1158

and aprotinin had no effect. This result is probably because CML oxygenators are less harmful to platelets. We conclude that both the need for and the regimen of aprotinin in CPB must be evaluated for each oxygenator. Systematic application of aprotinin given only in the pump priming fluid is unwarranted. Departments of Immunology-Transfusion Haematology, and Anaesthesiology, University Hospital Brugmann, 1020 Brussels, Belgium

CHRISTIAN VANDENVELDE PIERRE FONDU JACQUELINE DUBOIS-PRIMO

1. Dietrich

W, Barankay A, Dilthey G, et al. Reduction of homologous blood requirement m cardiac surgery by intraoperative aprotinin application. Thorac Cardiovasc Surg 1989; 37: 92-98. 2. Gram J, Janetzko T, Jespersen J, Bruhn HD. Enhanced effective fibrinolysis following the neutralization of heparin in open heart surgery increases the risk of post-surgical bleeding. Thromb Haemost 1990; 63: 241-45. 3. Van Oeveren W, Jansen NJG, Bidstrup BP, et al. Effects of aprotinin on hemostatic mechanisms during cardiopulmonary bypass. Ann Thorac Surg 1987; 44: 640-45. 4. Van Oeveren W, Harder MP, Roozendaal KJ, Eijsman L, Wildevuur CRH. Aprotinin protects platelets against the initial effect of cardiopulmonary bypass. J Thorac Cardiovasc Surg 1990; 99: 788-97.

Mechanical support has been tried successfully" though little is known about survival in such patients. Before retransplantation, 11 of the Eurotransplant patients received some form of mechanical support. 6 died 1-33 days after retransplantation (median 2), 7 of 14 without mechanical support died 1-213 days after retransplantation (median 25 days). 1-year survival in the two groups was not significantly different. The International Society for Heart Transplantation reported patient survival in regrafted cardiac patients as 52% at 1 year,S compared with a 1-year survival of about 80% for primary transplantation. However, their series included patients given a cardiac retransplant after chronic rejection while the patients in our study received their second graft after acute failure of the first. An answer to the question whether survival rates in patients after acute cardiac retransplantation justify their being given a higher urgency priority than patients awaiting primary cardiac transplant must await further data and longer follow-up. We thank the medical staff, nurses, and administrators of the participating for their cooperation in providing data for this analysis.

centres

Results of acute heart

JAN DE BOER

retransplantation

SiR,—Eurotransplant coordinates organ exchange in Austria, Belgium, Germany, Luxembourg, and the Netherlands. On Jan 1, 1988, a "high urgency programme" for patients awaiting acute cardiac retransplantation was initiated within Eurotransplant. Two rules were agreed: (1) all donor centres must offer available hearts to this special category of patients and (2) these high urgency patients have the highest priority in the selection process within the heart exchange programme. Since there is still a shortage of donor hearts and patients are dying while awaiting transplantation, the question was raised if acute retransplantation is justified in terms of survival and best use of organs. As of March 15, 1990, 60 patients from fifteen centres had been assigned to the "high urgency" category. 25 were transplanted, 24 within 6 days of registration. The follow-up of these 25 recipients of cardiac retransplants is shown in the table. Actuarial survival was 42% at 1 year. 13 patients (52%) died within 1-213 days (median 6 days), 7 dying within a week. FOLLOW-UP OF 25 CARDIAC RETRANSPLANTATIONS WITHIN EUROTRANSPLANT

2300 RC Leiden, Netherlands

BERNARD COHEN JANE THOROGOOD FRANS A. ZANTVOORT

Department of Immunohaematology, University Hospital, Leiden

JOSEPH D’AMARO

Eurotransplant Foundation

GUIDO G. PERSIJN

Eurotransplant Foundation, University Hospital,

Phillips SJ, ZeffRH, Wickemeyer WJ, et al. Bridging circulatory support before heart transplant without invasion of the mediastinum J Heart Transpl 1987; 2: 116-19 2. Zumbro GL. Mechanical assistance for cardiogenic shock following cardiac surgery, myocardial infarction, and cardiac transplantation. Ann Thorac Surg 1987; 44: 1.

11-13. 3. Frazier OH. Use of left ventricular assist device

as a bridge to transplantation in a pediatric patient. Texas Heart Inst J 1989; 1: 46-50. 4. Carpentier A. Heterotopic artificial heart as a bridge to cardiac transplantation. Lancet

1986, ii: 97-98. 5 Kriett JM, Tarazi RY,

Kaye MP The registry of the International Society for Heart Transplantation. Clin Transpl 1989: 45-53.

