Arrest of bacterial DNA replication.

ANNUAL REVIEWS

Further

Quick links to online content Annu. Rev. Microbiol. Copyright

© 1992

1992. 46:603-33

by Annual Reviews Inc. All rights reserved

ARREST OF BACTERIAL DNA Annu. Rev. Microbiol. 1992.46:603-633. Downloaded from www.annualreviews.org Access provided by Oregon State University on 01/22/15. For personal use only.

REPLICATION Thomas M. Hill

Department of Bioscience and Biotechnology, Drexel University, Philadelphia, Penn sylvania 191104

KEY WORDS:

termination, prokaryotic

CONTENTS Abstract...... ... . ...... .................................. ... ...... ............ . ... . ........... ...... INTRODUCTION ............. . . . . ................................... . . . . . . . . . . ............. . . . . . . . ...

BACILLUS SUBTlUS .......... .. . . .............. . . . ....... ...... . . .. ........... . . . ............. The Replication Terminus ...... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ......... . . . . . . . . . . . .

.

..

.

Future Prospects.................................................................................. .. . .................................................... ........... The Ter Sites ....... . ................ . . .......... . . . . . . . . . . . ......... . . . . . . . . . . . . . . . . ....... . . . . . . . The Tus Protein...................................................................................

ESCHERICHIA COll .......

. . . . . .

.

The Replication-Arrest Complex...............................................................

Why Do Ter Sites Exist? . .. . . ...................................................... Future Prospects.................................................................................. .

.

. . . . .

.

. . . .

603 604 604 604 61 1 612 614 618 620 625 627

Abstract The chromosomes of both gram-positive and gram-negative bacteria contain sites that a1Test the progression of DNA replication forks. These replication arrest sites limit the end of the replication cycle to a particular region of the chromosome, called the terminus region. Replication arrest is mediated by protein-DNA complexes that show polarity of function: they arrest DNA replication from one direction only. This paper reviews our current knowl edge of the replication-arrest complexes of Bacillus subtilis and Escherichia coli and examines possibilities for the function and mechanism of action of these complexes within the bacterial cell. 603

0066-4227/92/ 1 00 1 -0603$02.00

604

HILL

Annu. Rev. Microbiol. 1992.46:603-633. Downloaded from www.annualreviews.org Access provided by Oregon State University on 01/22/15. For personal use only.

INTRODUCTION

In the four decades that have passed since Watson & Crick published the structure of DNA, the overwhelming majority of research on DNA replication has focused on events that occur at replication origins during initiation and on the characterization of established , elongating replication forks. In recent years , interest has shifted to include the process of termination of DNA replication, which is defined here as the sequence of events that occur when two converging replication forks meet and conclude a cycle of DNA replica tion. To a large degree , the increased interest in replication termination is due to significant advances in describing and characterizing sites in bacterial chromosomes that arrest the progression of replication forks . The discovery of these replication arrest systems, along with the identification of new topoisomerases in Escherichia coli tha t possibly play a role in chromosome decatenation or partitioning ( 1 8, 44, 63), the isolation of mutants in the partitioning apparatus (38) , and the characterization of genes controlling cell division (reviewed in 1 6) have combined to make the events surrounding the conclusion of the DNA replication cycle and the onset of cell division one of the most exciting and active areas of prokaryotic research. In the strictest sense, the identification and characterization of sites that arrest DNA replication in bacterial chromosomes do not provide us with information about the events that occur at termination of replication per se, but only about the interaction of the replication arrest components with the replication fork . This distinction is made because the word "termination" as described above is often used interchangeably with the phrase "replication arrest," which is defined here as the inhibition of replication-fork progression. In reality , the process of replication arrest is only one step of many during the term in at ion process. That replication arrest is not synonymous with replica tion termination is evidenced by: (a) replication termination occurs in the E. coli chromosome at locations other than the replication arrest sites and (b) in both E. coli and Bacillus subtilis, inactivation of sites that arrest DNA replication has no apparent effect on cell growth, suggesting that replication termination proceeds normally in the absence of functional arrest sites. Con sequently, this review is restricted to a discussion of replication arrest in prokaryotes and focuses exclusively on the DNA-binding proteins and specif ic DNA sequences of B . subtilis and E . coli that halt DNA replication. BACILLUS SUBT/LIS The Replication Terminus

Many of the ground-breaking experiments that characterized bacterial replica tion arrest came in Bacillus subtilis, particularly from the laboratory of R . G .


