Nucleic Acids Research, Vol. 20, No. 17 4457-4464

Antisense probes targeted to an internal domain in U2 snRNP specifically inhibit the second step of pre-mRNA splicing Silvia M.L.Barabino+, Brian S.Sproat and Angus l.Lamond* European Molecular Biology Laboratory, Meyerhofstrasse 1, Postfach 102209, D-6900 Heidelberg, Germany Received June 15, 1992; Revised and Accepted August 14, 1992

ABSTRACT Functional domains within the mammalian U2 snRNP particle that are required for pre-mRNA splicing have been analysed using antisense oligonucleotides. A comparison of the melting temperatures of duplexes formed between RNA and different types of antisense oligonucleotides has demonstrated that the most stable hybrids are formed with probes made of 2'-0-allyl RNA incorporating the modified base 2-aminoadenine. We have therefore used these 2'-0-allyl probes to target sequences within the central domain of U2 snRNA. Overlapping biotinylated 2'-0-allyloligoribonucleotides complementary to the stem loop Ila region of U2 snRNA (nucleotides 54 72) specifically affinity selected U2 snRNA from HeLa nuclear extracts. These probes inhibited mRNA production in an in vitro splicing assay and caused a concomitant accumulation of splicing intermediates. Little or no inhibition of spliceosome assembly and 5' splice site cleavage was observed for all pre-mRNAs tested, indicating that the oligonucleotides were specifically inhibiting exon ligation. This effect was most striking with a 2'-0allyloligoribonucleotide complementary to U2 snRNA nucleotides 57 68. These results provide evidence for a functional requirement for U2 snRNP in the splicing mechanism occurring after spliceosome assembly. -

-

INTRODUCTION In vitro studies using nuclear extracts from HeLa cells have shown that spliceosomes are composed of multiple small nuclear ribonucleoprotein particles (snRNPs), specifically U1, U2, U5 and U4/U6 snRNPs (for reviews see 1-4). Non-snRNP protein factors, including hnRNP proteins (5, 6), snRNP accessory factors (7-11), intron binding proteins (12-16) and other factors (17-22) are also required for spliceosome assembly and/or splicing. Similar studies in the budding yeast Saccharomyces cerevisiae have shown that the U 1, U2, U4/U6 and U5 snRNP homologues are sub-units of yeast spliceosomes and have *

To whom correspondence should be addressed

+ Present address: DIBIT H S.Raffaele, via Olgettina 60, 20132 Milan,

Italy

identified genes encoding other non-snRNP splicing factors (reviewed by 23). In both mammalian and yeast systems the assembly of functional spliceosomes involves a stepwise pathway of snRNP (and probably protein) binding to pre-mRNA substrates (24-29). Each of the Ul, U2, U4/U6 and U5 snRNPs are essential for splicing activity in vitro. In the mammalian system this has been demonstrated by inhibition of splicing with anti-snRNP antibodies (30), by cleavage of snRNAs with RNaseH in the presence of complementary oligodeoxyribonucleotides (31-35) and more recently by antisense inhibition (36, 37, 38) or affinity depletion (39, 40, 41) using 2'-O-alkyl oligoribonucleotides. In the yeast system, oligodeoxyribonucleotide-targeted RNaseH cleavage has also been used to study snRNP function in vitro (42, 43, 44). In addition, genetic depletion strategies have been employed to prepare in vitro splicing extracts depleted for individual snRNPs (45, 46). Data from the mammalian and yeast systems are in good general agreement and show that inactivation or depletion of the separate snRNP particles blocks spliceosome formation at different stages. From these studies it appears that Ul and U2 snRNPs interact with pre-mRNA before U4, U5 and U6, which probably bind later as a preformed triple snRNP (27, 28). The U2 snRNP has been shown to have at least two functional domains which are required for distinct steps in the assembly pathway (38, 47-50). Perturbation of one of these domains prevents stable binding of U2snRNP to pre-mRNA while perturbation of the other domain allows pre-splicing complex formation but prevents formation of an active spliceosome. The use of antisense probes offers an important way in which to study snRNP:snRNP and snRNP:pre-mRNA interactions that occur during RNA processing. As discussed above, the functions of separate domains within snRNP particles can be addressed using nuclease-resistant antisense oligonucleotides made of either 2'-O-alkyl RNA or modified DNA (36, 37, 38, 41, 51, 52). The stability with which these different types of nucleic acid probes hybridise to complementary RNA sequences will affect their effectiveness as antisense probes. We have recently shown that oligonucleotides made of the nuclease resistant, 2'-O-allyl RNA,

4458 Nucleic Acids Research, Vol. 20, No. 17 which carry a three carbon alkoxy ether at each ribose moiety in the polynucleotide chain, can bind stably to complementary sequences in snRNAs (53). At the same time the presence of the bulky three carbon chain allyl group on the ribose significantly inhibits protein binding to these modified oligoribonucleotides. The thermal stability of hybrids formed with complementary RNA sequences can be further increased by substituting adenosine residues by 2-aminoadenosine in the 2'-O-allyl antisense probes (40).The base 2-aminoadenine forms three rather than two Hbonds to uridine on the complementary RNA strand. In this paper, we analyse a new set of 2-aminoadenosine containing 2'-O-allyloligoribonucleotides targeted to an internal region in U2 snRNA. Certain probes targeted to the stem Ila region of U2 are found to specifically block the conversion of splicing intermediates to products without inhibiting spliceosome assembly or 5' splice site cleavage. The results indicate a functional requirement for U2 snRNP at multiple steps in the splicing mechanism.

