Escherichia coli isolates from animals and farm workers in northeastern China. Microb. Drug Resist. 15: 323–328. doi: 10.1089/mdr.2009.0020. PMID:19857140.
Published by NRC Research Press
ARTICLE Antimicrobial resistance patterns and characterization of integrons in clinical isolates of Shigella from China Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by UNIV OF MANCHESTER on 10/11/14 For personal use only.
Haifei Yang, Yachao Pan, Lifen Hu, Yanyan Liu, Ying Ye, Jun Cheng, and Jiabin Li
Abstract: One hundred fifty-three Shigella isolates were examined for multiple antibiotic resistance phenotypes and prevalence of class 1 and class 2 integron sequences. The gene cassettes dfrA17-aadA5, dfrA12-orfF-aadA2, and arr-3-aacA4 were found in typical class 1 integrons. The gene cassettes blaOXA-1-aadA1 and dfrA1-sat1-aadA1 were detected in atypical class 1 integrons and in class 2 integrons, respectively. This is the first report of arr-3-aacA4 cassette detected in typical class 1 integrons among Shigella isolates. Rates of antibiotic resistance were different between integron-positive and integron-negative strains (P < 0.05), and all integronpositive isolates were resistant to at least 3 different antimicrobial agents. Typical class 1 integron-positive isolates showed higher resistance rates to cefotaxime and ciprofloxacin than did integron-negative ones (P < 0.05). Typical class 1 integrons and -lactamase genes were found in conjugative plasmids, otherwise class 2 and atypical class 1 integrons were located on chromosome. This study demonstrated the wide distribution of class 1 integrons in Shigella spp., which may lead resistance to cefotaxime and ciprofloxacin in China. Key words: Shigella spp., antimicrobial susceptibility, integron, -lactamase. Résumé : On a examiné les phénotypes d’antibiorésistance multiple et la prévalence de séquences d’intégrons de classe 1 et 2 chez 153 isolats de Shigella. Les cassettes géniques de dfrA17-aadA5, dfrA12-orfF-aadA2 et arr-3-aacA4 ont été retrouvées dans des intégrons de classe 1 typiques. Les segments blaOXA-1-aadA1 et dfrA1-sat1-aadA1 ont été détectés dans des intégrons de classe 1 atypiques et de classe 2, respectivement. Il s’agit du premier rapport signalant une cassette arr-3-aacA4 dans un intégron de classe 1 typique chez des isolats de Shigella. Les taux d’antibiorésistance étaient différents chez les souches intégron positives et négatives (P < 0,05), et tous les isolats recelant un intégron résistaient a` au moins 3 antimicrobiens distincts. Les isolats a` intégron typique de classe 1 étaient liés a` des taux de résistance au cefotaxime et a` la ciprofloxacine supérieurs aux isolats dépourvus de cet type d’intégron (P < 0,05). On a retrouvé les intégrons typiques de classe 1 et les gènes de la -lactamase dans des plasmides de conjugaison; a` l’opposé, les intégrons de classe 2 et de classe 1 atypiques étaient situés dans le chromosome. Cette étude a fait état d’une distribution élargie d’intégrons de classe 1 chez Shigella spp., ce qui pourrait donner lieu a` une résistance au cefotaxime et a` la ciprofloxacine en Chine. [Traduit par la Rédaction] Mots-clés : Shigella spp., susceptibilité aux antimicrobiens, intégron, -lactamase.
Introduction Shigellosis is a common diarrhoeal disease of both developed and developing countries. Global studies suggest there are 164.7 million episodes of shigellosis per year, of which 163.2 million are in developing countries and 1.5 million in developed countries. These episodes result in 1.1 million deaths, particularly among children in developing countries (Kotloff et al. 1999). In China, 0.8–1.7 million episodes of shigellosis were reported in 2000 and the predominant species was Shigella flexneri (Wang et al. 2006). Treatment with antimicrobial agents has been effective in alleviating the dysenteric syndrome of shigellosis, in reducing the duration of pathogen excretion to prevent disease transmission, and in lowering the risk of potential complications, for the past several decades. But the problem of antimicrobial resistance, especially multidrug resistance (resistance to 3 or more different kinds of antimicrobial agents), in Shigella continues to be alarming.
It is of great concern that integrons with resistance gene cassettes have been identified in plasmids, transposons, and chromosome (Bennish et al. 1992; Rajakumar et al. 1997). Mobile genetic elements may facilitate the dissemination of resistance determinants among species, even genera. Integrons are genecapture systems that harbour antibiotic resistance genes and may provide a flexible approach for bacteria to adapt to the pressure caused by antibiotics. The resistance to some antibiotics in Shigella species is associated with the presence of class 1 and class 2 integrons that contain resistance gene cassettes. The class 1 and class 2 integrons remain the most common integrons associated with resistance in clinical isolates (Goldstein et al. 2001; Sabaté and Prats 2002). Integrons and -lactamase-coding genes are responsible for the horizontal transfer of antimicrobial resistance among Gram-negative bacilli (Hall and Collis 1995; White et al. 2001).