ARREST OF DNA REPLICATION

605

Wake. These studies eventually led to the identification of two components of the B . subtilis replication arrest system, the inverted repeat region (lRR) of the chromosome (containing the DNA sequences IR I and IR II) and the DNA-binding replication terminator protein (RTP) , which associates with IR I and IR II. Although many characteristics of the replication-arrest systems of B . subtilis and E. coli are shared, several striking dissimilarities suggest that the mechanics of replication inhibition in these two systems are decidedly different. B idirectional replication of the chromosome of the gram-positive, spore forming eubacterium B . subtilis is initiated from a unique origin located near the purA gene and ends when the two replication forks meet on the opposite side of the circular chromosome in the vicinity of the gltA and citK loci (25 , 40) . Thc region where forks converge has been designated the chromosomal terminus, or terC . Evidence that this region of the chromosome was not simply the place where replication forks met most often came from genetic studies of B . subtilis strain GSY 1 1 27, which contains a nontandem duplica tion of 25% of the counterclockwise-replicated arm of the chromosome. This duplication results in an asymmetric chromosome, placing an ilvC marker directly opposite the origin of replication and shifting the terC region con siderably closer to oriC on the clockwise-replicated arm of the chromosome. Using this strain, O'Sullivan & Anagnotopoulos (72) qetermined transforma tion frequencies for genetic markers on both arms of the chromosome during spore outgrowth. They observed that the gltAlcitK region, or terC, was replicated after ilvC, even though the clockwise replication fork should have arrived at terC well before the counterclockwise fork reached ilvC . This result suggested that clockwise replication was specifically inhibited at the normal replication terminus near gilA rather than at a point halfway around the chromosome. Further characterization of the interesting properties displayed by terC required an accurate physical map of the region. By taking advantage of certain properties of the sporulation process , investigators could radioactively label only terminus-region DNA, permitting an unambiguous restriction map of approxiimately 200 kb of the terminus region to be constructed (67 , 84) . In addition to providing a map of the terminus region, this study helped establish a more precise determination of the site of replication arrest. Careful analysig of the incorporation of label into the various restriction fragments showed that one side of the terminus region was labeled to a much greater extent than the other and that the level of incorporation shifted abruptly at one particular position. Based on these results , Weiss & Wake proposed that the clockwise traveling replication fork arrived at terC five minutes in advance of the counterclockwise replication fork and that an impediment to the progression of the clockwise replication fork was located in a 24. 8-kb BamHI restriction