MATERIALS AND METHODS Materials HeLa cells used to prepare nuclear extracts were purchased from the Computer Cell Culture Centre (Mons, Belgium). a-(32p) UTP (20 mCi/ml) was purchased from Amersham. T3 RNA polymerase was purchased from Stratagene, and restriction enzymes from New England Biolabs. RNAsin was purchased from Promega. AMTV reverse transcriptase was purchased from Boehringer Mannheim. Oligonucleotide Synthesis Biotinylated and non-biotinyated 2'-O-allyloligoribonucleotides and all oligodeoxyribonucleotides were synthesized using an Applied Biosystems DNA synthesizer as described in 54. Multiple bioinylation was performed during the solid phase synthesis (55). The oligonucleotides carried tandem biotin residues at either one or both termini. The sequences of the 2'-O-allyloligoribonucleotides used for the antisense inhibition studies were (5' to 3'): A:CCAAAAGGCCGAGAAGCGAU B:AACAGAUACUACACUUG D: AGA*UA*UUA*AACU E: GUA*UCAGAUA*UU F:GACGUA*UCAGA*U G:AGAGGACGUA*U H: GGAUA*GAGGACG I:CCUA*UUCCA*UCU J: AGCA*AGCUCCUA*

The sequences of the oligonucleotides used for the thermal denaturation curves were (5' to 3'): 1. UGGAUAAGCCUC 2. 2'-O-allyl[UGGAUAAGCCUC] 3. 2'-O-aIIyI[UGGA* UA*A* GCCUC] 4. GAGGCUUAUCCA 5. d[GAGGCTTATCCA] A* represents 2-aminoadenosine.

Thermal denaturation curves for oligonucleotide duplexes were measured on a thermostated Cary UV/VIS. spectrophotometer equipped with a multicuvette rotater in 100 mM KCl, 10 mM Tris-HCl and 1 mM EDTA pH 7.0 using 3 mM of each strand.

Affinity selection and RNase H cleavage Antisense affinity selection assays were done as previously described (36,37). RNase H cleavage assays were performed

basically as described in 33. Incubation was for 1 hour at 30°C in a total reaction volume of 1001l. The oligodeoxyribonucleotides used were; 1. (U2 nucs 25-47) d[ATAAGAACAGATACTACACTTGA] 2. (U2 nucs 55-71) d[GAGGACGTATCAGATAT]

HeLa Cell Nuclear Extracts & Splicing Assays HeLa cell nuclear extracts were prepared essentially as described in 56, but with the changes described in 39. Splicing assays were done using uniformally labeled, capped pre-mRNAs incubated with nuclear extracts under our standard in vitro splicing conditions (57). Adeno pre-mRNA was transcribed from Sau3A-digested plasmid pBSAdl (28). Globin pre-mRNA was transcribed from Eco RI-digested plasmid pBSGlol (40). Fushi tarazu pre-mRNA was transcribed from Xho I-digested pGemV61 (59). For primer extension large scale splicing reactions were set up using about 100 fmoles of cold pre-mRNA in 20pil total reaction volume. Splicing products were separated on 10% polyacrylamide/8M urea denaturing gels, run in 1 xTBE, and splicing and snRNP complexes on non-denaturing agarose-polyacrylamide composite gels, as described in 38. Primer extension analysis Primer (about 50000 cpm) was mixed with spliced Adeno RNA in hybridization buffer (0.3M NaCl, 10mM Tris HCl pH7.5, 2mM EDTA) in 10AlO total reaction volume, heated at 80°C for 5 min and hybridized for 1.5 hours at 50°C. To the reactions 401il of 1.25x reverse transcriptase buffer (1.25mM dNTPs, 1.25mM DTT, 12.5mM Tris HCl pH8.4, 7.5mM MgC92) and 12.5 units AMTV reverse transcriptase were added. The samples were incubated for 45 minutes at 50°C. After addition of lyl 0.5 M EDTA and 6kd 1 M NaOH the reaction were incubated for 1 hour at 55°C. The samples were then precipitated by adding 6,il HCl, 6.5d1 NH4OAc and 140pi ethanol. Primer extension products were analysed on a 7% polyacrylamide-8 M urea denaturing gel.

RESULTS Thermal stability of oligonucleotide hybrids To evaluate the relative duplex stability of the recently developed 2'-O-allyloligoribonucleotide probes (53) we have compared the thermal stabilities of hybrids formed between RNA target sequences and DNA, RNA or 2'-O-allyl antisense oligonucleotides (Figl). Both RNA (curve 1) and the 2'-O-allyl modified oligoribonucleotides (curves 2 & 3) form more stable hybrids with complementary RNA than does an oligodeoxyribonucleotide (curve 4). The RNA:2'-O-allyl RNA hybrid is slightly more stable than the corresponding RNA:RNA hybrid (cf. curves 1 & 2). However, the presence of the modified base 2-aminoadenine in the antisense 2'-O-allyl oligoribonucleotide further increases stability (curve 3), resulting in a duplex with a Tm almost 10°C higher than that of RNA:RNA

under the assay conditions used.