Received 16 December 2013. Revision received 18 February 2014. Accepted 5 March 2014. H. Yang* and Y. Pan.* Department of Infectious Diseases, the First Affiliated Hospital of Anhui Medical University, Hefei, Anhui, People’s Republic of China. L. Hu.* Department of Center Laboratory, the First Affiliated Hospital of Anhui Medical University, Hefei, Anhui, People’s Republic of China; Institute of Bacterial Resistance, Anhui Medical University, Hefei, Anhui, People’s Republic of China; Anhui Center for Surveillance of Bacterial Resistance, Hefei, Anhui, People’s Republic of China. Y. Liu, Y. Ye, J. Cheng, and J. Li. Department of Infectious Diseases, the First Affiliated Hospital of Anhui Medical University, Hefei, Anhui, People’s Republic of China; Institute of Bacterial Resistance, Anhui Medical University, Hefei, Anhui, People’s Republic of China; Anhui Center for Surveillance of Bacterial Resistance, Hefei, Anhui, People’s Republic of China. Corresponding authors: Jun Cheng (e-mail: [email protected]) and Jiabin Li (e-mail: [email protected]). *These authors contributed equally to this work. Can. J. Microbiol. 60: 237–242 (2014) dx.doi.org/10.1139/cjm-2013-0893
Published at www.nrcresearchpress.com/cjm on 7 March 2014.
238
Can. J. Microbiol. Vol. 60, 2014
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by UNIV OF MANCHESTER on 10/11/14 For personal use only.
Table 1. Primers used for polymerase chain reaction. Primer
Sequence (5=¡3=)
Location
Product (bp)
Reference
intI1-F intI1-R intI2-F intI2-R intI3-F intI3-R In1-R In1-F In2-F In2-R intI1ca IS1 CTX-M-F CTX-M-R TEM-F TEM-R OXA-F OXA-R SHV-F SHV-R
ACATGTGATGGCGACGCACGA ATTTCTGTCCTGGCTGGCGA GTAGCAAACGAGTGACGAAATG CACGGATATGCGACAAAAAGGT AGTGGGTGGCGAATGAGTG TGTTCTTGTATCGGCAGGTG AAGCAGACTTGACCTGA GGCATCCAAGCAGCAAG GACGGCATGCACGATTTGTA GATGCCATCGCAAGTACGAG CGTAGA AGA ACAGCAAGG AGTGAGAGCAGAGATAGC ATGGTTAAAAAATCACTGCGCC TCCCGACGGCTTTCCGCCTT TTAGACGTCAGGTGGCACTT GGACCGGAGTTACCAATGCT AAGAAACGCTACTCGCCTGC CCACTCAACCCATCCTACCC TCTTTCCGATGCCGCCGCCAGTCA GCCGGGTTATTCTTATTTGTCGC
intI1 intI1 intI2 intI2 intI3 intI3 5= conserved sequence of class 1 integron 3= conserved sequence of class 1 integron 5= conserved sequence of class 2 integron 3= conserved sequence of class 2 integron intI1 IS1 blaCTX-M blaCTX-M blaTEM blaTEM blaOXA blaOXA blaSHV blaSHV
569
—
789
—
600
—
Variable
—
Variable
White et al. 2001
2453
—
833
—
1009
—
478
—
1115
—
The objectives of our study were to examine the molecular characteristics of class 1 and class 2 integrons, including their distribution and locations in the genome, and the correlation between gene cassettes and antibiotic resistance in Shigella isolates collected from Anhui, China, during a period of 5 years (2005–2009).
Materials and methods Bacterial isolates A total of 153 nonduplicate Shigella isolates were collected from 34 secondary level hospitals located in Anhui Province of China between September 2005 and September 2009. The patients included in this study were from 18 different cities in Anhui Province: Hefei, Wuhu, Bengbu, Huainan, Ma’anshan, Huaibei, Tongling, Anqing, Huangshan, Chuzhou, Fuyang, Suzhou, Lu’an, Bozhou, Chizhou, Chaohu, and Xuancheng, which distributed across the province. The ages of our patients ranged from 1 to 76. Stool specimens from patients with either diarrhea or dysentery were collected before the patients received antibiotics therapy and were then screened for Shigella spp. by conventional biochemical methods in local hospitals. All isolates were confirmed with API 20E (bioMérieux, Marcy l’Étoile, France) again in our laboratory. Of these Shigella isolates, 132 (86.3%) were S. flexneri, 19 (12.4%) Shigella sonnei, and 2 (0.7%) Shigella boydii. Escherichia coli ATCC 25922, E. coli ATCC 35218, E. coli V517, and sodium-azide-resistant E. coli J53 were stored at the Anhui Center for Surveillance of Bacterial Resistance (Hefei, Anhui, China). Antimicrobial susceptibility testing The minimum inhibitory concentrations (MICs) of ampicillin (AMP), cefotaxime (CTX), cefoxitin (FOX), ceftazidime (CAZ), cefepime (FEP), nalidixic acid (NA), ciprofloxacin (CIP), levofloxacin (LEV), norfloxacin (NOR), gatifloxacin (GAT), gentamicin (GM), amikacin (AMK), chloramphenicol (CHL), trimethoprim–sulfamethoxazole (SXT), tetracycline (TET), and imipenem (IMP) were determined by the agar dilution method, according to the guidelines of the Clinical Laboratory Standards Institute (2012). Escherichia coli ATCC 25922 and E. coli ATCC 35218 were used as a quality control strain. The susceptibility data of Shigella isolates tested were accepted only when the MIC for quality control strains tested in parallel was within the acceptable ranges given in the Clinical Laboratory Standards Institute guidelines. Multiple resistance was defined as resistance to 3 or more antimicrobials.