606

HILL

fragment (84, 85) . Furthermore , they speculated that arrest of replication at tere should transiently produce a Y-structure in the tere restriction fragment during the period between inhibition of the clockwise replication fork and arrival of the counterclockwise fork. This Y-structure should be distinguish able from the normal , linear tere restriction fragment on the basis of different mobilities during electrophoresis. This was indeed the case, as Southern blots of BamHI-digested DNA from strains 168 (wild-type) and GSY 1 1 27 both showed two bands that hybridized to a (ere probe: the 24 . 8-kb tere linear fragment and a second, more slowly migrating band (86) . This slowly migrat ing band was later characterized as a Y -structure containing an arrested replication fork 1 5 . 4 kb from one end (26, 87) . These results, in combination with studies localizing the position of the Y-junction to a 1 . 75-kb restriction fragment (8 1 ) demonstrated for the first time that replication arrest in a bacterial chromosome occurred at a very specific position. The {ere region does not appear to be necessary for vegetative growth or sporulation of B. subtilis, as determined by stUdying the growth characteris tics of strains in which the terminus region was deleted. Several strains containing deletions that originated in the SPI3 prophage and removed the citK and gltA loci (92) were characterized in order to define the endpoints of the deletions (42) . The junction fragment of the smallest deletion was identified, demonstrating conclusively that 230 kb of terminus-region DNA, including tere, were removed in this strain. When the growth rate and morphology of this deletion strain was compared to wild-type cells, no difference was observed, indicating that vegetative growth was undisturbed by loss of (ere. However, this deletion strain did not sporulate. The inability to sporulate may have been a direct result of (ere loss, or could have resulted from elimination of other sporulation genes in the 230-kb deletion. To determine if loss of tere had a specific effect on sporulation, another deletion strain was constructed that only removed 1 1 . 2 kb, including the (ere region . This strain showed normal vegetative growth characteristics and could sporulate as well, indicat ing that (ere was dispensable for the sporulation process (42) . When the nucleotide sequence of the region in B. subtilis strain 168 containing tere was determined, the most striking feature was the presence of two large imperfect, inverted repeats of 47-48 nucleotides ( 1 2) . These inverted repeats, designated IR I and IR II, shared 77% identity, were separated by 59 nucleotides , and were located between two open reading frames (ORFs) (see Figure I). A more precise determination of the site where the clockwise replication fork was im mobilized placed the Y-structure junction in the vicinity of IR II, suggesting that these inverted repeats played a major role in the inhibition of replication ( 1 2). This supposition was confirmed when a series of deletions in the (ere THE INVERTED REPEAT REGION AND RTP


�

I

_cw

I

TATAATAG��AACTATGTACCAAATGrrCAGTCGAAATTAATTTTCTT C -10


rtp

IRR

ORF

ccw_

A

po

B

IR I

/

,

I

GGAAAACAATAAAAGAAAATTGAA�ACATAGTG!TTGTCAGT.GACAGAAGA

IRII

-

Figure 1

607

B

A

S.D.

Met. ..

The TerC region of the E. subtilis chromosome. The direction of movement of

clockwise (CW) and counterclockwise (CCW) replication forks as they approach the Tere region are indicated by the arrows. The rtp gene encodes a DNA-binding protein that binds to the inverted repeats IR I and IR II (denoted by the heavy bar b eneath the two sequences), which are located within the inverted repeat region (lRR). The single bracket above the IR I sequence indicates the region protected from DNase I treatment by RTP binding. The double bracket above the IR II sequence indicates the regions protected from DNase I digestion at low and h igh

c oncentrations of RTP. The bracket covering the 41 nucleotides on the right half of IR II indicates that they are protected at relatively low RTP concentrations 0.3 centrations of RTP (2.5

x

10-8

x

10-8

M); at higher con

M), 12 additional nucleotides on the left half of IR II are

protected b y RTP binding. The boxed nucleotides labeled A and B are the proposed recognition sequences for RTP binding within the inverted repeats IR I and IR II. The underlined nucleotides

l abeled

-10

..

S.D., and Met indicate promoter sequences, Shine-Delgarno sequences, and the

start codon, respectively, for the rtp gene.

region were constructed and crossed into the chromosome of GSY1 l27 (82) . Deletions starting on the left side of the terC region (as depicted in Figure 1 ) that removed the left ORF and extended up to, but did not include I R I, had no effect on replication arrest. However, deletions that removed IR I, but not IR II or the right ORF, abolished the impediment to replication, indicating that IR I was a necessary component of the terC fragment. The IR elements alone, however, were not sufficient to halt replication forks. Delc�tions that started on the right side of the terC region and extended into the right ORF, but did not remove either IR II or IR I, also abolished replication arrest. This suggested that the protein product of this gene was required for inhibition of replication, possibly as a DNA-binding prote in that associated with the IR elements (82). In an effort to confirm the importance of this gene, which has been designated rtp (replication terminator protein) ,


