Science of the Total Environment 490 (2014) 416–421
Contents lists available at ScienceDirect
Science of the Total Environment journal homepage: www.elsevier.com/locate/scitotenv
Application of TaqMan fluorescent probe-based quantitative real-time PCR assay for the environmental survey of Legionella spp. and Legionella pneumophila in drinking water reservoirs in Taiwan Po-Min Kao a, Bing-Mu Hsu a,⁎, Tsui-Kang Hsu b,1, Wen-Tsai Ji a, Po-Hsiang Huang a, Chih-Jen Hsueh c,1, Chuen-Sheue Chiang d, Shih-Wei Huang e, Yu-Li Huang f a
Department of Earth and Environmental Sciences, National Chung Cheng University, Chiayi, Taiwan, ROC Department of Ophthalmology, Cheng Hsin General Hospital, Taipei, Taiwan, ROC c Department of Otorhinolaryngology, Cheng Hsin General Hospital, Taipei, Taiwan, ROC d Research and Diagnostic Center, Centers for Disease Control, Taiwan, ROC e Center for General Education, Cheng-Shiu University, Kaohsiung, Taiwan, ROC f Department of Safety Health and Environmental Engineering, National Kaohsiung First University of Science and Technology, Kaohsiung, Taiwan, ROC b
H I G H L I G H T S • The detection rate was 63.2% (12/19) for Legionella in drinking water reservoirs. • The identified species were L. pneumophila, L. jordanis and L. drancourtii. • The presence of L. pneumophila in reservoir may be a potential public health threat.
a r t i c l e
i n f o
Article history: Received 17 December 2013 Received in revised form 24 April 2014 Accepted 25 April 2014 Available online xxxx Editor: E. Capri Keywords: Legionella spp. Legionella pneumophila Reservoir PCR TaqMan fluorescent quantitative real-time PCR
a b s t r a c t In this study, TaqMan fluorescent quantitative real-time PCR was performed to quantify Legionella species in reservoirs. Water samples were collected from 19 main reservoirs in Taiwan, and 12 (63.2%) were found to contain Legionella spp. The identified species included uncultured Legionella spp., L. pneumophila, L. jordanis, and L. drancourtii. The concentrations of Legionella spp. and L. pneumophila in the water samples were in the range of 1.8 × 102–2.6 × 103 and 1.6 × 102–2.4 × 102 cells/L, respectively. The presence and absence of Legionella spp. in the reservoir differed significantly in pH values. These results highlight the importance that L. pneumophila, L. jordanis, and L. drancourtii are potential pathogens in the reservoirs. The presence of L. pneumophila in reservoirs may be a potential public health concern that must be further examined. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Legionella spp. is a Gram-negative coccobacillus belonging to the gamma-subgroup of proteobacteria and non-spore-forming genus, and is commonly found worldwide in many different anthropogenic and natural aquatic environments such as rivers, hot springs, cooling towers, water systems and spa pools (WHO, 2007; Gomez-Valero et al., 2009). There are 62 species/subspecies belonging to 73 distinct serogroups, and 26 species have been found to cause human pneumonia ⁎ Corresponding author. Tel.: +886 952840868; fax: +886 5 2720807. E-mail address: [email protected] (B.-M. Hsu). 1 Equal contribution to first author: Tsui-Kang Hsu and Chih-Jen Hsueh.
http://dx.doi.org/10.1016/j.scitotenv.2014.04.103 0048-9697/© 2014 Elsevier B.V. All rights reserved.
(WHO, 2007; Gomez-Valero et al., 2009; DSMZ, 2013). Legionella pneumophila and other related Legionella bacteria cause Legionellosis, a disease that emerged in the second half of the 20th century. Legionella spp. is considered an emerging pathogen involved in aquatic environment contamination and cause of Legionnaires' disease (Iatta et al., 2013). Legionellosis, also known as Legion Fever, including Pontiac fever and Legionnaires' disease, is a potentially significant health threat to cigarette smokers, immunosuppressed individuals and chronic lung disease patients (Winn, 1995; Percival et al., 2004). Over 90% of legionellosis cases are caused by infection of L. pneumophila (WHO, 2007; Gomez-Valero et al., 2009). Legionella are found in aquatic environments (hot springs, Spa, whirlpool baths) as symbionts of protists and therefore more research
P.-M. Kao et al. / Science of the Total Environment 490 (2014) 416–421
417
is necessary for investigating the associated risks for public health (Hoge and Breiman, 1991; Su et al., 2006; Lin et al., 2007). The aim of the study was to gain insights into the distribution and occurrence of Legionella spp. and L. pneumophila in 19 reservoirs of Taiwan. The TaqMan fluorescent quantitative real-time PCR assay was used for quantification of Legionella spp. and L. pneumophila in the water samples. Taxonomic classification of Legionella spp. and L. pneumophila was done with DNA sequencing method, and water quality parameters were measured for comparison. The results are presented and discussed with respect to potential risk of infection.
filtration and a differential medium was described in the standard method for the examination of water and wastewater (Methods 9222B) (APHA, 2005). The total coliform cultures were placed in m-Endo LES agar (Difco, USA) at 36 °C for 24 h before counting. Heterotrophic bacteria were cultured on the M-(HPC) heterotrophic plate count agar base measured by the spread plate method (Methods 9215C) (APHA, 2005). The potential effect of water quality parameters on the presence/absence of Legionella spp. were evaluated using STATISTICA® 6.0 (StatSoft, Inc., Tulsa, Oklahoma, USA).
2. Materials and methods
2.2. Water sample concentration and DNA extraction
2.1. Water sample collection and water quality measurements
For each collected water sample, 1 L was concentrated via membrane filtration method using GN-6 Metricel® mixed cellulose ester membranes (0.45 μm pore diameter, Pall, Port Washington, New York, USA). After filtration, the membranes were scraped, and the collected material was washed with 100 mL eluting fluid consisting of phosphate-buffered saline (PBS; 7.5 mM Na2HPO4, 3.3 mM NaH2PO4, 108 mM NaCl, pH 7.2). The resulting solution was then transferred into two 50 mL centrifuge tubes and centrifuged at 2600 ×g for 30 min (KUBOTA-Model 2420 Compact Tabletop Centrifuge, RS-240 swinging bucket rotor, Japan). Subsequently, the top 45 mL supernatant fluid was removed, and the remaining 5 mL pellet was preserved with PBS at 4 °C for further analyses. Total DNA extraction was done with the concentrated pellet (1 mL) using MagNA Pure LC instruments (Roche, USA) with MagNA Pure LC DNA isolation kits III (Roche, USA) following automated mode specified by the kit. The resulting solution (final volume: 100 μL) was analyzed for the presence of Legionella spp. specific genes with PCR and TaqMan realtime quantitative PCR.
A total of 57 water samples were from 19 reservoirs in Taiwan (see Fig. 1). Sample collection was carried out from November 2012 to May 2013. The water samples were collected within 10 cm of the water surface. The 19 reservoirs were of a natural environment with favorable weather conditions for vegetation. All reservoirs are used for drinking water. For each sampling site, 1 L of water sample was placed into sterile 1 L polypropylene bottles and stored at 4 °C transported to the laboratory for subsequent analyses within 24 h. Water quality parameters were measured for each sample on site at the time of sample collection. Turbidity was measured in situ using a ratio turbidimeter (Turb555, WTW, Germany). The pH and water temperature were measured in situ using portable pH meter and thermometer (D-24E, Horiba Co., Kyoto, Japan). Additional water samples were taken from each sampling site in 300 mL sampling bags (Nasco Whirl-Pak, Salida, California, USA) for microbiological water quality parameters. The total coliform were measured by membrane
Fig. 1. The sampling sites in 19 reservoirs of Taiwan.