Apolipoprotein

E

genotyping by one-stage PCR

SIR,-In a lipid clinic, apolipoprotein E (apo E) phenotyping is important diagnostic aid. The conventional method is isoelectric focusing of plasma apo E isoforms but this can sometimes be misleading. DNA-based genotyping is more accurate but has an

*Number of days registered as highly urgent tStl1l alive. tABO blood group incompatibility

tended to be time-consuming and inconvenient for routine use. Kontula et all have described a simplified DNA technique that requires two-stage polymerase chain reaction (PCR) amplification of DNA in the region of the apo E gene followed by digestion with a restriction endonuclease. The method is based on the observation3 that the nucleotide substitutions that account for apo E allelic variation result in polymorphic restriction sites for HhaI or Cfol. Although a considerable advance on previous methods’*’’ this method has two drawbacks. Two-stage PCR is expensive in time and materials and, because of a low PCR annealing temperature, primer binding may not always be specific for apo E sites. Both disadvantages can be overcome with different primers in a single-stage PCR at a higher annealing temperature described here. The primers (see figure legend) amplify a 227 bp region of DNA that spans both apo E polymorphic sites. In the PCR, 200 ng of genomic DNA or 7-5 1 boiled whole bloodare added to 25 pmol of each primer, 2-5 III dimethyl sulphoxide, and 0-5 units Taq DNA polymerase (’Amplitaq’, Cetus) in 25 pl. In the thermal reactor (Hybaid), an initial denaturation at 94°C for 5 min is followed by 40 cycles of annealing at 65°C for 0-5 min, extension at 70°C for 15 min, denaturation at 94°C for 0-5 min, and final extension at 70°C for 10 min. 22 ul of amplification product is then digested with 24 units Cfol (Boehringer) for at least 3 h at 37°C, subjected to electrophoresis for 18 h at 100 V on a 20% polyacrylamide gel, and viewed and photographed under ultraviolet light after staining with ethidium bromide. In 128 individuals genotyped by this method, we have not encountered any difficulties with additional amplification products,

1159

N-acetylcysteine and immunoreactivity of lipoprotein(a) SIR,-Dr Gavish and Dr Breslow (Jan 26, p 203) report a striking decrease in the plasma levels of lipoprotein(a) in two patients after short-term oral administration of N-acetylcysteine (NAC) at a dose of 2 and 4 g daily. Dr Stalenhoef and colleagues (Feb 16, p 491) treated twelve patients and seven volunteers having high and normal plasma Lp(a) concentrations, respectively, with NAC at daily doses of 1-2 g for 4-6 weeks or 1-2 g for 4 weeks, followed by 2-4 g for 2 weeks. They observed either no or only very small changes in plasma Lp(a). As part of a large scale study on the effect of thiols and cysteine-containing compounds on the structure of Lp(a), we have observed in vitro that NAC decreases the immunoreactivity of Lp(a) and that this process is dependent on reagent concentration, medium pH, and length of incubation. ELISA’ measurement of both the apoB-apo(a) complex and apo(a) showed a progressive drop in the percentage of Lp(a) immunoreactivity in the plasma samples that were incubated with 1-20 mmol/1 NAC for 1 h at 37°C at pH 77. The initial plasma concentration of Lp(a) protein was 16 mg/dl. Representative results are shown below:

technique for genotyping apo E. Upper. restriction map of three principal alleles 1:2,1:3’ and s, of apo E gene. Codons 112 and 158 contain polymorphic nucleotides 3745 and 3883 Cutting sites for Cfol are labelled C and arrowed, variant sites being indicated by (C) Numbers between cutting sizes indicate fragment sites in base pairs. Lower photograph of polyacrylamide gel stained with ethidium bromide and viewed through UV light. A=molecular weight marker, H=undigested PCR-ampllfled unextracted DNA (whole blood); B-G Cfol restriction fragments from six possible apo E genotypes Sizes in base pairs. (48 bp bands in C and D are readily recognisable on gel, but do not photograph well.) Upstreamprimer=5’TCCAAGGAGCTGCAGGCGGCGCA3’,asusedby Houlston et al in their oligomelting procedure.’ Downstream pnmer=5’ACAGAATTCGCCCCGGCCTGGTACACTGCCA3’, that used by Hixon and Vernier’ with addition of TGCCA at 3’ end. Modified PCR

and the elimination of one PCR procedure saves time and materials. Further economy has been achieved by using one-eighth the quantities of PCR reagents, one-tenth of the Taq DNA polymerase used by Kontula et aland boiled whole blood in place of extracted DNA. We find the method is ideally suited for routine use. Department of Clinical Chemistry, Western General Hospital, Edinburgh MRC Human Genetics Unit and University Department of Medicine, Western General Hospital, Edinburgh EH4 2XU, UK