Antisense probes targeted against U2 snRNP As the 2'-O-allyloligoribonucleotides form extremely stable

hybrids with complemetary RNA sequences, they may reveal new functional domains in snRNPs by binding to snRNA sequences that are too short to form stable hybrids with other types of antisense probe. Biotinylated 2 '-O-allyloligoribonucleotides

Nucleic Acids Research, Vol. 20, No. 17 4459 from earlier studies (36, 39), both the A and B oligonucleotides inhibited splicing (Fig. 3, lanes 1&2). A strong inhibition of splicing was also seen with oligonucleotide H (Fig. 3, lane 7). A parallel analysis of spliceosome assembly revealed that oligonucleotide H inhibited U2 binding to pre-mRNA and prevented A complex formation (data not shown). This probe has not been analysed further. None of the other oligonucleotides completely inhibited splicing. However, in comparison with the no oligonucleotide control, several probes, in particular the E, F and G oligonucleotides, decreased the amount of mRNA product formed relative to splicing intermediates (Fig. 3, compare lane 10 with lanes 4, 5&6). To determine whether these probes bound specifically to U2 snRNP, affinity selection assays were done with the biotinylated D, E, F and G oligonucleotides (Fig. 4). Each oligonucleotide was incubated in HeLa nuclear extract and the bound snRNPs isolated by affinity chromatohraphy on streptavidin agarose (36,37). This shows that all four probes targeted to the stem IIa region specifically select U2, but not other splicing snRNAs (Fig. 4A, lanes 2-5). However, some difference is observed in the relative efficiencies with which the different oligonucleotides select U2. The F oligonucleotide shows the lowest level of selection and also is highly sensitive to the position of attachment of biotin to the probe. A similar position effect of biotin was previously seen with the U2 B oligonucleotide (36). This probably results from steric interference of snRNP proteins affecting the interaction of biotin with streptavidin on the affinity matrix. To confirm that the region targeted by the F oligonucleotide was accessible, an RNAse H cleavage assay was also performed using an oligodeoxyribonucleotide spanning the U2 snRNA sequence from nucleotides 55-71 (Fig. 4B). This showed specific cleavage of U2 snRNA in the F region (Fig. 4B, lane 3). As expected, the efficiency of cleavage at this site was less than for oligodeoxyribonucleotide-directed RNaseH cleavage at the branch site complementary region of U2 snRNA (Fig. 4B, cf. lanes 2&3). To extend the comparison of antisense probes targeted to different regions of U2 snRNA, the effects of the A, B and F

complementary to different regions of mammalian U2 snRNA were therefore synthesised (Fig. 2). Antisense probes made of 2'-O-methyl RNA have previously been shown to bind to regions A and B of U2 snRNA, but not to region C (36, 39, cf. Fig. 1). The regions defined here as D, E, F, G, H, I and J have not previously been targeted using 2'-O-alkyloligoribonucleotides.

Oligonucleotides complementary to U2 snRNA can affect different steps in the splicing mechanism To test the effect of the anti-U2 snRNA probes shown in Figure 2, in vitro splicing assays were done using HeLa nuclear extracts which had been pre-incubated with oligonucleotides A, B, D, E, F, G, H, I and J (Fig. 3, lanes 1-9). As expected Absorbance

-2

-3

Figure 1. Thermal denaturation curves for oligonucleotide duplexes. Denaturation curves are shown for 12 base pair duplexes of; 1. RNA:RNA, 2. RNA:2'-Oallyl RNA, 3. RNA:2'-O-allyl RNA containing 2-aminoadenosine and 4. RNA:DNA. The Tm values obtained were; 1. 56.6°C, 2. 57.3°C, 3. 66.4°C and 4. 45.0°C. For experimental details see Materials and Methods.

J

IC

U2 uu

A

i

-

E~~A

A D C-G U G-CU G-c G-U A-U A C G

G

G-CE A-U G C C

G -U

-C

0

100

G -C u -A A -C

C

-U

C-G

G--C

BA

capG AUCGCUU - AUCAAGUGUAGUAUCUGUUCUU

I IG

AAAUAUUAAAU

UA

UUUUGGAGCAG A

U GCAUCG CCUGG

66A&6 AC6U AC AAU CA OHC

A

G

H Figure 2. Secondary structure of mammalian U2 snRNA according to 68 and 78. The regions targeted by 2'-O-allyloligoribonucleotides are indicated by solid bars.

4460 Nucleic Acids Research, Vol. 20, No. 17 .~a lo

0*4

.4~..

4~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~.i:

0

wiw

4~ ~~§-^..

-.4

A*

v

:, tw

Figure 4. Affinity selection and RNaseH cleavage of U2 snRNP in the stemIla region. A. snRNAs affinity selected by biotinylated antisense oligonucleotides targeted to the stemlla region of U2 snRNA. RNAs were affinity selected by the D,E,F&G oligonucleotides as described by Barabino et al., (1989), separated on a 10% denaturing polyacrylamide gel and analysed by northern hybridisation using probes complementary to each of the 5 spliceosomal snRNAs. Marker lane