Polymerase chain reaction (PCR) amplification All Shigella isolates were screened for the class 1, class 2, and class 3 integrase genes (intI1, intI2, and intI3, respectively) and the extended-spectrum -lactamases genes (blaCTX-M, blaOXA, blaTEM, and blaSHV) using the primer pairs described in Table 1. All integron-positive Shigella isolates were screened for the presence of plasmid-mediated quinolone resistance (PMQR) genes (qnrA, qnrB, qnrS, qnrC, qnrD, aac(6=)-Ib-cr, and qepA) using methods described previously (Yamane et al. 2007; Xiong et al. 2008; Cavaco et al. 2009; Wang et al. 2009). The mutations in the quinoloneresistance-determining regions of the gyrA, gyrB, parC, and parE genes, in 16S rRNA methylase genes (armA, rmtB, rmtC, and npmA), and in plasmid-mediated ampC were determined by PCR with the methods described previously for the PMQR-positive isolates (Dutta et al. 2005; Cattoir et al. 2007; Doi and Arakawa 2007; Dallenne et al. 2010; Hu et al. 2011). All the purified PCR products were sequenced on an ABI Prism 3730 sequencer (Applied Biosystems, Foster City, California, USA). Sequence alignment was compared with the GenBank nucleotide database using the nucleotide BLAST program. The sequences of blaCTX-M-3, blaCTX-M-15, and blaCTX-M-55 have been submitted to GenBank under accession Nos. JN646780, JN627489, and JN627490, respectively. Conjugation experiments Conjugation experiments were carried out for all isolates positive for integrons and the -lactamase gene, with sodiumazide-resistant E. coli J53 as the recipient. Transconjugants were selected on Luria–Bertani agar plates supplemented with sodium azide (200 mg/L) (Sigma Chemical Co., St. Louis, Missouri, USA) and AMP (16 mg/L). Transconjugants were tested by biochemical method and confirmed using API 20E (bioMérieux) as E. coli. Plasmid DNA extraction from donors and transconjugants was performed using Qiagen Plasmid Purification kit (QIAGEN, Hilden, Germany). The transconjugants were examined by PCR for the presence of integrons and the -lactamase gene using plasmid DNA as the template and were tested for susceptibility as described above. Southern blot hybridization The plasmid sizes of donors and transconjugants were estimated by agarose gel electrophoresis as previously described (Wang et al. 2003). The presence of integron sequences were conPublished by NRC Research Press
Yang et al.
239
Table 2. The antimicrobial resistance of Shigella isolated from China.
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by UNIV OF MANCHESTER on 10/11/14 For personal use only.
No. of resistant isolates (%) Antimicrobial agent
S. flexneri (n = 132)
S. sonnei (n = 19)
Total (n = 153)
AMP CTX FOX CAZ FEP NA CIP LEV NOR GAT GM AMK CHL SXT TET IMP
129 (97.7) 33 (25.0) 4 (3.0) 7 (5.0) 9 (6.8) 130 (98.5) 40 (30.3) 15 (11.4) 130 (98.5) 13 (9.8) 58 (43.9) 4 (3.0) 93 (70.5) 91 (68.9) 128 (97.0) 0 (0.0)
15 (78.9) 5 (26.3) 0 (0.0) 2 (10.5) 3 (15.8) 8 (42.1) 8 (42.1) 2 (10.5) 8 (42.1) 3 (15.8) 6 (31.6) 2 (10.5) 1 (5.3) 3 (15.8) 10 (52.6) 0 (0.0)
144 (94.1) 38 (24.8) 5 (3.3) 9 (5.9) 11 (7.2) 138 (90.2) 48 (31.4) 17 (11.1) 138 (90.2) 16 (10.4) 64 (41.8) 6 (3.9) 95 (62.1) 94 (61.4) 138 (90.2) 0 (0.0)
Fig. 1. Profiles of plasmid and Southern hybridization of donors and transconjugants with the intI1 probe. Lanes: M, Escherichia coli V517 molecular marker; A, intI1-positive clinical strain; B, transconjugant; C, hybridization signal of clinical strain; and D, hybridization signal of corresponding transconjugant.