PHILIP R. WENHAM

WILLIAM H. PRICE

Department of Clinical Chemistry, Western General Hospital, Edinburgh

GILLIAN BLUNDELL

1 Snowden

2

C, Houlston RS, Arif MH, Laker MF, Humphries SE, Alberti KGMM. Disparity between apolipoprotein E phenotypes and genotypes (as determined by polymerase chain reaction and oligonucleotide probes) m patients with noninsulin-dependent diabetes mellitus. Clin Chim Acta 1991; 196: 49-58. Kontula K, Aalto-Setala K, Kuusi T, Hamalalnen L, Synen A-C. Apolipoprotein e polymorphism determined by restriction enzyme analysis of DNA amplified by polymerase chain reaction: convenient alternative to phenotyping by isolectric

focusing. Clin Chem 1990; 36: 2087-92. 3 Hixon

JE, Vernier DT Restriction isotyping of human apolipoprotein E by gene amplification and cleavage with HhaI.J Lipid Res 1990, 31: 545-48. 4 Houlston RS, Snowden C, Green F, Alberti KGMM, Humphries SE. Apolipoprotein (apo) E genotypes by polymerase chain reaction and allele-specific oligonucleotide probes no detectable linkage equilibrium between apo E and apo CII. Hum Genet 1989; 83: 364-68. 5. Wenham PR, Newton CR, Pnce WH. Determination of apolipoprotein E genotypes by the amplification refractory mutation system. Clin Chem 1991; 37: 241-44. 6 Newton CR, Kalshekar N, Graham A, et al. Diagnosis of &agr;1-antitrypsin deficiency by enzymatic amplification of human genomic DNA and direct sequencing of polymerase chain reaction products. Nucleic Acids Res 1988; 16: 8233-43.

Capturing antibody was antiapo(a). Of detecting antibodies, antiapob apoB100-apo(a) complex, and anti-apo(a) measured apo(a) Immunoblot analyses corroborated the ELISA results. Under the experimental conditions used, we noted no significant changes in total plasma cholesterol or total protein. We also found that the NAC-induced decrease in Lp(a) immunoreactivity is related to structural changes of the kringle domains of apo(a) that follow the cleavage of the disuphide bonds. Our results indicate that caution must be taken in interpreting results from Lp(a) measurements in media containing NAC. The changes in plasma Lp(a) reported by Gavish and Breslow may have been due to attenuation of antibody reactivity and not to actual changes in Lp(a) mass; the plasma cholesterol of the two patients studied remained unchanged even in the presence of a big decrease in plasma Lp(a). The plasma concentrations of NAC attained in the study by Stalenhoef et al may have been too low to elicit changes in the structure and immunoreactivity of Lp(a). The evidence that NAC can cause structural alterations of Lp(a) in a dose-dependent manner raises doubts about the potential benefits of this compound in the treatment ofhyper-Lp(a)-proteinemia that has been shown to be associated with an increased risk for atherosclerotic cardiovascular disease .2 measured the

Departments of Medicine, Biochemistry, and Molecular Biology, University of Chicago, Chicago, Illinois 60637, USA

ANGELO M. SCANU

1. Fless GM, Snyder ML, Scanu AM. Enzyme-linked immunoassays for Lp(a).J Lipid Res 1989; 30: 651-62. 2. Berg K. Lp(a) lipoprotein: an overview. In: Scanu AM, ed. Lipoprotein(a). San Diego: Academic Press, 1989: 1-23.

Tea and

fertility

SiR,—Dr Cramer has suggested that tannic acid in

tea

may

women’s fertility.’ Our earlier paper that had implicated caffeine compared coffee with non-coffee caffeinated beverages and found reduced fertility with bothAfter Cramer’s suggestion, we separated our non-coffee beverages into tea and caffeinated soft drinks, and repeated the analysis. We collected no data on non-caffeinated beverages. We found that tea had a negligible association with fertility, whereas soft drinks were strongly related to lower fertility. When soft drinks were modelled as a linear variable (the model that best fitted our data), one caffeinated soft drink per day was associated with a 50% reduction in the monthly

impair