ow wo

4

LJ

splicingactivit. Splig Figure 3. Effect of antisense oligonucleotidi acivity. Splictwing qts on spLcng Adenn nre-mRNA after nreinruh: wac tected r%UvIIvJ yl-illWa3 *IZwbLC assLWltil Ul llWa llU%,lVal C;Atla%,t PIV,111tuuatLIILYL the indicated oligonucleotides (lanes 1 to 9). The lane labelled 'Ctrl' corresponds to a splicing reaction carried out in the absence of oligonucleotide (lane 10). Oligonucleotides were used at the following final concentrations; A&G 2.5pmol/Al, B 1.25pmol/yd and D,E,F,H,I & J 7.5pmol/Ad. Splicing intermediates and products were analysed on a 10% denaturing polyacrylamide gel. Size markers are endlabelled Mspl fragments of pBR322 and unprocessed pre-mRNA. es on

o

oligonucleotides on both splicing and spliceosome assembly were analysed in parallel (Fig. 5). As before, the A and B oligonucleotides strongly inhibited splicing (Fig. SA, lanes 2&3) while the F oligonucleotide caused an accumulation of splicing intermediates relative to the no oligonucleotide control (Fig. SA, cf. lanes 1&4). Analysis of splicing complexes shows that oligonucleotide F did not block spliceosome assembly but produced an accumulation of the spliceosome B complex (Fig. SB, lane 4). In contrast, the A and B oligonucleotides both inhibit B complex formation (Fig. SB, lanes 2&3). Consistent with our previous studies using 2'-O-methyl RNA probes (36,39), oligonucleotide A causes accumulation of the A complex while oligonucleotide B blocks stable binding of U2 snRNP to the premRNA. These data indicate that the anti-U2 snRNA F oligonucleotide is inhibiting miRNA production after spliceosome assembly and formation of the splicing intermediates. Oligonucleotide F blocks the conversion of splicing intermediates to products To investigate whether the accumulation of splicing intermediates in the presence of the F oligonucleotide was a specific effect, pre-mRNA splicing was tested at increasing oligonucleotide F concentrations up to 12.5 pmoles/ul (Fig. 6, A&B). The RNA intermediates and products of the splicing reaction were analysed by denaturing gel electrophoresis (Fig 6A) and the relative amounts of splicing intermediates and products formed were also quantitated for each oligonucleotide concentration (Fig 6B). These data show that there is a progressive decrease in the level of

corresponds to unselected total HeLa nuclear RNA. Lane 1 shows the level of RNA selected in the absence of oligonucleotide. The oligonucleotides were each used at a final concentration of lpmol/Il. B. Deoxyoligoribonucleotide-directed RNaseH cleavage of U2 snRNA. U2 snRNA was cleaved with RNaseH either in the absence of any complementary oligonucleotide (lane 1) or in the presence of deoxyoligoribonucleotides complementary to U2 snRNA nucleotides 25-47 (lane 2) and 55-71 (lane 3). Cleavage products were separated on a 10% denaturing polyacrylamide gel and analysed by northern hybridisation using a U2-specific probe (Lamond et al., 1989). Markers are 5'-end-labeled DNA fragments generated by MspI cleavage of plasmid pBR322. The cleavage products of U2 snRNA are indicated by arrows.

-

~

~

~~-

a

_

4

Om

im

F

Figure 5. Inhibition of splicing activity and splicing complex formation by antisense oligonucleotides. Splicing intermediates and products were separated on a 10% polyacrylamide gel (panel A) and splicing complexes on a nondenaturing agarosepolyacrylamide composite gel (panel B). In both panels, lanes 2 to 4 correspond to standard splicing assays preincubated with oligonucleotides A (lane 2), B (lane 3) and F (lane 4). Lanes marked 'ctrl' correspond to splicing reactions carried out in the absence of oligonucleotide. The oligonucleotides were used at the following final concentrations, A 7.5pmol/Al. B 5pmol/yl. and F lOpmol/ltl.

mRNA and intron product formed with addition of increasing oligonucleotide F, while the levels of splicing intermediates increase in parallel. Note that even at the highest concentration of oligonucleotide F there is little change in the amounts of

Nucleic Acids Research, Vol. 20, No. 17 4461

A

Oligonucleotide

Oligonucleotide

Time (min)

Concentration

10 20 30 45 60sO0

19

u-u., -

"W W.

ww:m

.4 -49

Os-. C._:

10 20 30 45 60so0

1

-

_..

-

MO__1

_\

E

(E_,

a

fl.

Ea

a,

0

itq

IAd

s

4k.

4W

.

1 2 3 4

B

5

.. 4

_

6

Figure 7. Comparison of antisense inhibition for different pre-mRNA substrates. Splicing of adeno and ,B-globin pre-mRNA was tested either in the absence (lane 1) or in the presence of oligonucleotide F (lane 2). The oligonucleotide was used at a final concentration of lOpmol/pl. For both substrate RNAs, splicing intermediates and products were analysed on denaturing polyacrylamide gels.