418
P.-M. Kao et al. / Science of the Total Environment 490 (2014) 416–421
2.3. PCR conditions and nucleotide sequencing analysis The PCR solution was prepared with 3 μL of the DNA templates and PCR mixture to a total volume of 25 μL. The PCR mixture included 2.5 μL 10×PCR buffer (20 mM MgCl2), 0.5 μL 40 mM dNTP, 0.5 μL each of the primer (10 μM), 0.2 μL Taq DNA Polymerase (Viogene, 5 U/μL), and DNase-free deionized water. The PCR assay primers, PCR cycling conditions, and the fragments of target genes used for detecting Legionella spp. and Legionella pneumophila in this study are summarized in Table 1. PCR products of Legionella spp. were identified by gel electrophoresis on a 2% agarose gel (Biobasic Inc., Canada) with 5 μL of the reaction solution. The DNA fragments were confirmed using ethidium bromide staining (0.5 μg/mL, 10 min). A 100 bp DNA ladder was used as a DNA size marker. PCR products were directly sequenced. If the PCR sequencing signals were cluttered, the original sequences were cloned and then sequenced. The sequence analysis was done using a Bio-Dye terminator cycle sequencing kit (Applied Biosystem, USA). Phylogenetic construction produced gene trees by using neighbor-joining distance trees with a generation of 1000 bootstrapped replicates. The gene sequences were assigned to the NCBI GenBank database in order to allow Blast searching and alignment used the MEGA software program version 5.0 (Mega Software, Tempe, Arizona, USA). 2.4. TaqMan fluorescent quantitative real-time PCR assay The quantitative real-time PCR assay was performed using an ABI StepOneTM Real-Time PCR Systems (Applied Biosystems, Singapore) with a total reaction volume of 20 μL. Each reaction mix contained 3.5 μL sterile PCR grade deionized water, 0.5 μL each of the primer, 0.5 μL TaqMan probe, 10 μL Probes mix, and 5 μL template DNA. The quantitative real-time PCR assay primers, cycling conditions, and the fragments of target genes used for detecting Legionella spp. and L. pneumophila are shown in Table 2. For each assay, the threshold cycle (Ct) value, defined as the quantitative real-time PCR cycle at which the fluorescence signal exceeded the background threshold, was determined to quantify each DNA product. Negative DNA controls (template DNA replaced by double distilled water) and positive control DNA (L. pneumophila ATCC 43661) were included with each quantitative PCR run. A Taqman® Exogenous Internal Positive Control (IPC, Applied Biosystems) was co-amplified in each qPCR reaction with target DNA, according to the manufacturers' instruction. 2.5. Standard curve of 23S-5S rRNA and mip gene The yT&A clone vector kit (Yeasterm Biotech Corporation, Taipei, Taiwan) was used to determine the Legionella 23S-5S rRNA and mip gene copy number. Recombinant plasmid DNA was purified in triplicates using a HiYield™ plasmid mini kit (Real Biotech Corporation, Taipei, Taiwan). Following purification, the concentration of plasmid DNA was determined using a NanoDrop ND1000 spectrophotometer (NanoDrop Technologies, Wilmington, Delaware, USA). The number
of construct copies in the plasmid solution was calculated based on plasmid and insert sizes. A plasmid-based standard curve was generated with 10-fold serial dilutions of plasmid containing the 23S5S rRNA and mip gene sequence of the target. The standard curve, with a concentration of 2.7 × 107 copies/μL (23S-5S rRNA gene) and 3.5 × 108 copies/μL (mip gene) for the dilution with the highest copy number, was used for determining the copy number of the 23S-5S rRNA and mip gene in Legionella spp. and L. pneumophila. 3. Results and discussion 3.1. Detection and quantification of Legionella spp. and L. pneumophila Legionella spp. and L. pneumophila were detected in 12 (63.2%) and 4 (21.1%) of the 19 reservoirs, as shown in Table 3. The results indicated that L. pneumophila can be found in reservoirs in Taiwan. The drinking water source area is less likely to be affected by domestic wastewater and livestock sewage. Therefore, periodic clearing and monitoring of the reservoir will be necessary to avoid Legionella contamination in the future. In previous literatures, Legionella spp. and L. pneumophila have been found in various aquatic environmental ecosystems worldwide. For instance, the detection rate of river water samples for Legionella spp. was 17.9% in Taiwan (Huang et al., 2011a) and 20.8% in France (Parthuisot et al., 2010). In hot springs, the detection rate was reported at 8.7% in USA (Sheehan et al., 2005) and 17.9–47.1% in Taiwan (Hsu et al., 2009; Huang et al., 2010, 2011a,b; Huang and Hsu, 2010) In Spain (Garcia et al., 2013) and China (Zhou et al., 2011), the reported detected rate for L. pneumophila in drinking water samples was 13.9% and 16.6%, respectively. The above literatures suggested that the detection rate of Legionella spp. in the aquatic environment may be influenced by detection methods, water types and sources, geographical areas and conditions, and the diversity of ecological locations around the world. In this study, the detection rate of Legionella spp. and L. pneumophila was higher than previously reported from the aquatic environment. Accordingly, their potential impact on human health should not be overlooked. Quantification of Legionella spp. in reservoirs can help us to better understand Legionella contamination condition and potential threat to human health. Therefore, investigative and monitoring program to quantify the density of Legionella in the aquatic environment is important with respect to characterizing potential human exposure in the aquatic environments, which could be achieved by TaqMan fluorescent probe-based quantitative real-time PCR. The quantitative results of real-time PCR assays for Legionella-positive water samples in this study are shown in Table 3. The equation from the regression curve was: Ct = − 3.28 log [23S-5S rRNA gene copy number] + 34.65 (R2 = 0.994) and −3.19 [mip gene copy number] + 39.33 (R2 = 0.998). For the 12 Legionella-positive reservoir water samples, the Ct values were in the range of 31.7–34.5. The Legionella concentration was estimated based on the assumption of one gene copy per cell (Koide et al., 1993; Herpers et al., 2003; Wang et al., 2012). Legionella spp. and
Table 1 Description of the primers used in PCR of Legionella spp. and L. pneumophila. Pathogen
Target gene
Primer name
Primer sequences (5′–3′)
Predenaturation, denaturation, annealing, extension, and final extension temperature (°C)/reaction time (s)
Cycling no.
Amplicon size (bp)
Source
Legionella
16S rRNA
LEG 225 LEG 858
95/600, 95/30, 58/60, 72/60, 72/300
35
654
Miyamoto et al. (1997)
L. pneumophila
mip
LmipL920 LmipR1548
95/600, 95/60, 62/60, 72/60, 72/300
40
650
Bej et al. (1991)
rpoB
RL1 RL2 DL1 DL2
AAGATTAGCCTGCGTCCGAT GTCAACTTATCGCGTTTGCT GCTACAGACAAGGATAAGTTG GTTTTGTATGACTTTAATTCA GATGATATCGATCAYCTDGG TTCVGGCGTTTCAATNGGAC TTGATTTGGTGAAACTCAATGG CAATCAAAATCCTGGTGCTTC
95/600, 95/30, 55/60, 72/60, 72/300
40
369
Ko et al. (2002a)
95/600, 95/30, 50/30, 72/30, 72/300
40
434
Ko et al. (2002b)
dotA
P.-M. Kao et al. / Science of the Total Environment 490 (2014) 416–421
419
Table 2 Description of the primers used in real-time PCR of Legionella spp. and L. pneumophila. Pathogen
Target gene
Primer name
Primer sequences (5′–3′)
Denaturation, annealing, and extension temperature (°C)/reaction time (s)
Cycling no.