608

HILL

Lewis & Wake (57) sequenced the tere region of strain W23, whose genome has 67-89% DNA sequence homology to the chromosome of strain 1 68 (62, 78) . Although there were 22 substitutions in the 366 bases of the W23 rtp gene, the amino acid sequence was identical to that of the rtp gene of strain 1 6 8 , suggesting that function of the protein was conserved between the two strains. This study also identified a putative promoter for the rtp gene for both strains, with the -10 box positioned just three bases 5' of IR I (Figure 1 ) . IR I and IR II are therefore located between the promoter and the start codon of the rtp gene, raising the possibility that expression of this gene is autoregulated (82) . Based on the DNA sequence of the rtp gene , the replication terminator protein is a small , basic polypeptide of 1 22 amino acids with a calculated pI of 9.2. RTP shows homology to the DnaB protein of B. subtilis (49), which is involved in initiation of DNA replication and is not to be confused with the DnaB protein of E. coli, which is the major replicative helicase . The homolo gy shared by RTP and DnaB may be part of a DNA-binding domain or could indicate a common ancestry for these replication-initiation and -termination proteins . No significant amino acid homology between RTP and the replication-arrest protein of E. coli, Tus, was detected (37). RTP has been overexpressed, purified to homogeneity, and migrates on SDS polyacryl amide gels with an apparent molecular mass of 1 4,500 (56) , very similar to the predicted size of a RTP monomer . To determine its native configuration , sedimentation equilibrium studies of RTP were performed and demonstrated an apparent molecular weight of 29,000, consistent with a dimer (55). Dimerization depended upon RTP concentration, with an equilibrium associa tion constant K 12 for the monomer-to-dimer transition of 2 x 1 06 liters mol- I and a K24 of 1 x 1 04 liters mol- I for the dimer-to-tetramer transition . Thus, the dimeric form of RTP is the predominant species between 5 x 10-7 and I x 10-4 M in these buffer conditions. If these equilibrium constants reflect the true physiological values for the monomer-dimer transition, then approx imately 70 molecules of the RTP monomer would be required intracellularly for 50% dimer formation. Gel retardation assays were used to test the hypothesis that purified RTP would bind specifically to the IRR (inverted repeat region) containing IR I and IR II. Addition of low concentrations of purified RTP to a 209-bp fragment containing IRR (molar ratio of RTP:IRR = 7) produced four slowly migrating bands , presumably resulting from protein-DNA complexes containing one, two, three, or four molecules of RTP (56) . As the RTP:IRR ratio was increased to 80, all of the IRR DNA was shifted into the slowest-migrating species. These results not only demonstrated a specific interaction between RTP and the IRR, but also suggested that each IR element contained two binding sites for RTP. This was confirmed later when DNA fragments