100%

80%

1 st

80%

step

70%

Relative

Splicing Activity (%)

60% 50% 40%t

30%

2nd step

20% 10% 0.00

spliceosome assembly also shows oligonucleotide F causes little reduction in the rates of A and B complex formation (data not shown). In the presence or absence of oligonucleotide F, splicing intermediates are first detected after approximately 20 minutes. However, in the absence of oligonucleotide F splicing products are detected after 30 minutes and rapidly accumulate while in the presence of oligonucleotide F splicing products are seen only after 45 minutes incubation and remain at very low levels thereafter. From these data we conclude that oligonucleotide F specifically inhibits the second step of the splicing mechanism. As all the previous in vitro splicing experiments were done using the same adenovirus pre-mRNA substrate, the effect of oligonucleotide F on the splicing of other pre-mRNAs was also analysed (Fig. 8). An accumulation of splicing intermediates in extracts incubated with the F oligonucleotide was observed with a transcript containing the second intron of rabbit f-globin premRNA (Fig. 8, cf. lanes 3&4). Similarly, a transcript from the Drosophilajiishi tarazu gene, which is spliced efficiently in HeLa nuclear extracts (59), also showed an accumulation of splicing intermediates (data not shown). Parallel analysis of adenovirus and j3-globin substrates in HeLa nuclear extract incubated with the same amount of oligonucleotide F showed that both premRNAs were similarly affected and showed comparable levels of accumulation of the splicing intermediates (Fig. 8, cf. lanes 2&4). These results show that the oligonucleotide-mediated inhibition of the second step of the splicing reaction affects three separate pre-mRNAs which each have different exon and intron lengths and different primary sequences. The data are consistent with the effect of oligonucleotide F arising from perturbation of a common trans-acting component of the splicing apparatus. The simplest interpretation is that the effect of the antisense oligonucleotide is caused by its binding to the complementary or no

2.50

5.00

7.50

10.00

12.50

Concentration of Oligonucleotide F (pmol/uil)

Figure 6. Oligonucleotide U2F specifically inhibits the second step of splicing. Panel A: Standard splicing assays were incubated with increasing concentrations of oligonucleotide F: lane 1: 0 pmol/Al; lane 2: 2.5 pmol/ll; lane 3: 5 pmol/jJ; lane 4 : 7.5 pmol/yl; lane 5: 10 pmol/lA; lane 6: 12.5 pmol/pl. Panel B: The relative splicing activity for the first and the second step of splicing is reported in the plot as a function of the concentration of the oligonucleotide. Quantative analyses of the gels was carried out by using a Molecular Dynamics Phosphor Imager. Volume integration was used to estimate the amount of radioactivity in the bands corresponding to intermediates and products of the reaction. The relative splicing activity for the second step was obtained by measuring the amount of lariat intermediate that is converted into the lariat product.

level of unspliced RNA remaining but rather a striking increase in the ratio of splicing intermediates to products as compared with the no oligonucleotide control (Fig. 6A, cf. lanes 1&6). The accumulation of splicing intermediates caused by oligonucleotide F could result either from a specific inhibition of the second step of the splicing reaction or from a general decrease in the rate of splicing which also affects spliceosome assembly and 5' splice site cleavage. To distinguish between these alternatives the kinetics of splicing were analysed in the presence and absence of oligonucleotide F (Fig. 7). The results show that there is little or no effect of oligonucleotide F on the rate of 5' splice site cleavage. A parallel analysis of the kinetics of

sequence on

U2 snRNA.

4462 Nucleic Acids Research, Vol. 20, No. 17 *`?Glour'

Adeno *,. )|I

M

rI e

'tid (-4 ,Z

...

.4

_

a .-..

4'

.4

t as

_

a

*

...

-mg

0 -40

-

a

1*

Figure 8. Rate of 5' splice site cleavage is not affected by oligonucleotide F. The kinetics of splicing were assayed either in the presence (lanes 1 to 6) or in the absence (lanes 7 to 12) of oligonucleotide F. The oligonucleotide was used at a final concentration of lOpmol/yl. Reactions using Adeno pre-mRNA were incubate under standard splicing conditions either with or without oligonucleotide F. Samples were taken at the time points indicated.

0

w**40 Accumulation of splicing internediates is not caused by aberrant branch site selection Previous studies have shown that certain mutations at either the 5' splice site or branch site of pre-mRNAs block the second step of the splicing reaction and cause an accumulation of splicing intermediates (60, 61, 62). As U2 snRNP binds at the branch site and base pairs with the pre-mRNA (63, 64, 65), selection of an ectopic branch site could explain the effect of oligonucleotide F if its binding to U2 snRNA perturbed the fidelity of branch site recognition. Primer extension assays were therefore carried out to determine whether oligonucleotide F affected the site of branch formation (Fig. 9). This confirmed that the level of lariat intermediate to mRNA product was increased by oligonucleotide F. However, the site of branch formation is the same in the presence or absence of oligonucleotide F. We conclude that the splicing intermediates which accumulate in the presence of oligonucleotide F have not formed abberant branch sites.

DISCUSSION Overlapping 2'-O-allyloligoribonucleotide probes targeted to different regions of U2 snRNA have revealed a domain located approximately between nucleotides 54-72 which may play a role specifically in the second step of the splicing mechanism. This effect was most pronounced with an oligonucleotide complementary to nucleotides 57-68 in U2 snRNA (cf. Fig 2). Addition of this oligonucleotide to a HeLa nuclear extract caused an accumulation of splicing intermediates for all three pre-mRNA substrates tested. This effect was also observed with several independent syntheses of these oligonucleotides. While we have previously studied a large number of antisense probes