Amplicon size (bp)
Source
Legionella
23S-5S rRNA
45
259
Herpers et al. (2003)
mip
CTAATTGGCTGATTGTCTTGAC GGCGATGACCTACTTTCG VIC-CGAACTCAGAAGTGAAAC TTCATTTGYTGYTCGGTTAAAGC AWTGGCTAAAGGCATGCAAGAC FAM-ATCGTGTAAACTCTGACTCTTT ACCAAACCTGTGG
95/600, 95/15, 60/60
L. pneumophila
LegF LegR Leg Probe LPQF LPQR mip Probe
95/600, 95/15, 60/60
45
66
Behets et al. (2007)
L. pneumophila concentrations were in the range of 1.8 × 102 – 2.6 × 103 cells/L and 1.6 × 102–2.4 × 102 cells/L, respectively. In earlier studies, concentrations of Legionella spp. in river water samples were in the range of 1 × 104–1 × 108 cells/L (Ortiz-Roque and Hazen, 1987; Parthuisot et al., 2010; Kao et al., 2013). Legionella spp. and L. pneumophila in tap water samples were in the range of 6.1 × 101– 8.5 × 105 cells/L (Joly et al., 2006; Wullings and van der Kooij, 2006; Declerck et al., 2007; Yaradou et al., 2007; Wullings et al., 2011; Yanez et al., 2011) and 1.7 × 101–3.1 × 105 cells/L (Yanez et al., 2005; Joly et al., 2006; Behets et al., 2007; Yaradou et al., 2007; Bonetta et al., 2010; Wullings et al., 2011). Legionella spp. in hot spring samples were in the range of 0.3 × 101–2.1 × 106 cells/L (Qin et al., 2012; Kao et al., 2013). In this study, concentrations of Legionella spp. were similar to those reported in previous studies in the aquatic environments. The detection rate for Legionella spp. was 63.2% and the mean concentrations of L. pneumophila were 1.9 × 102 cells/L in reservoirs. The results suggested that these reservoirs might be a potential source for Legionella contamination in domestic drinking water supplies. Relevant drinking water supply facilities and health authorities should be aware of these possible hazards. It may also be necessary to ensure adequate treatment efficiency of drinking water treatment plants when considering Legionella spp. infection risk. 3.2. Identification of Legionella spp. All Legionella-positive water samples detected by PCR were subjected to DNA sequencing for species identification. The DNA sequences of sample strains were compared with Legionella reference strains from the NCBI GenBank to determine the likelihood of specific strains (above 99% sequence identity). Neighbor-joining analysis was used to
infer relationships between the reservoir isolates in this study and reference strains (Fig. 2). The identified Legionella species from reservoir water samples were uncultured Legionella sp. (n = 7), L. pneumophila (n = 4), L. jordanis (n = 2), and L. drancourtii (n = 1). Strains from sampling sites A and S were identified as L. jordanis (EF036512) and L. pneumophila (FR799709). L. jordanis was first isolated from a bronchoalveolar lavage specimen from a patient with an indolent lower respiratory tract infection associated with constitutional symptoms in Canada (Vinh et al., 2007), and L. pneumophila was first isolated from Emilia-Romagna Area of Italy. Strains from sites E and G were identified as L. pneumophila (FR799709). Strain at site H water sample was identified as L. drancourtii LLAP12 (NR026335), which was isolated from an environmental water source in West Yorkshire, UK (Scola, 2004). For sampling sites B, C and F, the strain was identified as uncultured Legionella sp. (HQ112007), which was first isolated from environmental biofilm sample from the distribution system of treated anaerobic groundwater in Netherlands (Wullings et al., 2011). Sampling sites I, K, O and R were found with uncultured Legionella sp. (AY924058), which was first isolated from environmental surface water samples in Netherlands (Wullings and van der Kooij, 2006). The results showed that Legionella is present and widespread in Taiwan's reservoirs. Of the 12 sampling sites containing Legionella, 5 samples (41.7%) contained pathogenic species including L. pneumophila (33.3%), L. jordanis (16.7%), and L. drancourtii (8.3%). Among the pathogenic species, L. pneumophila is the most pathogenic, causing more than 80% of the legionellosis outbreaks worldwide (Brooksa et al., 2004; Yanez et al., 2005; Declerck et al., 2007). The results also provided evidence that there is potentially a health risk associated with Legionella contamination in the domestic drinking water supply in these water areas. Therefore, long-term monitoring on the prevalence
Table 3 Detection results of Legionella-positive water samples in various reservoirs. Sampling site
Longitude/latitude
Positive sample
DNA sequencing result
Ct value
Cell number (cells/L)
A
121.7104, 25.1336
+
B C D E F G H I J K L M N O P Q R S
121.7356, 25.0872 121.2424, 24.8035 121.0569, 24.7460 121.0648, 24.7328 120.8848, 24.5804 120.7965, 24.3402 121.1686, 24.2547 121.1364, 23.9831 120.9105, 23.8609 120.9135, 23.8362 120.4797, 23.4681 120.5126, 23.4654 120.4755, 23.3553 120.3768, 23.2116 120.3443, 22.8151 120.3567,22.6563 120.3922, 22.5410 120.7813, 22.1338
+ + ND + + + + + ND + ND ND ND + ND ND + +
L. jordanis L. pneumophila u. Legionella sp. u. Legionella sp.
– 34.5 32.3 –
– 1.6 × 102 1.5 × 103 –
L. pneumophila u. Legionella sp. L. pneumophila L. drancourtii u. Legionella sp.
– 32.3 34.5 – 31.9
– 1.5 × 103 1.6 × 102 – 2.1 × 103
u. Legionella sp.
34.4
1.8 × 102
u. Legionella sp.
31.9
2.1 × 103
u. Legionella sp. L. jordanis L. pneumophila
31.7 – 33.9
2.6 × 103 – 2.4 × 102
ND, not detected. –, not enough DNA sample added to the real-time PCR.
420
P.-M. Kao et al. / Science of the Total Environment 490 (2014) 416–421
G 100 S2
E A2 L. pneumophila (FR799709) H 100 L. drancourtii (NR026335)
L. sp. (JN380997)
77
100 A1
S1 L. jordanis (EF036512) u. Legionella sp. (HQ112007) B
93 100
C F
L. londiniensis (NR044963) u. Legionella sp. (AY924157) O
99 100
R u. Legionella sp.(AY924058)
76
I
86
100 K
0.01 Fig. 2. Phylogenetic relationship of Legionella species PCR products and reference strains from NCBI GenBank inferred by neighbor-joining analysis in reservoir water samples.
of Legionella spp. may be necessary to prevent further infestations in Taiwan's reservoirs. 3.3. Relationships among water quality parameters and Legionella Mann–Whitney U test of statistical analyses was performed to detect differences in water quality parameters between Legionellapositive/negative water samples. Results of the above nonparametric tests are presented in Table 4. No significant differences were observed between the positive/negative samples of Legionella spp. with respect to turbidity, total coliforms, water temperature and heterotrophic plate counts. On the other hand, significant difference (P b 0.05) was found between the positive/negative of Legionella spp. and pH value. The result supported previous reports of significant difference between pH value and Legionella spp. in the aquatic environment (Huang and Hsu, 2010; Huang et al., 2011a; Wang et al., 2012; Kao et al., 2013). Furthermore, for water samples with L. pneumophila, the pH value in
the reservoir ranged from 7.1 to 8.3. In previous reports, naturally occurring L. pneumophila multiplied at pH values of 5.5 to 9.2 (Wadowsky et al., 1985). Further, Ohno et al. reported that the optimal pH values for L. pneumophila in an aquatic environment ranged from 6.0 to 8.0 (Ohno et al., 2003), which was in agreement with the results in this study. 4. Conclusions In this study, the presence of Legionella spp. was investigated in 19 reservoirs in Taiwan. The total detection rate was 63.2% (12/19), and the identified species were L. pneumophila, L. jordanis and L. drancourtii. The mean concentration of Legionella spp. and L. pneumophila was 1.7 × 103 and 1.9 × 102 cells/L, respectively. Significant differences were found between the presence/absence of Legionella spp. with pH value. Legionella spp. in reservoirs in Taiwan may be a potential public health concern and should be further examined.
Table 4 Nonparametric test results for difference for Legionella in term of water quality parameters. Water quality parameter
HPC (CFU/mL) Total coliforms (CFU/100 mL) Temperature (°C) Turbidity (NTU) pH ⁎ P b 0.05.