Note: AMP, ampicillin; CTX, cefotaxime; FOX, cefoxitin; CAZ, ceftazidime; FEP, cefepime; NA, nalidixic acid; CIP, ciprofloxacin; LEV, levofloxacin; NOR, norfloxacin; GAT, gatifloxacin; GM, gentamicin; AMK, amikacin; CHL, chloramphenicol; SXT, trimethoprim–sulfamethoxazole; TET, tetracycline; IMP, imipenem.
Table 3. The main antibiotic resistance patterns of Shigella from China. Antibiotic resistance pattern
No. of isolates (%)
AMP-NA-NOR-CHL-SXT-TET-CTX AMP-NA-NOR-CHL-SXT-TET-CTX-CIP-GM AMP-NA-NOR-SXT-TET-GM AMP-NA-NOR-CHL-SXT-TET AMP-CTX-CAZ-FEP-NA-CIP-LEV-GAT-NOR-GM-TET-CHL-SXT
18 (11.8) 9 (5.9) 25 (16.3) 29 (19.0) 7 (4.6)
Note: For definition of antibiotic abbreviations, see Note in Table 2.
firmed with Southern blot hybridization using the DIG Nucleic Acid Detection kit (Roche Applied Science, Mannheim, Germany). The plasmid DNA extracted from E. coli V517 was used as a marker for Southern blot hybridization. Statistical analysis To analyze the relationship between the prevalence of integrase gene and multidrug resistance, the software of SPSS 13.0 for Windows (SPSS Inc., Chicago, Illinois, USA) was used to evaluate the P value of Fisher’s Exact test.
Results A total of 132 S. flexneri isolates showed high levels of resistance to AMP (97.7%), NA (98.5%), NOR (98.5%), and TET (97.0%). Among 19 S. sonnei isolates, high levels of resistance to AMP (78.9%), TET (52.6%), NA (42.1%), and CIP (42.1%) were found (Table 2). Overall, 145 (94.8 %) of the 153 isolates exhibited multiple resistance. A majority of Shigella isolates were resistant to AMP, CHL, and SXT, which are commonly recommended drugs for treatment of shigellosis, as shown in Table 2. The most prevalent antimicrobial resistance patterns were AMP-NA-NOR-CHL-SXT-TET, AMP-NA-NOR-SXT-TET-GM, and AMPNA-NOR-CHL-SXT-TET-CTX, as shown in Table 3. And 3.3%, 24.8%, and 31.4% of the multiresistant isolates were resistant to FOX, CTX, and CIP, respectively. All of the isolates were susceptible to IMP. Of the 153 isolates, 133 (86.9%) isolates harboured class 1 integron and 109 (71.2%) harboured class 2 integron. Of the 144 (94.1%)
isolates positive for either integron, 98 (64.1%) isolates were positive for both class 1 and class 2 integrons, 35 (22.9%) for class 1 integron only, and 11 (7.2%) for class 2 integron only. Nine isolates were absent of all integrons (Table 4). All the strains harbouring class 2 integron or accompanied with class 1 integron were resistant to at least 3 different antibiotics tested. Among the 133 intI1positive isolates, only 22 isolates were positive for the variable region of typical class 1 integron with the primer pair 5=conserved sequence and 3= conserved sequence. The gene cassettes of typical class 1 integrons dfrA17-aadA5, aar-3-aacA4, and dfrA12-orfF-aadA2 were detected in 19 isolates, 2 isolates, and 1 isolate, respectively. A total of 120 isolates were contained gene cassette arrays of blaOXA-1-aadA1. All 109 intI2-positive isolates contained constant gene cassette arrays of dfrA1-sat1-aadA1 (Table 4). There were no isolates positive for intI3 (data not shown). The prevalence of intI1 and intI2 was significantly higher in isolates with multidrug resistance to at least 3 antibiotics than that in isolates with resistance to ≤2 antibiotics (P < 0.05) (Table 5). Among the 153 isolates, 102 (66.7%) contained the blaOXA-1 gene, 35 (22.9%) the blaTEM-1 gene, and 83 (54.2%) the blaCTX-M gene (including blaCTX-M-3, blaCTX-M-15, and blaCTX-M-55). The blaSHV gene was not detected in any isolates. Five Shigella isolates (S12, S21, S43, S120, and S121) positive for both class 1 and class 2 integrons and for PMQR carried 3 or more resistance determinants on the same strain. All 5 isolates also had at least one mutation in gyrA (S83L or D87Y) or parC (S80I) genes, which caused CIP resistance (MICs ≥ 4 g/mL) (Table 6). All of these typical class 1 integron-positive isolates were able to transfer gene cassettes to E. coli J53. Southern hybridization revealed that donors and transconjugants contained plasmids hybridizing with the intI1 probe. The intI1-positive plasmid was about 5.1 kb (Fig. 1). However, the negative results of conjugation experiments suggested that the atypical class 1 integron and the class 2 integron were only present in the chromosomes of these isolates. Published by NRC Research Press
240
Can. J. Microbiol. Vol. 60, 2014
Table 4. Profiles of integrons and gene cassettes in 153 Shigella isolates. Gene cassette Integrase gene
Typical class 1 integron
Atypical class 1 integron
Class 2 integron
Shigella serotype
No. of isolates
intI1
intI2
Both*
None
dfrA17-aadA5
aar-3-aacA4
dfrA12-orfF-aadA2
blaOXA-1-aadA1
dfrA1-sat1-aadA1
S. flexneri S. sonnei S. boydii
132 19 2
119 13 1
91 16 2
85 12 1
7 2 0
17 2 0
2 0 0
1 0 0
107 12 1
91 16 2
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by UNIV OF MANCHESTER on 10/11/14 For personal use only.