Figure 9. Primer extension analysis of splicing intermediates and products. A 5' 32P-labelled oligodeoxyribonucleotide primer was hybridized to the RNA extracted from an in vitro splicing reaction performed either in the absence (lane 2) or in the presence of oligonucleotide F (lane 3). The primer was then extended and the cDNA products were analysed on a 7% denaturing polyacrylamide gel. In the diagram, the position of the primer within the transcription unit is shown as a solid line. The length of the expected cDNA products are also indicated. The DNA oligonucleotide primer is complementary to positions 325 to 341 in the Adeno pre-mRNA. Size markers are end-labelled Mspl fragments of pBR322 (lane 'Mrks'). Lane I shows the cDNA products obtained with unspliced pre-mRNA.

complementary to multiple regions within each of the spliceosomal snRNAs, and to both intron and exon sequences of pre-mRNAs, only the oligonucleotides analysed here, targeted to the region between nucleotides 54-72 in U2 snRNA, specifically affect the second step of splicing. This suggests a

Nucleic Acids Research, Vol. 20, No. 17 4463 role for U2 snRNP in the splicing mechanism subsequent to spliceosome assembly and 5' splice site cleavage. Previous studies have shown that splicing can be inhibited by specific deletion of, or mutation in, U2 snRNA (46, 50, 66,), by oligodeoxyribonucleotide-directed RNase H cleavage of U2 (32, 33, 35, 43, 44) or by antisense inhibition (36, 38, 51). In these cases, however, the splicing inhibition correlated with an inhibition of either U2 binding to pre-mRNA or subsequent steps in spliceosome assembly that precede 5' splice site cleavage. For example, in HeLa splicing extracts, an antisense 2'-Oalkyloligoribonucleotide targeted to the 5' terminus of U2 snRNA allows U2 to bind pre-mRNA and form a pre-splicing 'A' complex, but blocks the subsequent stable binding of U4/U5/U6 snRNPs (38 cf. this work Fig. 5). This 5' terminal region of U2 snRNA has recently been shown to interact by base pairing with a complementary sequence in U6 snRNA (65, 67). Based on these data and the observation that U2 snRNA base pairs with the branch site region of the pre-mRNA which must be recognised for the first step of splicing, it has not been clear whether U2 snRNP is functionally required for later stages of the splicing mechanism. The effect of the 2'-O-allyloligoribonucleotides shown here argues in favour of U2 being required also for exon ligation. There is a significant level of phylogenetic conservation in the primary sequence of U2 snRNA between nucleotides 62-67, where there is maximum overlap between the oligonucleotides that most clearly cause an accumulation of splicing intermediates. For example, within this region, nucleotides 61-64 are identical in mammals, flies, trypanosomes, plants and yeast (reviewed in 2). This part of U2 snRNA has not been previously analysed by oligodeoxyribonucleotide-targeted RNAse H cleavage. However, a large deletion of U2 snRNA spanning this region has been analysed in Xenopus oocytes and shown to inhibit splicing and spliceosome assembly (50, 66). Mutational studies on yeast U2 snRNA have shown that base changes in the region between nucleotides 48-67, which disrupt the formation of stem hIa, result in loss of viability (68). Specific point mutations in stem Ila, at nucleotides G53 and C62, have also been shown to cause a cold-sensitive phenotype and to inhibit splicing of yeast pre-mRNAs (69). These mutations affected the stable association of U2 snRNP with actin pre-mRNA at the non-permissive temperature. The phenotypes of U2 mutations in Xenopus and yeast systems described above are consistent with an important role in splicing for the U2 snRNA region identified here using antisense probes. However, none of these mutants resulted in an accumulation of splicing intermediates as observed with the antisense probes used in this study. A possible explanation for this difference could be that this domain of U2 snRNA is required at both early and late stages of the splicing reaction. In this case such mutations would already block splicing during spliceosome assembly and hence their effect on later steps in the splicing mechanism would not be revealed. An alternative explanation is that the functions of U2 required for spliceosome assembly could either be unaffected by the antisense probe or that the complementary sequence on U2 snRNA may not become accessible until later stages of spliceosome assembly. It is also possible that the effect of the antisense probe binding to ths internal region of U2 snRNA is acting indirectly. For example, the binding of the oligonucleotide could cause a conformational change in the U2 snRNP or could result in steric hindrance of another snRNP or splicing factor which lies adjacent to U2 in the spliceosome.

While it cannot be excluded that the inhibitory effect could result from the modified oligonucleotide sequestering some essential splicing factor, rather than from an antisense effect, we consider this unlikely. The presence of both ribose and base modifications in the oligonucleotides, with each ribose carrying the bulky, three carbon allyl group, is known to severely inhibit direct protein binding. Furthermore, the specific inhibition of the second step of splicing is observed with overlapping antisense probes which share a maximum of only four identical nucleotides and which are primarily related through their complementarity to a specific region of U2 snRNA. In yeast, point mutations in the stem I region of U6 snRNA and immunodepletion of the PRP16 protein both cause accumulation of splicing intermediates (70, 71). Therefore binding of oligonucleotide F to U2 snRNA could interfere with either or both of these factors. To test these possibilities it will now be important to screen this region of U2 snRNA in more detail and to look for mutations which might similarly affect the second step in splicing. Antisense oligonucleotides made of 2'-O-allyl RNA incorporating the modified nucleotide 2-aminoadenosine form hybrids with complementary RNA target sequences that have exceptionally high thermal stability. These duplexes are more stable than those formed with all other types of antisense probes tested so far, including oligonucleotides made of RNA, DNA or modified DNA. An important corollary of this increased stability is the potential for the 2'-O-allyl probes to displace preformed regions of RNA secondary structure. This should help to increase the range of potential sites in RNP particles that may be targeted using an antisense approach. The 2'-O-allyl oligoribonucleotides are also highly resistant to enzymatic or chemical degradation and show reduced non-specific interactions with nucleic acid binding proteins (53, 72). While DNA oligonucleotides can also be stabilised against degradation by phosporothioate or methyl phosphonate modifications (73, 74,), these modifications lower the thermal stability of hybrid formation with complementary sequences (75, 76, 77). The combination of stable hybrid formation and resistance to degradation therefore renders the 2'-O-allyl oligoribonucleotides especially well suited for use as antisense probes in the study of RNA processing and gene expression.