Mann–Whitney U test
P P P P P
= = = = =
0.763 0.985 0.918 0.720 0.028⁎
Legionella-positivity samples (n = 12)
Legionella-negativity samples (n = 47)
Mean (range)
Mean (range)
7.2 × 103 (3.7 × 102–1.87 × 104) 3.9 × 103 (0–6.5 × 103) 23.1 (16.9–28) 6 (1–45) 8.11 (7–9.4)
6.4 × 103 (2.0 × 102–1.97 × 104) 3.5 × 103 (0–8.7 × 103) 23.1 (18–32) 3.7 (1–60) 8.25 (7.7–8.9)
P.-M. Kao et al. / Science of the Total Environment 490 (2014) 416–421
Acknowledgments This work was supported by a research grant from the National Science Council (NSC 102-2116-M-194-006) and Cheng Hsin General Hospital (102-27) of Taiwan, ROC. References APHA. Standard method for the examination of water and wastewater. Washington DC.: APHA, WEF and AWWA; 2005 Behets J, Declerck P, Delaedt Y, Creemers B, Ollevier F. Development and evaluation of a Taqman duplex real-time PCR quantification method for reliable enumeration of Legionella pneumophila in water samples. J Microbiol Methods 2007;68:137–44. Bej AK, Mahbubani MH, Atlas RM. Detection of viable Legionella pneumophila in water by polymerase chain reaction and gene probe methods. Appl Environ Microbiol 1991; 57:597–600. Bonetta S, Bonetta S, Ferretti E, Balocco F, Carraro E. Evaluation of Legionella pneumophila contamination in Italian hotel water systems by quantitative real-time PCR and culture methods. J Appl Microbiol 2010;108:1576–83. Brooksa T, Osickia RA, Springthorpea VS, Sattara SA, Filiona L, Abrialb D, et al. Detection and identification of Legionella species from groundwaters. J Toxicol Environ Health A 2004;67:1845–59. Declerck P, Behets J, van Hoef V, Ollevier F. Detection of Legionella spp. and some of their amoeba hosts in floating biofilms from anthropogenic and natural aquatic environments. Water Res 2007;41:3159–67. DSMZ. Bacterial nomenclature up-to-date. http://old.dsmz.de/microorganisms/bacterial_ nomenclature_info.php?genus=Legionella, 2013. [acess:11.15. 2013]. Garcia A, Goni P, Cieloszyk J, Fernandez MT, Calvo-Begueria L, Rubio E, et al. Identification of free-living amoebae and amoeba-associated bacteria from reservoirs and water treatment plants by molecular techniques. Environ Sci Technol 2013;47:3132–40. Gomez-Valero L, Rusniok C, Buchrieser C. Legionella pneumophila: population genetics, phylogeny and genomics. Infect Genet Evol 2009;9:727–39. Herpers BL, de Jongh BM, van der Zwaluw K, van Hannen EJ. Real-time PCR assay targets the 23S-5S spacer for direct detection and differentiation of Legionella spp. and Legionella pneumophila. J Clin Microbiol 2003;41:4815–6. Hoge CW, Breiman RF. Advances in the epidemiology and control of Legionella infections. Epidemiol Rev 1991;13:329–40. Hsu BM, Lin CL, Shih FC. Survey of pathogenic free-living amoebae and Legionella spp. in mud spring recreation area. Water Res 2009;43:2817–28. Huang SW, Hsu BM. Survey of Naegleria and its resisting bacteria-Legionella in hot spring water of Taiwan using molecular method. Parasitol Res 2010;106:1395–402. Huang SW, Hsu BM, Wu SF, Fan CW, Shih FC, Lin YC, et al. Water quality parameters associated with prevalence of Legionella in hot spring facility water bodies. Water Res 2010;44:4805–11. Huang SW, Hsu BM, Chen NH, Huang CC, Huang KH, Chen JS, et al. Isolation and identification of Legionella and their host amoebae from weak alkaline carbonate spring water using a culture method combined with PCR. Parasitol Res 2011a;109:1233–41. Huang SW, Hsu BM, Huang CC, Chen JS. Utilization of polymerase chain reaction and selective media cultivation to identify Legionella in Taiwan spring water samples. Environ Monit Assess 2011b;174:427–37. Iatta dR, Cuna T, Napoli C, Giglio OD, Montagna MT. Environmental surveillance and molecular investigation of Legionella spp. in Apulia, in the years 2008–2011. Ann lg 2013; 25:435–41. Joly P, Falconnet PA, Andre J, Weill N, Reyrolle M, Vandenesch F, et al. Quantitative realtime Legionella PCR for environmental water samples: data interpretation. Appl Environ Microbiol 2006;72:2801–8. Kao PM, Tung MC, Hsu BM, Chiu YC, She CY, Shen SM, et al. Identification and quantitative detection of Legionella spp. in various aquatic environments by real-time PCR assay. Environ Sci Pollut Res Int 2013;20:6128–37. Ko KS, Lee HK, Park MY, Lee KH, Yun YJ, Woo SY, et al. Application of RNA polymerase βsubunit gene (rpoB) sequences for the molecular differentiation of Legionella species. J Clin Microbiol 2002a;40:2653–8. Ko KS, Lee HK, Park MY, Park MS, Lee KH, Woo SY, et al. Population genetic structure of Legionella pneumophila inferred from RNA polymerase gene (rpoB) and DotA gene (dotA) sequences. J Bacteriol 2002b;184:2123–30.
421
Koide M, Saito A, Kusano N, Higa F. Detection of Legionella spp. in cooling tower water by the polymerase chain reaction method. Appl Environ Microbiol 1993;59:1943–6. Lin YE, Lu WM, Huang HI, Huang WK. Environmental survey of Legionella pneumophila in hot springs in Taiwan. J Toxicol Environ Health A 2007;70:84–7. Miyamoto H, Yamamoto H, Arima K, Fujii J, Maruta K, Izu K, et al. Development of a new seminested PCR method for detection of Legionella species and its application to surveillance of Legionellae in hospital cooling tower water. Appl Environ Microbiol 1997; 63:2489–94. Ohno A, Kato N, Yamada K, Yamaguchi K. Factors influencing survival of Legionella pneumophila serotype 1 in hot spring water and tap water. Appl Environ Microbiol 2003;69:2540–7. Ortiz-Roque CM, Hazen TC. Abundance and distribution of Legionellaceae in Puerto Rican Waters. Appl Environ Microbiol 1987;53:2231–6. Parthuisot N, West NJ, Lebaron P, Baudart J. High diversity and abundance of Legionella spp. in a pristine river and impact of seasonal and anthropogenic effects. Appl Environ Microbiol 2010;76:8201–10. Percival SL, Chalmers RM, Embrey M, Hunter PR, Sellwood J, Wyn-Jones P. Legionella. Microbiology of waterborne diseases. California, USA: Elsevier Academic Press; 2004. p. 141–53. Qin T, Tian Z, Ren H, Hu G, Zhou H, Lu J, et al. Application of EMA-qPCR as a complementary tool for the detection and monitoring of Legionella in different water systems. World J Microbiol Biotechnol 2012;28:1881–90. Scola BL. Legionella drancourtii sp. nov., a strictly intracellular amoebal pathogen. Int J Syst Evol Microbiol 2004;54:699–703. Sheehan KB, Fagg JA, Ferris MJ, Henson JM. Thermophilic amoebae and Legionella in hot springs in Yellowstone and Grand Teton National Parks. Geothermal Biology and Geochemistry in Yellowstone National Park. Bozeman: Montana State University; 2005. p. 317–24. Su HP, Tseng LR, Tzeng SC, Chou CY, Chung TC. A Legionellosis case due to contaminated spa water and confirmed by genomic identification in Taiwan. Microbiol Immunol 2006;50:371–7. Vinh DC, Garceau R, Martinez G, Wiebe D, Burdz T, Reimer A, et al. Legionella jordanis lower respiratory tract infection: case report and review. J Clin Microbiol 2007;45: 2321–3. Wadowsky RM, Wolford R, McNamara AM, Yee RB. Effect of temperature, pH, and oxygen level on the multiplication of naturally occurring Legionella pneumophila in potable water. Appl Environ Microbiol 1985;49:1197–205. Wang H, Edwards M, Falkinham III JO, Pruden A. Molecular survey of the occurrence of Legionella spp., Mycobacterium spp., Pseudomonas aeruginosa, and amoeba Hosts in two chloraminated drinking water distribution systems. Appl Environ Microbiol 2012;78:6285–94. WHO. Legionella and the prevention of legionellosis. In: Bartram J, Chartier Y, Lee JV, Pond K, Surman-Lee S, editors. Geneva: World Health Organization; 2007. p. 1–252. Winn WC. Legionella. In: Murray PR, Baron EJ, Pfaller MA, Tenover FC, Yolken RH, editors. Manual of clinical microbiology. Washington, D.C.: American Society for Microbiology; 1995. p. 533–44. Wullings BA, van der Kooij D. Occurrence and genetic diversity of uncultured Legionella spp. in drinking water treated at temperatures below 15 degrees C. Appl Environ Microbiol 2006;72:157–66. Wullings BA, Bakker G, van der Kooij D. Concentration and diversity of uncultured Legionella spp. in two unchlorinated drinking water supplies with different concentrations of natural organic matter. Appl Environ Microbiol 2011;77:634–41. Yanez MA, Carrasco-Serrano C, Barbera VM, Catalan V. Quantitative detection of Legionella pneumophila in water samples by immunomagnetic purification and real-time PCR amplification of the dotA gene. Appl Environ Microbiol 2005;71:3433–41. Yanez MA, Nocker A, Soria-Soria E, Murtula R, Martinez L, Catalan V. Quantification of viable Legionella pneumophila cells using propidium monoazide combined with quantitative PCR. J Microbiol Methods 2011;85:124–30. Yaradou DF, Hallier-Soulier S, Moreau S, Poty F, Hillion Y, Reyrolle M, et al. Integrated realtime PCR for detection and monitoring of Legionella pneumophila in water systems. Appl Environ Microbiol 2007;73:1452–6. Zhou G, Wen S, Liu Y, Li R, Zhong X, Feng L, et al. Development of a DNA microarray for detection and identification of Legionella pneumophila and ten other pathogens in drinking water. Int J Food Microbiol 2011;145:293–300.