*“Both” means isolates contain intI1 and intI2 simultaneously.
Table 5. The profiles of integron-positive and multiresistant Shigella from China. No. of isolates (%) Group
No.
Multiresistant to ≥3 antibiotics
Susceptive to all or resistant to ≤2 antibiotics
Positive for either integron Negative for all integrons Positive for intI1 gene Negative for intI1 gene Positive for intI2 gene Negative for intI2 gene
144 9 133 20 109 44
140 (97.2) 5 (55.6) 131 (98.5) 14 (70.0) 106 (97.2) 39 (88.6)
4 (2.8) 4 (44.4) 2 (1.5) 6 (30.0) 3 (2.8) 5 (11.4)
P* 0.000 0.000 0.044
*Fisher's Exact test.
Table 6. Profile of 5 Shigella isolates positive for both class 1 and class 2 integrons. Mutation in QRDRs
-Lactamase
PMQR Isolate blaCTX-M15 blaOXA-1 blaTEM-1 blaSHV determinants gyrA S12 S21 S43 S120 S121
+ – + + +
+ + – + +
– – – – +
– – – – –
aac(6=)-Ib-cr qepA aac(6=)-Ib-cr qnrS2 qnrS2
parC Methylase Antibiotic resistance pattern
S83L D87Y S80I rmtB S83L S83L S80I S83L S80I rmtB
AMP-CTX-NA-LEV-GAT-GM-TET-CHL-SXT AMP-NA-CIP-LEV-NOR-GM, AMK-TET-CHL-SXT AMP-CTX-NA-TET-SXT AMP-CTX-FEP-NA-CIP-LEV-GAT-NOR-GM-TET-CHL-SXT AMP-CTX-CAZ-FEP-NA-CIP-LEV-GAT-NOR-GM-AMK-TET-CHL-SXT
Note: PMQR, plasmid-mediated quinolone resistance; QRDRs, quinolone-resistance-determining regions. For definition of antibiotic abbreviations, see Note in Table 2.
Discussion Among Shigella isolates, S. flexneri is the major agent that causes bacterial diarrhea in most Asian countries (Kotloff et al. 1999; Choi et al. 2007). Our study also showed that S. flexneri remains the predominant serotype among Shigella strains in Anhui Province. Antimicrobial resistance in Shigella is common nowadays; it is particularly resistant to TET and sulfonamides–trimethoprim (Peirano et al. 2005). However, the resistance rates to AMP, CHL, and NA vary greatly (Jafari et al. 2009; Rosewell et al. 2010). In our study, Shigella isolates had a high prevalence of resistance to all of these commonly used antimicrobial agents. The most frequent antimicrobial resistance pattern was AMP-NA-NOR-CHL-SXT-TET. Our findings illustrated that more than two thirds of Shigella isolates were resistant to at least 6 antimicrobials, which confirmed that these antimicrobial agents are now generally inefficient in the empirical treatment of shigellosis. Shigella had good sensitivity to CIP and CTX in vitro, but the resistance rates were still high in our study in contrast with studies for some other countries (Oh et al. 2003; Rosewell et al. 2010). Although AMP and SXT have been recommended for treating shigellosis in the past, they are currently considered ineffective for empirical therapy (Niyogi 2005). In our study, we found a high prevalence of Shigella isolates with resistance to many kinds of antimicrobials. In China, patients with diarrhea have commonly been treated with antimicrobials by doctors without the result of bacterial culture. In many cases, patients with diarrhea took antimicrobials by themselves before they saw a doctor, regardless of whether the diarrhea was caused by bacteria or virus. Therefore, antibiotic abuse and misuse is very serious.