ACKNOWLEDGEMENTS The authors thank Susan Weston and Samantha O'Loughlin for expert technical assistance in the preparation of oligonucleotides. We thank Professor D. Rio for kindly providing plasmid pGemV61. We are also grateful to our colleagues at the EMBL for carefully reading the manuscript. S.M.L.B. was supported by a postdoctoral fellowship from the Human Frontiers in Science Programme.

REFERENCES 1. Steitz, J.A., Black, D.A., Gerke, V., Parker, K.A., Kramer, A., Frendewey, D. and Keller, W. (1988) Max L. Bimstiel, Ed. Springer-Verlag. Berlin, Heidelberg, New York, London, Paris, Tokyo. pp71-99. 2. Guthrie, C. and Patterson, B. (1988) Ann. Rev. Genet. 22, 387-419. 3. Lamond, A.I., Barabino, S.M.L., and Blencowe, B.J. (1990) Vol.4. F. Eckstein and D.M.J. Lilley Eds. (Springer-Verlag Berlin Heidelberg).

pp.243-257. 4. Green, M.R., (1991) Ann. Rev. Cell Biol.7, 559-599. 5. Choi, Y.D., Grabowski, P.J., Sharp, P.A. and Dreyfuss, G.

231, 1534-1539.

(1986) Science

4464 Nucleic Acids Research, Vol. 20, No. 17 6. Mayeda, A. and Krainer, A.R. (1992) Cell 68, 365-375. 7. Kramer, A. (1988) Genes and Develop. 2, 1155-1167. 8. Ruskin, B., Zamore, P.D. and Green, M.R. (1988)Cell 52, 207-219. 9. Zamore, P.D., and Green, M.R. (1989) Proc. Natl. Acad. Sci. USA. 86, 9243-9247. 10. Zamore, P.D., and Green, M.R. (1991) EMBO J. 10, 207-214. 11. Zamore, P.D., Patton, J.G., Green, M.R. (1992) Nature 355, 609-614. 12. Tazi, J., Alibert, C., Temsamani, J., Reveillaud, I., Cathala, G., Brunel, C. and Jeunteur, P. (1986) Cell 47, 755-766. 13. Gerke, V. and Steitz, J.A. (1986) Cell 47, 973-984. 14. Garcia-Blanco, M.A., Jamison, S.F., and Sharp, P.A. (1989) Genes and