Contents lists available at ScienceDirect
Science of the Total Environment journal homepage: www.elsevier.com/locate/scitotenv
Application of TaqMan fluorescent probe-based quantitative real-time PCR assay for the environmental survey of Legionella spp. and Legionella pneumophila in drinking water reservoirs in Taiwan Po-Min Kao a, Bing-Mu Hsu a,⁎, Tsui-Kang Hsu b,1, Wen-Tsai Ji a, Po-Hsiang Huang a, Chih-Jen Hsueh c,1, Chuen-Sheue Chiang d, Shih-Wei Huang e, Yu-Li Huang f a
Department of Earth and Environmental Sciences, National Chung Cheng University, Chiayi, Taiwan, ROC Department of Ophthalmology, Cheng Hsin General Hospital, Taipei, Taiwan, ROC c Department of Otorhinolaryngology, Cheng Hsin General Hospital, Taipei, Taiwan, ROC d Research and Diagnostic Center, Centers for Disease Control, Taiwan, ROC e Center for General Education, Cheng-Shiu University, Kaohsiung, Taiwan, ROC f Department of Safety Health and Environmental Engineering, National Kaohsiung First University of Science and Technology, Kaohsiung, Taiwan, ROC b
H I G H L I G H T S • The detection rate was 63.2% (12/19) for Legionella in drinking water reservoirs. • The identified species were L. pneumophila, L. jordanis and L. drancourtii. • The presence of L. pneumophila in reservoir may be a potential public health threat.
a r t i c l e
i n f o
Article history: Received 17 December 2013 Received in revised form 24 April 2014 Accepted 25 April 2014 Available online xxxx Editor: E. Capri Keywords: Legionella spp. Legionella pneumophila Reservoir PCR TaqMan fluorescent quantitative real-time PCR
a b s t r a c t In this study, TaqMan fluorescent quantitative real-time PCR was performed to quantify Legionella species in reservoirs. Water samples were collected from 19 main reservoirs in Taiwan, and 12 (63.2%) were found to contain Legionella spp. The identified species included uncultured Legionella spp., L. pneumophila, L. jordanis, and L. drancourtii. The concentrations of Legionella spp. and L. pneumophila in the water samples were in the range of 1.8 × 102–2.6 × 103 and 1.6 × 102–2.4 × 102 cells/L, respectively. The presence and absence of Legionella spp. in the reservoir differed significantly in pH values. These results highlight the importance that L. pneumophila, L. jordanis, and L. drancourtii are potential pathogens in the reservoirs. The presence of L. pneumophila in reservoirs may be a potential public health concern that must be further examined. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Legionella spp. is a Gram-negative coccobacillus belonging to the gamma-subgroup of proteobacteria and non-spore-forming genus, and is commonly found worldwide in many different anthropogenic and natural aquatic environments such as rivers, hot springs, cooling towers, water systems and spa pools (WHO, 2007; Gomez-Valero et al., 2009). There are 62 species/subspecies belonging to 73 distinct serogroups, and 26 species have been found to cause human pneumonia ⁎ Corresponding author. Tel.: +886 952840868; fax: +886 5 2720807. E-mail address: [email protected] (B.-M. Hsu). 1 Equal contribution to first author: Tsui-Kang Hsu and Chih-Jen Hsueh.
http://dx.doi.org/10.1016/j.scitotenv.2014.04.103 0048-9697/© 2014 Elsevier B.V. All rights reserved.
(WHO, 2007; Gomez-Valero et al., 2009; DSMZ, 2013). Legionella pneumophila and other related Legionella bacteria cause Legionellosis, a disease that emerged in the second half of the 20th century. Legionella spp. is considered an emerging pathogen involved in aquatic environment contamination and cause of Legionnaires' disease (Iatta et al., 2013). Legionellosis, also known as Legion Fever, including Pontiac fever and Legionnaires' disease, is a potentially significant health threat to cigarette smokers, immunosuppressed individuals and chronic lung disease patients (Winn, 1995; Percival et al., 2004). Over 90% of legionellosis cases are caused by infection of L. pneumophila (WHO, 2007; Gomez-Valero et al., 2009). Legionella are found in aquatic environments (hot springs, Spa, whirlpool baths) as symbionts of protists and therefore more research
P.-M. Kao et al. / Science of the Total Environment 490 (2014) 416–421
417
is necessary for investigating the associated risks for public health (Hoge and Breiman, 1991; Su et al., 2006; Lin et al., 2007). The aim of the study was to gain insights into the distribution and occurrence of Legionella spp. and L. pneumophila in 19 reservoirs of Taiwan. The TaqMan fluorescent quantitative real-time PCR assay was used for quantification of Legionella spp. and L. pneumophila in the water samples. Taxonomic classification of Legionella spp. and L. pneumophila was done with DNA sequencing method, and water quality parameters were measured for comparison. The results are presented and discussed with respect to potential risk of infection.
filtration and a differential medium was described in the standard method for the examination of water and wastewater (Methods 9222B) (APHA, 2005). The total coliform cultures were placed in m-Endo LES agar (Difco, USA) at 36 °C for 24 h before counting. Heterotrophic bacteria were cultured on the M-(HPC) heterotrophic plate count agar base measured by the spread plate method (Methods 9215C) (APHA, 2005). The potential effect of water quality parameters on the presence/absence of Legionella spp. were evaluated using STATISTICA® 6.0 (StatSoft, Inc., Tulsa, Oklahoma, USA).
2. Materials and methods
2.2. Water sample concentration and DNA extraction
2.1. Water sample collection and water quality measurements
For each collected water sample, 1 L was concentrated via membrane filtration method using GN-6 Metricel® mixed cellulose ester membranes (0.45 μm pore diameter, Pall, Port Washington, New York, USA). After filtration, the membranes were scraped, and the collected material was washed with 100 mL eluting fluid consisting of phosphate-buffered saline (PBS; 7.5 mM Na2HPO4, 3.3 mM NaH2PO4, 108 mM NaCl, pH 7.2). The resulting solution was then transferred into two 50 mL centrifuge tubes and centrifuged at 2600 ×g for 30 min (KUBOTA-Model 2420 Compact Tabletop Centrifuge, RS-240 swinging bucket rotor, Japan). Subsequently, the top 45 mL supernatant fluid was removed, and the remaining 5 mL pellet was preserved with PBS at 4 °C for further analyses. Total DNA extraction was done with the concentrated pellet (1 mL) using MagNA Pure LC instruments (Roche, USA) with MagNA Pure LC DNA isolation kits III (Roche, USA) following automated mode specified by the kit. The resulting solution (final volume: 100 μL) was analyzed for the presence of Legionella spp. specific genes with PCR and TaqMan realtime quantitative PCR.
A total of 57 water samples were from 19 reservoirs in Taiwan (see Fig. 1). Sample collection was carried out from November 2012 to May 2013. The water samples were collected within 10 cm of the water surface. The 19 reservoirs were of a natural environment with favorable weather conditions for vegetation. All reservoirs are used for drinking water. For each sampling site, 1 L of water sample was placed into sterile 1 L polypropylene bottles and stored at 4 °C transported to the laboratory for subsequent analyses within 24 h. Water quality parameters were measured for each sample on site at the time of sample collection. Turbidity was measured in situ using a ratio turbidimeter (Turb555, WTW, Germany). The pH and water temperature were measured in situ using portable pH meter and thermometer (D-24E, Horiba Co., Kyoto, Japan). Additional water samples were taken from each sampling site in 300 mL sampling bags (Nasco Whirl-Pak, Salida, California, USA) for microbiological water quality parameters. The total coliform were measured by membrane
Fig. 1. The sampling sites in 19 reservoirs of Taiwan.