According to the current study, the observed susceptibility of Shigella isolates to FOX, AMK, third-generation cephalosporins, and IMP indicated that these antibiotics may be the preferred empirical treatment options in Anhui, China. From our findings and that of others (Oh et al. 2003; Peirano et al. 2005; Jafari et al. 2009; Rosewell et al. 2010), we concluded that antimicrobial resistance in Shigella isolates may change over time and along with regions, so continuous surveillance of resistance is necessary, especially in developing countries. The prevalence of integrons found in Shigella varies from country to country. In our study, most Shigella isolates harboured classes 1 or 2 integrons, and class 1 integron was the most frequently detected, which is in keeping with the results of other studies (Dubois et al. 2007; Gassama Sow et al. 2010). However, some reports also revealed that class 2 integron was predominant in some countries (Peirano et al. 2005; Ahmed et al. 2006). The prevalence of class 1 and class 2 integrons in Shigella isolates in Anhui Province was higher than that in previous studies (Dubois et al. 2007). The resistance to antimicrobials in Shigella isolates with class 1 integron and (or) class 2 integron was far more common than that in Shigella isolates without them (P < 0.05). This demonstrates that horizontal gene transfer mediated by integrons contributes to the dissemination of antimicrobial drug resistance in Shigella isolates in Anhui, China. Our results proved that the majority of typical class 1 integrons contained the gene cassette dfrA17-aadA5. In addition, dfr12-orfF-aadA2 was detected in 1 Shigella isolate while arr-3-aacA4 was detected in 2 Shigella isolates. These cassettes have also been reported in different bacterial species worldwide (Chang et al. 2009; Krauland Published by NRC Research Press
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by UNIV OF MANCHESTER on 10/11/14 For personal use only.
Yang et al.
et al. 2009; Zhang et al. 2009). The typical class 1 integron-positive isolates showed higher resistance to CTX and CIP in contrast with class 1 integron-negative ones (P < 0.05). The typical class 1 integron-positive Shigella isolates had a higher incidence of blaTEM compared with atypical class 1 integron- or class 2 integronpositive isolates (P < 0.05). But the reason for this phenomenon is not clear, and thus needs further investigation. Conjugation experiments and Southern hybridization indicated the horizontal transfer of typical class 1 integron through conjugative plasmids. The present study also identified an atypical class 1 integron with an unusual 3= conserved sequence linked to an insertion sequence called IS1, which was first discovered on the chromosome of S. flexneri 2a strain YSH6000 isolated in Japan (Rajakumar et al. 1997). According to the previous report (Rajakumar et al. 1997), the atypical class 1 integron together with CHL and TET resistance determinants were located in the Shigella resistance locus. Our result showed that atypical class 1 integron-positive Shigella isolates had a higher resistance rates to AMP, CHL, and TET (P < 0.05), which also confirmed that the atypical class 1 integron was linked to CHL and TET resistance determinants. Previous studies have proved that class 2 integron was often associated with S. sonnei isolates (Chang et al. 2011). In our study, class 2 integrons were detected in a large quantity of S. flexneri and S. sonnei isolates indiscriminately. The only gene cassette array found in the class 2 integron was dfrA1-sat1-aadA1. Both the class 2 integron and atypical class 1 integron can not be transferred by conjugation. Moreover, the failure of hybridization confirmed their chromosome location, which indicated the transmission of clones carrying class 2 integron and atypical class 1 integron among isolates. The bla genes for TEM, CTX-M, and OXA were also detected in 153 isolates, and all the blaOXA-positive isolates were found to contain gene cassette arrays of blaOXA-1-aadA1. The presence of these resistance genes in combination with integrons may have important clinical implications, which will make the multidrug resistance more serious, as the resistance genes can widely and rapidly distribute within and between species. In our study, 5 Shigella isolates positive for both class 1 and class 2 integrons and for PMQR carried 3 or more resistance determinants on the same strain All 5 isolates had at least 1 mutation in gyrA (S83L or D87Y) or parC (S80I) genes, which caused CIP resistance (MICs ≥ 4 g/mL). So these mechanisms should be explored further to monitor and control antimicrobial resistance. In conclusion, this study demonstrated that multiple antibiotic resistance is common in clinical isolates of Shigella in Anhui, China, especially against widely used therapeutic agents for shigellosis. Multiple antibiotic resistance in the isolates was conferred by class 1 and class 2 integrons and other antimicrobial resistance genes. Therefore, further strengthening of surveillance of antimicrobial resistance in China is urgently needed.
Acknowledgements This study was supported by the Natural Science Foundation of China (Nos. 30972631 and 81172737) and Provincial Natural Science Foundation Key Program of Higher Education of China (Nos. KJ2011A180, KJ2012A177, and KJ2010A344). We are grateful to Huimin Ma, Xue Zhou, Liguang Liu and Xiuying Miao for assistance in antimicrobial susceptibility testing. Authors declare no conflict of interest.
References Ahmed, A.M., Furuta, K., Shimomura, K., Kasama, Y., and Shimamoto, T. 2006. Genetic characterization of multidrug resistance in Shigella spp. from Japan. J. Med. Microbiol. 55: 1685–1691. doi:10.1099/jmm.0.46725-0. PMID:17108272. Bennish, M.L., Salam, M.A., Hossain, M.A., Myaux, J., Khan, E.H., Chakraborty, J., et al. 1992. Antimicrobial resistance of Shigella isolates in Bangladesh, 19831990: increasing frequency of strains multiply resistant to ampicillin, trimethoprim–sulfamethoxazole, and nalidixic acid. J. Infect. Dis. 14: 1055– 1060. doi:10.1093/clinids/14.5.1055. PMID:1600006.