Develop. 3, 1874-1886. 15. Gil, A., Sharp, P.A., Jamison, S.F., and Garcia-Blanco, M.A. (1991) Genes and Develop. 5, 1224- 1236. 16. Patton, J.G., Mayer, S.A., Tempst, P., and Nadal-Ginard, B. (1991) Genes and Develop. 5, 1237-1251. 17. Fu, X.D., and Maniatis, T. (1990) Nature 343, 437-441. 18. Utans, U. and Kramer, A. (1990) EMBO J. 9, 4119-4126. 19. Krainer, A.R., Conway, G.C. and Kozak, D. (1990) Cell 62, 35-42. 20. Krainer, A.R., Mayeda, A., Kozak, D., and Binns, G. (1991) Cell 66, 383 -394. 21. Ge, H., and Manley, J.L. (1990) Cell 62, 25-34. 22. Ge, H., Zuo, P., and Manley, J.L. (1991) Cell 66, 373-382. 23. Ruby, S.W. and Abelson, J. (1991) Trends in Genetics 3, 79-85. 24. Frendewey, D., and Keller, W. (1985) Cell 42, 355-367. 25. Grabowski, P.J. and Sharp, P.A. (1986) Science 233, 1294-1299. 26. Pikielny, C.W., Rymond, B.C. and Rosbash, M. (1986). Nature 324, 341 -345. 27. Cheng, S. C., and Abelson, J. (1987) Genes and Develop. 1, 1014-1027. 28. Konarska, M.M. and Sharp, P.A. (1987) Cell 49, 763-774. 29. Bindereif, A. and Green, M.R. (1987) EMBO J. 6, 2415-2424. 30. Padgett, R.A., Mount, S.M., Steitz, J.A. and Sharp, P.A. (1983) Cell 35, 101- 107. 31. Krimer, A., Keller, W., Appel, B. and Luhrmann, R. (1984) Cell 38, 299-307. 32. Krainer, A.R. and Maniatis, T. (1985). Cell 42, 725-736. 33. Black, D. L., Chabot, B., and Steitz, J. A. (1985) Cell 42, 737-750. 34. Black, D. L., and Steitz, J. A. (1986) Cell 46, 697-704. 35. Berget, S.M., and Robberson, B.L. (1986) Cell 46, 691-696. 36. Barabino, S., Sproat, B.S., Ryder, U., Blencowe, B.J. and Lamond, A.I. (1989) EMBO J. 8, 4171-4178 37. Blencowe, B.J., Sproat. B.S., Ryder, U., Barabino, S. and Lamond, A.I. (1989) Cell 59, 531-539 38. Lamond, A.I., Sproat, B.S., Ryder, U. and Hamm, J. (1989) Cell 58, 383-390. 39. Barabino, S., Blencowe, B.J., Ryder, U., Sproat, B.S., and Lamond, A.I. (1990) Cell 63, 293-302. 40. Lamm,G.M., Blencowe, B.J., Sproat, B.S., Iribarren. A.M., Ryder,U. and Lamond, A,j. (1991) Nucl. Acids Res. 19, 3193-3198. 41. Wolff, T. and Bindereif, A. (1992) EMBO J. 11, 345-359. 42. Kretzner, L., Rymond, B.C. and Rosbash, M. (1987) Cell 50, 593-602. 43. Legrain, P., Seraphin, B. and Rosbash, M. (1988) Mol. Cell. Biol. 8, 3755 -3760. 44. McPheeters, D.S., Fabrizio, P. and Abelson,J. (1989) Genes and Develop. 3, 2124-2136. 45. Patterson, B. and Guthrie, C. (1987) Cell 49, 613-624. 46. Seraphin, B. and Rosbash, M. (1989) Cell 59, 349-358. 47. Frendewey, D., Krdmer, A. and Keller, W. (1987) Cold Spring Harbor Symp. Quant. Biol. 53, 287-298. 48. Chabot, B., and Steitz, J.A. (1987). Mol. Cell. Biol. 7, 281-293. 49. Zillmann, M., Zapp, M.L. and Berget, S.M. (1988) Mol. Cell. Biol. 8, 814-821. 50. Hamm, J., Dathan, N.A. and Mattaj, I.W. (1989) Cell 59, 159-169. 51. Temsamani, J, Agrawal, S. and Pederson, T. (1991) J. Biol. Chem. 266, 468-472. 52. Cotton, M., Oberhauser, B., Brunar, H., Holzer, A., Issakides, G., Noe, C.R., Schaffner, G., Wagner, E. and Birnstiel, M.L., (1991) Nucl. Acids Res. 19, 2629-2635. 53. Iribarren, A.M., Sproat, B.S., Neuner, P., Sulston, I., Ryder, U. and Lamond, A.I. (1990) Proc. Natl. Acad. Sci. USA 87, 7747-7751. 54. Sproat, B.S. and Lamond, A.l. (1991) IRL Press at Oxford University Press (F. Eckstein, editor) pp49-86. Sproat, B.S. and Lamm, G.M. (1990) Nucl. Acids Res. 18,

55. Pieles, U.,

4355-4360 56.

Dignam, J.D. Lebowitz, R.M. and Roeder, R.G. (1983). Nucl. Acids Res. 11, 1475-1489.

57. Lamond, A.I., Konarska, M.M., and Sharp, P. A. (1987) Genes and Develop. 1, 532-543. 59. Rio, D.C. (1988) Proc. Natl. Acad. Sci. USA 85, 2904-2908. 60. Newman, A.J., Lin, R., Cheng, S., and Abelson, J. (1985) Cell 41, 107-118. 61. Aebi, M., Horning, H., Padgett, R.A., Reiser, J. and Weissmann, C. (1986) Cell 47, 555-565. 62. Horning, H., Aebi, M. and Weissmann, C. (1986) Nature 324, 589-591. 63. Parker, R., Siciliano, P.G. and Guthrie, C. (1987) Cell 49, 229-239. 64. Zhuang, Y. and Weiner, A.M.(1989) 3, 1545-1552. 65. Wu, J. and Manley, J.L. (1991) Nature 352, 818-821. 66. Pan, Z.-Q. and Prives, C. (1988) Science 241, 1328-1331. 67. Datta, B. and Wainer, A.M. (1991) Nature 352, 821-824. 68. Ares, M. Jr. and Haller Igel, A. (1990) Genes and Develop. 4, 2132-2145. 69. Zavanelli, M.I. and Ares, M. Jr. (1991) Genes and Develop. 5, 2521 -2533. 70. Madhani, H.D., Bordonne, R. and Guthrie, C. (1990) Genes and Develop. 4, 2264-2277. 71. Schwer, B. and Guthrie, C. (1991) Nature 349, 494-499. 72. Paolella, G., Sproat, B.S. and Lamond, A.I. EMBO J. in press 73. Eckstein, F. (1985) Ann.Rev.Biochem. 54, 367-402. 74. Agrawal, S. and Goodchild, J. (1987) Tetrahedron Letters 28, 3539-3542. 75. Murakani, A., Blake, K.R. and Miller, P.S. (1985) Biochemistry 24, 4041 -4046. 76. Stein, C.A., Subasinghe, C., Shinosuka, K. and Cohen, J.S. (1988) Nucl. Acids Res. 16, 3209-3221. 77. Kibler-Herzog, L., Zon, G., Uznanski, B., Whittier, G and Wilson, W.D. (1991) Nucleic Acids Res. 19, 2979-2986. 78. Hartshorne, T. and Agabian, N. (1990) Genes and Develop. 4, 2121 -2131.