418
P.-M. Kao et al. / Science of the Total Environment 490 (2014) 416–421
2.3. PCR conditions and nucleotide sequencing analysis The PCR solution was prepared with 3 μL of the DNA templates and PCR mixture to a total volume of 25 μL. The PCR mixture included 2.5 μL 10×PCR buffer (20 mM MgCl2), 0.5 μL 40 mM dNTP, 0.5 μL each of the primer (10 μM), 0.2 μL Taq DNA Polymerase (Viogene, 5 U/μL), and DNase-free deionized water. The PCR assay primers, PCR cycling conditions, and the fragments of target genes used for detecting Legionella spp. and Legionella pneumophila in this study are summarized in Table 1. PCR products of Legionella spp. were identified by gel electrophoresis on a 2% agarose gel (Biobasic Inc., Canada) with 5 μL of the reaction solution. The DNA fragments were confirmed using ethidium bromide staining (0.5 μg/mL, 10 min). A 100 bp DNA ladder was used as a DNA size marker. PCR products were directly sequenced. If the PCR sequencing signals were cluttered, the original sequences were cloned and then sequenced. The sequence analysis was done using a Bio-Dye terminator cycle sequencing kit (Applied Biosystem, USA). Phylogenetic construction produced gene trees by using neighbor-joining distance trees with a generation of 1000 bootstrapped replicates. The gene sequences were assigned to the NCBI GenBank database in order to allow Blast searching and alignment used the MEGA software program version 5.0 (Mega Software, Tempe, Arizona, USA). 2.4. TaqMan fluorescent quantitative real-time PCR assay The quantitative real-time PCR assay was performed using an ABI StepOneTM Real-Time PCR Systems (Applied Biosystems, Singapore) with a total reaction volume of 20 μL. Each reaction mix contained 3.5 μL sterile PCR grade deionized water, 0.5 μL each of the primer, 0.5 μL TaqMan probe, 10 μL Probes mix, and 5 μL template DNA. The quantitative real-time PCR assay primers, cycling conditions, and the fragments of target genes used for detecting Legionella spp. and L. pneumophila are shown in Table 2. For each assay, the threshold cycle (Ct) value, defined as the quantitative real-time PCR cycle at which the fluorescence signal exceeded the background threshold, was determined to quantify each DNA product. Negative DNA controls (template DNA replaced by double distilled water) and positive control DNA (L. pneumophila ATCC 43661) were included with each quantitative PCR run. A Taqman® Exogenous Internal Positive Control (IPC, Applied Biosystems) was co-amplified in each qPCR reaction with target DNA, according to the manufacturers' instruction. 2.5. Standard curve of 23S-5S rRNA and mip gene The yT&A clone vector kit (Yeasterm Biotech Corporation, Taipei, Taiwan) was used to determine the Legionella 23S-5S rRNA and mip gene copy number. Recombinant plasmid DNA was purified in triplicates using a HiYield™ plasmid mini kit (Real Biotech Corporation, Taipei, Taiwan). Following purification, the concentration of plasmid DNA was determined using a NanoDrop ND1000 spectrophotometer (NanoDrop Technologies, Wilmington, Delaware, USA). The number
of construct copies in the plasmid solution was calculated based on plasmid and insert sizes. A plasmid-based standard curve was generated with 10-fold serial dilutions of plasmid containing the 23S5S rRNA and mip gene sequence of the target. The standard curve, with a concentration of 2.7 × 107 copies/μL (23S-5S rRNA gene) and 3.5 × 108 copies/μL (mip gene) for the dilution with the highest copy number, was used for determining the copy number of the 23S-5S rRNA and mip gene in Legionella spp. and L. pneumophila. 3. Results and discussion 3.1. Detection and quantification of Legionella spp. and L. pneumophila Legionella spp. and L. pneumophila were detected in 12 (63.2%) and 4 (21.1%) of the 19 reservoirs, as shown in Table 3. The results indicated that L. pneumophila can be found in reservoirs in Taiwan. The drinking water source area is less likely to be affected by domestic wastewater and livestock sewage. Therefore, periodic clearing and monitoring of the reservoir will be necessary to avoid Legionella contamination in the future. In previous literatures, Legionella spp. and L. pneumophila have been found in various aquatic environmental ecosystems worldwide. For instance, the detection rate of river water samples for Legionella spp. was 17.9% in Taiwan (Huang et al., 2011a) and 20.8% in France (Parthuisot et al., 2010). In hot springs, the detection rate was reported at 8.7% in USA (Sheehan et al., 2005) and 17.9–47.1% in Taiwan (Hsu et al., 2009; Huang et al., 2010, 2011a,b; Huang and Hsu, 2010) In Spain (Garcia et al., 2013) and China (Zhou et al., 2011), the reported detected rate for L. pneumophila in drinking water samples was 13.9% and 16.6%, respectively. The above literatures suggested that the detection rate of Legionella spp. in the aquatic environment may be influenced by detection methods, water types and sources, geographical areas and conditions, and the diversity of ecological locations around the world. In this study, the detection rate of Legionella spp. and L. pneumophila was higher than previously reported from the aquatic environment. Accordingly, their potential impact on human health should not be overlooked. Quantification of Legionella spp. in reservoirs can help us to better understand Legionella contamination condition and potential threat to human health. Therefore, investigative and monitoring program to quantify the density of Legionella in the aquatic environment is important with respect to characterizing potential human exposure in the aquatic environments, which could be achieved by TaqMan fluorescent probe-based quantitative real-time PCR. The quantitative results of real-time PCR assays for Legionella-positive water samples in this study are shown in Table 3. The equation from the regression curve was: Ct = − 3.28 log [23S-5S rRNA gene copy number] + 34.65 (R2 = 0.994) and −3.19 [mip gene copy number] + 39.33 (R2 = 0.998). For the 12 Legionella-positive reservoir water samples, the Ct values were in the range of 31.7–34.5. The Legionella concentration was estimated based on the assumption of one gene copy per cell (Koide et al., 1993; Herpers et al., 2003; Wang et al., 2012). Legionella spp. and
Table 1 Description of the primers used in PCR of Legionella spp. and L. pneumophila. Pathogen
Target gene
Primer name
Primer sequences (5′–3′)
Predenaturation, denaturation, annealing, extension, and final extension temperature (°C)/reaction time (s)
Cycling no.
Amplicon size (bp)
Source
Legionella
16S rRNA
LEG 225 LEG 858
95/600, 95/30, 58/60, 72/60, 72/300
35
654
Miyamoto et al. (1997)
L. pneumophila
mip
LmipL920 LmipR1548
95/600, 95/60, 62/60, 72/60, 72/300
40
650
Bej et al. (1991)
rpoB
RL1 RL2 DL1 DL2
AAGATTAGCCTGCGTCCGAT GTCAACTTATCGCGTTTGCT GCTACAGACAAGGATAAGTTG GTTTTGTATGACTTTAATTCA GATGATATCGATCAYCTDGG TTCVGGCGTTTCAATNGGAC TTGATTTGGTGAAACTCAATGG CAATCAAAATCCTGGTGCTTC
95/600, 95/30, 55/60, 72/60, 72/300
40
369
Ko et al. (2002a)
95/600, 95/30, 50/30, 72/30, 72/300
40
434
Ko et al. (2002b)
dotA
P.-M. Kao et al. / Science of the Total Environment 490 (2014) 416–421
419
Table 2 Description of the primers used in real-time PCR of Legionella spp. and L. pneumophila. Pathogen
Target gene
Primer name
Primer sequences (5′–3′)
Denaturation, annealing, and extension temperature (°C)/reaction time (s)
Cycling no.