241
Cattoir, V., Poirel, L., Rotimi, V., Soussy, C.J., and Nordmann, P. 2007. Multiplex PCR for detection of plasmid-mediated quinolone resistance qnr genes in ESBL-producing enterobacterial isolates. J. Antimicrob. Chemother. 60: 394– 397. doi:10.1093/jac/dkm204. PMID:17561500. Cavaco, L.M., Hasman, H., Xia, S., and Aarestrup, F.M. 2009. qnrD, a novel gene conferring transferable quinolone resistance in Salmonella enterica serovar Kentucky and Bovismorbificans strains of human origin. Antimicrob. Agents Chemother. 53: 603–608. doi:10.1128/AAC.00997-08. PMID:19029321. Chang, C.Y., Fang, Y.T., Tsai, S.M., Chang, L.L., and Yu, W.L. 2009. Characterization of class 1 integrons and gene cassettes in clinical isolates of Klebsiella pneumoniae from Taiwan. Diagn. Microbiol. Infect. Dis. 65: 214–216. doi:10. 1016/j.diagmicrobio.2009.06.005. PMID:19748438. Chang, C.Y., Lu, P.L., Lin, C.C., Lee, T.M., Tsai, M.Y., and Chang, L.L. 2011. Integron types, gene cassettes, antimicrobial resistance genes and plasmids of Shigella sonnei isolates from outbreaks and sporadic cases in Taiwan. J. Med. Microbiol. 60: 197–204. doi:10.1099/jmm.0.022517-0. PMID:20947666. Choi, S.Y., Jeon, Y.S., Lee, J.H., Choi, B., Moon, S.H., von Seidlein, L., et al. 2007. Multilocus sequence typing analysis of Shigella flexneri isolates collected in Asian countries. J. Med. Microbiol. 56: 1460–1466. doi:10.1099/jmm.0.47322-0. PMID:17965345. Clinical and Laboratory Standards Institute. 2012. Performance Standards for Antimicrobial Susceptibility Testing; Nineteenth Information Supplement. M100-S22. CLSI, Wayne, Penn., USA. Dallenne, C., Da Costa, A., Decré, D., Favier, C., and Arlet, G. 2010. Development of a set of multiplex PCR assays for the detection of genes encoding important -lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 65: 490– 495. doi:10.1093/jac/dkp498. PMID:20071363. Doi, Y., and Arakawa, Y. 2007. 16S ribosomal RNA methylation: emerging resistance mechanism against aminoglycosides. Clin. Infect. Dis. 45: 88–94. doi: 10.1086/518605. PMID:17554708. Dubois, V., Parizano, M.P., Arpin, C., Coulange, L., Bezian, M.C., and Quentin, C. 2007. High genetic stability of integrons in clinical isolates of Shigella spp. of worldwide origin. Antimicrob. Agents Chemother. 51: 1333–1340. doi:10.1128/ AAC.01109-06. PMID:17242143. Dutta, S., Kawamura, Y., Ezaki, T., Nair, G.B., Lida, K., and Yoshida, S. 2005. Alteration in the GyrA subunit of DNA gyrase and the ParC subunit of topoisomerase IV in quinolone-resistant Shigella dysenteriae serotype I clinical isolates from Kolkata, India. Antimicrob. Agents Chemother. 49: 1660–1661. doi:10.1128/AAC.49.4.1660-1661.2005. PMID:15793166. Gassama Sow, A., Aïdara-Kane, A., Barraud, O., Gatet, M., Denis, F., and Ploy, M.C. 2010. High prevalence of trimethoprim-resistance cassettes in class 1 and 2 integrons in Senegalese Shigella isolates. J. Infect. Dev. Counttries, 4: 207–212. doi:10.3855/jidc.583. PMID:20440057. Goldstein, C., Lee, M.D., Sanchez, S., Hudson, C., Phillips, B., Register, B., et al. 2001. Incidence of class 1 and 2 integrases in clinical and commensal bacteria from livestock, companion animals and exotics. Antimicrob. Agents Chemother. 45: 723–726. doi:10.1128/AAC.45.3.723-726.2001. PMID:11181350. Hall, R.M., and Collis, C.M. 1995. Mobile gene cassettes and integrons: capture and spread of genes by site-specific recombination. Mol. Microbiol. 15: 593– 600. doi:10.1111/j.1365-2958.1995.tb02368.x. PMID:7783631. Hu, L.F., Chang, X., Ye, Y., Wang, Z.X., Shao, Y.B., Shi, W., et al. 2011. Stenotrophomonas maltophilia resistance to trimethoprim/sulfamethoxazole mediated by acquisition of sul and dfrA genes in a plasmid-mediated class 1 integron. Int. J. Antimicrob. Agents, 37: 230–234. doi:10.1016/j.ijantimicag.2010.10.025. PMID: 21296557. Jafari, F., Hamidian, M., Rezadehbashi, M., Doyle, M., Salmanzadeh-Ahrabi, S., Derakhshan, F., and Reza Zali, M. 2009. Prevalence and antimicrobial resistance of diarrheagenic Escherichia coli and Shigella species associated with acute diarrhea in Tehran, Iran. Can. J. Infect. Dis. Med. Microbiol. 