Amplicon size (bp)
Source
Legionella
23S-5S rRNA
45
259
Herpers et al. (2003)
mip
CTAATTGGCTGATTGTCTTGAC GGCGATGACCTACTTTCG VIC-CGAACTCAGAAGTGAAAC TTCATTTGYTGYTCGGTTAAAGC AWTGGCTAAAGGCATGCAAGAC FAM-ATCGTGTAAACTCTGACTCTTT ACCAAACCTGTGG
95/600, 95/15, 60/60
L. pneumophila
LegF LegR Leg Probe LPQF LPQR mip Probe
95/600, 95/15, 60/60
45
66
Behets et al. (2007)
L. pneumophila concentrations were in the range of 1.8 × 102 – 2.6 × 103 cells/L and 1.6 × 102–2.4 × 102 cells/L, respectively. In earlier studies, concentrations of Legionella spp. in river water samples were in the range of 1 × 104–1 × 108 cells/L (Ortiz-Roque and Hazen, 1987; Parthuisot et al., 2010; Kao et al., 2013). Legionella spp. and L. pneumophila in tap water samples were in the range of 6.1 × 101– 8.5 × 105 cells/L (Joly et al., 2006; Wullings and van der Kooij, 2006; Declerck et al., 2007; Yaradou et al., 2007; Wullings et al., 2011; Yanez et al., 2011) and 1.7 × 101–3.1 × 105 cells/L (Yanez et al., 2005; Joly et al., 2006; Behets et al., 2007; Yaradou et al., 2007; Bonetta et al., 2010; Wullings et al., 2011). Legionella spp. in hot spring samples were in the range of 0.3 × 101–2.1 × 106 cells/L (Qin et al., 2012; Kao et al., 2013). In this study, concentrations of Legionella spp. were similar to those reported in previous studies in the aquatic environments. The detection rate for Legionella spp. was 63.2% and the mean concentrations of L. pneumophila were 1.9 × 102 cells/L in reservoirs. The results suggested that these reservoirs might be a potential source for Legionella contamination in domestic drinking water supplies. Relevant drinking water supply facilities and health authorities should be aware of these possible hazards. It may also be necessary to ensure adequate treatment efficiency of drinking water treatment plants when considering Legionella spp. infection risk. 3.2. Identification of Legionella spp. All Legionella-positive water samples detected by PCR were subjected to DNA sequencing for species identification. The DNA sequences of sample strains were compared with Legionella reference strains from the NCBI GenBank to determine the likelihood of specific strains (above 99% sequence identity). Neighbor-joining analysis was used to
infer relationships between the reservoir isolates in this study and reference strains (Fig. 2). The identified Legionella species from reservoir water samples were uncultured Legionella sp. (n = 7), L. pneumophila (n = 4), L. jordanis (n = 2), and L. drancourtii (n = 1). Strains from sampling sites A and S were identified as L. jordanis (EF036512) and L. pneumophila (FR799709). L. jordanis was first isolated from a bronchoalveolar lavage specimen from a patient with an indolent lower respiratory tract infection associated with constitutional symptoms in Canada (Vinh et al., 2007), and L. pneumophila was first isolated from Emilia-Romagna Area of Italy. Strains from sites E and G were identified as L. pneumophila (FR799709). Strain at site H water sample was identified as L. drancourtii LLAP12 (NR026335), which was isolated from an environmental water source in West Yorkshire, UK (Scola, 2004). For sampling sites B, C and F, the strain was identified as uncultured Legionella sp. (HQ112007), which was first isolated from environmental biofilm sample from the distribution system of treated anaerobic groundwater in Netherlands (Wullings et al., 2011). Sampling sites I, K, O and R were found with uncultured Legionella sp. (AY924058), which was first isolated from environmental surface water samples in Netherlands (Wullings and van der Kooij, 2006). The results showed that Legionella is present and widespread in Taiwan's reservoirs. Of the 12 sampling sites containing Legionella, 5 samples (41.7%) contained pathogenic species including L. pneumophila (33.3%), L. jordanis (16.7%), and L. drancourtii (8.3%). Among the pathogenic species, L. pneumophila is the most pathogenic, causing more than 80% of the legionellosis outbreaks worldwide (Brooksa et al., 2004; Yanez et al., 2005; Declerck et al., 2007). The results also provided evidence that there is potentially a health risk associated with Legionella contamination in the domestic drinking water supply in these water areas. Therefore, long-term monitoring on the prevalence
Table 3 Detection results of Legionella-positive water samples in various reservoirs. Sampling site
Longitude/latitude
Positive sample
DNA sequencing result
Ct value
Cell number (cells/L)
A
121.7104, 25.1336
+
B C D E F G H I J K L M N O P Q R S
121.7356, 25.0872 121.2424, 24.8035 121.0569, 24.7460 121.0648, 24.7328 120.8848, 24.5804 120.7965, 24.3402 121.1686, 24.2547 121.1364, 23.9831 120.9105, 23.8609 120.9135, 23.8362 120.4797, 23.4681 120.5126, 23.4654 120.4755, 23.3553 120.3768, 23.2116 120.3443, 22.8151 120.3567,22.6563 120.3922, 22.5410 120.7813, 22.1338
+ + ND + + + + + ND + ND ND ND + ND ND + +
L. jordanis L. pneumophila u. Legionella sp. u. Legionella sp.
– 34.5 32.3 –
– 1.6 × 102 1.5 × 103 –
L. pneumophila u. Legionella sp. L. pneumophila L. drancourtii u. Legionella sp.
– 32.3 34.5 – 31.9
– 1.5 × 103 1.6 × 102 – 2.1 × 103
u. Legionella sp.
34.4
1.8 × 102
u. Legionella sp.
31.9
2.1 × 103
u. Legionella sp. L. jordanis L. pneumophila
31.7 – 33.9
2.6 × 103 – 2.4 × 102
ND, not detected. –, not enough DNA sample added to the real-time PCR.
420
P.-M. Kao et al. / Science of the Total Environment 490 (2014) 416–421
G 100 S2
E A2 L. pneumophila (FR799709) H 100 L. drancourtii (NR026335)
L. sp. (JN380997)
77
100 A1
S1 L. jordanis (EF036512) u. Legionella sp. (HQ112007) B
93 100
C F
L. londiniensis (NR044963) u. Legionella sp. (AY924157) O
99 100
R u. Legionella sp.(AY924058)
76
I
86
100 K
0.01 Fig. 2. Phylogenetic relationship of Legionella species PCR products and reference strains from NCBI GenBank inferred by neighbor-joining analysis in reservoir water samples.
of Legionella spp. may be necessary to prevent further infestations in Taiwan's reservoirs. 3.3. Relationships among water quality parameters and Legionella Mann–Whitney U test of statistical analyses was performed to detect differences in water quality parameters between Legionellapositive/negative water samples. Results of the above nonparametric tests are presented in Table 4. No significant differences were observed between the positive/negative samples of Legionella spp. with respect to turbidity, total coliforms, water temperature and heterotrophic plate counts. On the other hand, significant difference (P b 0.05) was found between the positive/negative of Legionella spp. and pH value. The result supported previous reports of significant difference between pH value and Legionella spp. in the aquatic environment (Huang and Hsu, 2010; Huang et al., 2011a; Wang et al., 2012; Kao et al., 2013). Furthermore, for water samples with L. pneumophila, the pH value in
the reservoir ranged from 7.1 to 8.3. In previous reports, naturally occurring L. pneumophila multiplied at pH values of 5.5 to 9.2 (Wadowsky et al., 1985). Further, Ohno et al. reported that the optimal pH values for L. pneumophila in an aquatic environment ranged from 6.0 to 8.0 (Ohno et al., 2003), which was in agreement with the results in this study. 4. Conclusions In this study, the presence of Legionella spp. was investigated in 19 reservoirs in Taiwan. The total detection rate was 63.2% (12/19), and the identified species were L. pneumophila, L. jordanis and L. drancourtii. The mean concentration of Legionella spp. and L. pneumophila was 1.7 × 103 and 1.9 × 102 cells/L, respectively. Significant differences were found between the presence/absence of Legionella spp. with pH value. Legionella spp. in reservoirs in Taiwan may be a potential public health concern and should be further examined.
Table 4 Nonparametric test results for difference for Legionella in term of water quality parameters. Water quality parameter
HPC (CFU/mL) Total coliforms (CFU/100 mL) Temperature (°C) Turbidity (NTU) pH ⁎ P b 0.05.