20: e56– e62. PMID:20808457. Kotloff, K.L., Winickoff, J.P., Ivanoff, B., Clemens, J.D., Swerdlow, D.L., Sansonetti, P.J., et al. 1999. Global burden of Shigella infections: implications for vaccine development and implementation of control strategies. Bull. W. H. O. 77: 651–666. PMID:10516787. Krauland, M.G., Marsh, J.W., Paterson, D.L., and Harrison, L.H. 2009. Integronmediated multidrug resistance in a global collection of nontyphoidal Salmonella enterica isolates. Emerg. Infect. Dis. 15: 388–396. doi:10.3201/eid1503. 081131. PMID:19239750. Niyogi, S.K. 2005. Shigellosis. J. Microbiol. 43: 133–143. PMID:15880088. Oh, J.Y., Yu, H.S., Kim, S.K., Seol, S.Y., Cho, D.T., and Lee, J.C. 2003. Changes in patterns of antimicrobial susceptibility and integron carriage among Shigella sonnei isolates from southwestern Korea during epidemic periods. J. Clin. Microbiol. 41: 421–423. doi:10.1128/JCM.41.1.421-423.2003. PMID:12517883. Peirano, G., Agersø, Y., Aarestrup, F.M., and dos Prazeres Rodrigues, D. 2005. Occurrence of integrons and resistance genes among sulphonamideresistant Shigella spp. from Brazil. J. Antimicrob. Chemother. 55: 301–305. doi:10. 1093/jac/dki012. PMID:15681578. Rajakumar, K., Bulach, D., Davies, J., Ambrose, L., Sasakawa, C., and Adler, B. 1997. Identification of a chromosomal Shigella flexneri multi-antibiotic resistance locus which shares sequence and organizational similarity with the resistance region of the plasmid NR1. Plasmid, 37: 159–168. doi:10.1006/plas. 1997.1280. PMID:9200219. Rosewell, A., Ropa, B., Posanai, E., Dutta, S.R., Mola, G., Zwi, A., and Published by NRC Research Press
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by UNIV OF MANCHESTER on 10/11/14 For personal use only.
242
MacIntyre, C.R. 2010. Shigella spp. antimicrobial drug resistance, Papua New Guinea, 2000-2009. Emerg. Infect. Dis. 16: 1797–1799. doi:10.3201/eid1611. 101025. PMID:21029550. Sabaté, M., and Prats, G. 2002. Structure and function of integrons. Enferm. Infecc. Microbiol. Clin. 20: 341–345. doi:10.1016/S0213-005X(02)72813-9. PMID: 12237001. Wang, M., Tran, J.H., Jacoby, G.A., Zhang, Y.Y., Wang, F., and Hooper, D.C. 2003. Plasmid-mediated quinolone resistance in clinical isolates of Escherichia coli from Shanghai, China. Antimicrob. Agents Chemother. 47: 2242–2248. doi: 10.1128/AAC.47.7.2242-2248.2003. PMID:12821475. Wang, M., Guo, Q., Xu, X., Wang, X., Ye, X., Wu, S., et al. 2009. New plasmidmediated quinolone resistance gene, qnrC, found in a clinical isolate of Proteus mirabilis. Antimicrob. Agents Chemother. 53:1892–1897. doi:10.1128/ AAC.01400-08. PMID:19258263. Wang, X.Y., Tao, F, Xiao, D., Lee, H., Deen, J., Gong, J., et al. 2006. Trend and
Can. J. Microbiol. Vol. 60, 2014
disease burden of bacillary dysentery in China (1991-2000). Bull. W.H.O. 84: 561–568. doi:10.2471/BLT.05.023853. PMID:16878230. White, P.A., McIver, C.J., and Rawlinson, W.D. 2001. Integrons and gene cassettes in the Enterobacteriaceae. Antimicrob. Agents Chemother. 45: 2658–2661. doi: 10.1128/AAC.45.9.2658-2661.2001. PMID:11502548. Xiong, Z., Wang, P., Wei, Y., Wang, H., Cao, H., Huang, H., and Li, J. 2008. Investigation of qnr and aac(6=)-Ib-cr in Enterobacter cloacae isolates from Anhui Province, China. Diagn. Microbiol. Infect. Dis. 62: 457–459. doi:10.1016/j. diagmicrobio.2008.07.010. PMID:18814992. Yamane, K., Wachino, J., Suzuki, S., Kimura, K., Shibata, N., Kato, H., et al. 2007. New plasmid-mediated fluoroquinolone efflux pump, QepA, found in an Escherichia coli clinical isolate. Antimicrob. Agents Chemother. 51: 3354–3360. doi:10.1128/AAC.00339-07. PMID:17548499. Zhang, X.Y., Ding, L.J., and Yue, J. 2009. Occurrence and characteristics of class 1 and class 2 integrons in resistant Escherichia coli isolates from animals and farm workers in northeastern China. Microb. Drug Resist. 15: 323–328. doi: 10.1089/mdr.2009.0020. PMID:19857140.
Published by NRC Research Press