Mann–Whitney U test
P P P P P
= = = = =
0.763 0.985 0.918 0.720 0.028⁎
Legionella-positivity samples (n = 12)
Legionella-negativity samples (n = 47)
Mean (range)
Mean (range)
7.2 × 103 (3.7 × 102–1.87 × 104) 3.9 × 103 (0–6.5 × 103) 23.1 (16.9–28) 6 (1–45) 8.11 (7–9.4)
6.4 × 103 (2.0 × 102–1.97 × 104) 3.5 × 103 (0–8.7 × 103) 23.1 (18–32) 3.7 (1–60) 8.25 (7.7–8.9)
P.-M. Kao et al. / Science of the Total Environment 490 (2014) 416–421
Acknowledgments This work was supported by a research grant from the National Science Council (NSC 102-2116-M-194-006) and Cheng Hsin General Hospital (102-27) of Taiwan, ROC. References APHA. Standard method for the examination of water and wastewater. Washington DC.: APHA, WEF and AWWA; 2005 Behets J, Declerck P, Delaedt Y, Creemers B, Ollevier F. Development and evaluation of a Taqman duplex real-time PCR quantification method for reliable enumeration of Legionella pneumophila in water samples. J Microbiol Methods 2007;68:137–44. Bej AK, Mahbubani MH, Atlas RM. Detection of viable Legionella pneumophila in water by polymerase chain reaction and gene probe methods. Appl Environ Microbiol 1991; 57:597–600. Bonetta S, Bonetta S, Ferretti E, Balocco F, Carraro E. Evaluation of Legionella pneumophila contamination in Italian hotel water systems by quantitative real-time PCR and culture methods. J Appl Microbiol 2010;108:1576–83. Brooksa T, Osickia RA, Springthorpea VS, Sattara SA, Filiona L, Abrialb D, et al. Detection and identification of Legionella species from groundwaters. J Toxicol Environ Health A 2004;67:1845–59. Declerck P, Behets J, van Hoef V, Ollevier F. Detection of Legionella spp. and some of their amoeba hosts in floating biofilms from anthropogenic and natural aquatic environments. Water Res 2007;41:3159–67. DSMZ. Bacterial nomenclature up-to-date. http://old.dsmz.de/microorganisms/bacterial_ nomenclature_info.php?genus=Legionella, 2013. [acess:11.15. 2013]. Garcia A, Goni P, Cieloszyk J, Fernandez MT, Calvo-Begueria L, Rubio E, et al. Identification of free-living amoebae and amoeba-associated bacteria from reservoirs and water treatment plants by molecular techniques. Environ Sci Technol 2013;47:3132–40. Gomez-Valero L, Rusniok C, Buchrieser C. Legionella pneumophila: population genetics, phylogeny and genomics. Infect Genet Evol 2009;9:727–39. Herpers BL, de Jongh BM, van der Zwaluw K, van Hannen EJ. Real-time PCR assay targets the 23S-5S spacer for direct detection and differentiation of Legionella spp. and Legionella pneumophila. J Clin Microbiol 2003;41:4815–6. Hoge CW, Breiman RF. Advances in the epidemiology and control of Legionella infections. Epidemiol Rev 1991;13:329–40. Hsu BM, Lin CL, Shih FC. Survey of pathogenic free-living amoebae and Legionella spp. in mud spring recreation area. Water Res 2009;43:2817–28. Huang SW, Hsu BM. Survey of Naegleria and its resisting bacteria-Legionella in hot spring water of Taiwan using molecular method. Parasitol Res 2010;106:1395–402. Huang SW, Hsu BM, Wu SF, Fan CW, Shih FC, Lin YC, et al. Water quality parameters associated with prevalence of Legionella in hot spring facility water bodies. Water Res 2010;44:4805–11. Huang SW, Hsu BM, Chen NH, Huang CC, Huang KH, Chen JS, et al. Isolation and identification of Legionella and their host amoebae from weak alkaline carbonate spring water using a culture method combined with PCR. Parasitol Res 2011a;109:1233–41. Huang SW, Hsu BM, Huang CC, Chen JS. Utilization of polymerase chain reaction and selective media cultivation to identify Legionella in Taiwan spring water samples. Environ Monit Assess 2011b;174:427–37. Iatta dR, Cuna T, Napoli C, Giglio OD, Montagna MT. Environmental surveillance and molecular investigation of Legionella spp. in Apulia, in the years 2008–2011. Ann lg 2013; 25:435–41. Joly P, Falconnet PA, Andre J, Weill N, Reyrolle M, Vandenesch F, et al. Quantitative realtime Legionella PCR for environmental water samples: data interpretation. Appl Environ Microbiol 2006;72:2801–8. Kao PM, Tung MC, Hsu BM, Chiu YC, She CY, Shen SM, et al. Identification and quantitative detection of Legionella spp. in various aquatic environments by real-time PCR assay. Environ Sci Pollut Res Int 2013;20:6128–37. Ko KS, Lee HK, Park MY, Lee KH, Yun YJ, Woo SY, et al. Application of RNA polymerase βsubunit gene (rpoB) sequences for the molecular differentiation of Legionella species. J Clin Microbiol 2002a;40:2653–8. Ko KS, Lee HK, Park MY, Park MS, Lee KH, Woo SY, et al. Population genetic structure of Legionella pneumophila inferred from RNA polymerase gene (rpoB) and DotA gene (dotA) sequences. J Bacteriol 2002b;184:2123–30.
421
Koide M, Saito A, Kusano N, Higa F. Detection of Legionella spp. in cooling tower water by the polymerase chain reaction method. Appl Environ Microbiol 1993;59:1943–6. Lin YE, Lu WM, Huang HI, Huang WK. Environmental survey of Legionella pneumophila in hot springs in Taiwan. J Toxicol Environ Health A 2007;70:84–7. Miyamoto H, Yamamoto H, Arima K, Fujii J, Maruta K, Izu K, et al. Development of a new seminested PCR method for detection of Legionella species and its application to surveillance of Legionellae in hospital cooling tower water. Appl Environ Microbiol 1997; 63:2489–94. Ohno A, Kato N, Yamada K, Yamaguchi K. Factors influencing survival of Legionella pneumophila serotype 1 in hot spring water and tap water. Appl Environ Microbiol 2003;69:2540–7. Ortiz-Roque CM, Hazen TC. Abundance and distribution of Legionellaceae in Puerto Rican Waters. Appl Environ Microbiol 1987;53:2231–6. Parthuisot N, West NJ, Lebaron P, Baudart J. High diversity and abundance of Legionella spp. in a pristine river and impact of seasonal and anthropogenic effects. Appl Environ Microbiol 2010;76:8201–10. Percival SL, Chalmers RM, Embrey M, Hunter PR, Sellwood J, Wyn-Jones P. Legionella. Microbiology of waterborne diseases. California, USA: Elsevier Academic Press; 2004. p. 141–53. Qin T, Tian Z, Ren H, Hu G, Zhou H, Lu J, et al. Application of EMA-qPCR as a complementary tool for the detection and monitoring of Legionella in different water systems. World J Microbiol Biotechnol 2012;28:1881–90. Scola BL. Legionella drancourtii sp. nov., a strictly intracellular amoebal pathogen. Int J Syst Evol Microbiol 2004;54:699–703. Sheehan KB, Fagg JA, Ferris MJ, Henson JM. Thermophilic amoebae and Legionella in hot springs in Yellowstone and Grand Teton National Parks. Geothermal Biology and Geochemistry in Yellowstone National Park. Bozeman: Montana State University; 2005. p. 317–24. Su HP, Tseng LR, Tzeng SC, Chou CY, Chung TC. A Legionellosis case due to contaminated spa water and confirmed by genomic identification in Taiwan. Microbiol Immunol 2006;50:371–7. Vinh DC, Garceau R, Martinez G, Wiebe D, Burdz T, Reimer A, et al. Legionella jordanis lower respiratory tract infection: case report and review. J Clin Microbiol 2007;45: 2321–3. Wadowsky RM, Wolford R, McNamara AM, Yee RB. Effect of temperature, pH, and oxygen level on the multiplication of naturally occurring Legionella pneumophila in potable water. Appl Environ Microbiol 1985;49:1197–205. Wang H, Edwards M, Falkinham III JO, Pruden A. Molecular survey of the occurrence of Legionella spp., Mycobacterium spp., Pseudomonas aeruginosa, and amoeba Hosts in two chloraminated drinking water distribution systems. Appl Environ Microbiol 2012;78:6285–94. WHO. Legionella and the prevention of legionellosis. In: Bartram J, Chartier Y, Lee JV, Pond K, Surman-Lee S, editors. Geneva: World Health Organization; 2007. p. 1–252. Winn WC. Legionella. In: Murray PR, Baron EJ, Pfaller MA, Tenover FC, Yolken RH, editors. Manual of clinical microbiology. Washington, D.C.: American Society for Microbiology; 1995. p. 533–44. Wullings BA, van der Kooij D. Occurrence and genetic diversity of uncultured Legionella spp. in drinking water treated at temperatures below 15 degrees C. Appl Environ Microbiol 2006;72:157–66. Wullings BA, Bakker G, van der Kooij D. Concentration and diversity of uncultured Legionella spp. in two unchlorinated drinking water supplies with different concentrations of natural organic matter. Appl Environ Microbiol 2011;77:634–41. Yanez MA, Carrasco-Serrano C, Barbera VM, Catalan V. Quantitative detection of Legionella pneumophila in water samples by immunomagnetic purification and real-time PCR amplification of the dotA gene. Appl Environ Microbiol 2005;71:3433–41. Yanez MA, Nocker A, Soria-Soria E, Murtula R, Martinez L, Catalan V. Quantification of viable Legionella pneumophila cells using propidium monoazide combined with quantitative PCR. J Microbiol Methods 2011;85:124–30. Yaradou DF, Hallier-Soulier S, Moreau S, Poty F, Hillion Y, Reyrolle M, et al. Integrated realtime PCR for detection and monitoring of Legionella pneumophila in water systems. Appl Environ Microbiol 2007;73:1452–6. Zhou G, Wen S, Liu Y, Li R, Zhong X, Feng L, et al. Development of a DNA microarray for detection and identification of Legionella pneumophila and ten other pathogens in drinking water. Int J Food Microbiol 2011;145:293–300.