609

containing only IR I or IR II were complexed with RTP and each IR fragment produced two slowly migrating bands on the gel (55 ) . A more detailed analysis o f the binding interaction between RTP and the IRR allowed an estimation of the average equilibrium constant for RTP binding to a single site (55) . RTP bound to the intact IRR (containing four binding sites) with an average Ko of I x 10- 1 1 M for a single RTP:IRR interaction , indicating a strong affinity of RTP for its binding sites. Stoichiometric studies determined that the number of RTP monomers bound to a saturated RTP:IRR complex was seven to eight, suggesting that RTP bound as a dimer (55), a result consistent with the dimerization of unbound RTP. To measure the Ko, concentrations of RTP were used that were several orders of magnitude below the monomer-dimer equilibrium dissociation con stant of 5 x 10-7 M, suggesting that the monomeric rather than the dimeric form of RTP was the predominant molecular species . However, the authors concluded that the high levels of glycerol (50%) used in binding and loading buffers for the Ko studies enhanced the formation and binding of the dimeric RTP molecules of such low protein concentrations . They demonstrated that the efficiency of RTP binding was greatly reduced in buffers containing less than 30% glycerol and suggested that the most likely explanation for the increased binding in the presence of glycerol was a simple excluded-volume effect or a glycerol-induced conformational change during the RTP/IRR interaction resulting in compaction of the protein-DNA complex. DNase I footprinting studies of the RTP/IRR complex identified the RTP binding sites within the IRR (55) . At the lowest concentrations of RTP tested (6.4 X 10-9 M), a 4 1 -bp region that overlapped IR I was the only part of the IRR prote,eted from digestion (Figure 1). As the concentration of RTP was increased Ito 1 . 3 x 1 0-8 M, a second protected region of 4 1 bp was observed that overlapped IR II. As the RTP concentration was increased further, to 2 . 5 x 1 0-8 M, an additional 1 2 bp of the I R I I region was protected from DNase I digestion. This observation was consistent with the proposal that each IR contained two RTP binding sites . The concentration-dependent order of binding observed with the DNase I footprinting studies was also consistent with the equilibrium constant study described above, which indicated positive cooperativity amongst the sites for RTP binding and suggested that the sites were not equivalent. The fully protected regions of both IR I and IR II were not positioned in the center of the homologous sequences, but instead covered about two-thirds of one end of the inverted repeats (Figure 1 ) . When the protected regions from both IR dements of strain 1 68 were aligned with the equivalent sequences from the IRR of strain W23 , the only potential candidate for the RTP binding sequence that was present twice in each protected region was an 8-bp segment with the consensus sequence ACYRARA/TR. The candidate sequences, des-

610

HILL

ignated A and B (Figure 1), were present as direct repeats separated by only 8 bp. They did not show the twofold rotational symmetry often associated with the recognition sites of dimeric DNA-binding proteins, suggesting that the IR elements might show polarity of function. Indirect evidence suggesting a role for this 8-bp sequence in RTP binding was obtained when a DNA fragment containing only the IR I-B box was tested for binding in the gel retardation assay and shown to produce only a single retarded species, even at high RTP concentrations (55).


By analogy with the observed polarity of replication arrest associated with the Ter sites of E. coli (described below), Lewis et al (55) suggested that IR I was responsible for arrest of the clockwise replication fork and that the clockwise fork passed through IR II. This possibility was tested by synthesiz ing a series of oligodeoxyribonucleotides corresponding to sequences at different positions upstream of IR I on the clockwise

arm

of the chromosome

(89). These single-stranded probes were then hybridized to either the leading or lagging strand of the immobilized clockwise replication fork from strain

GSY1127 to determine the location of replication arrest in the terC fragment. Although the majority of arrested leading strands were halted before reaching IR II, a small but significant number of leading strands traversed IR II and entered the 59-bp spacer region between IR I and IR II. No leading strands were detected beyond IR I. Probes specific for lagging-strand synthesis showed that no lagging strands passed through IR II. These results suggested that IR I was the primary impediment to at least a portion of the leading strands of the clockwise replication fork, consistent with the hypothesis that the IR elements were polar for replication arrest. Recently, a similar result demonstrating that replication forks can traverse IR II but not IR I was obtained by inserting the IRRJrtp region into a plasmid

(10). In this study, the IRRJrtp region was oriented such that the unidirection al replication fork initiated from the plasmid origin would encounter the

terC

region in the order rtpllR II1IR I, the same order encountered by the clockwise replication fork in the chromosome. The products of leading-strand arrest were mapped at nucleotide resolution and shown to pass through rtp and IR II before ending within IR I, adjacent to the IR I-B binding site. The primary arrest sites of leading-strand synthesis were one and two nucleotides upstream of and one nucleotide within the IR I-B binding site. These results suggested that the polymerase replicated through the RTP-binding sites in IR II, but halted at the first properly oriented RTP bound in IR I. The arrest of leading-strand synthesis within a couple of nucleotides of the RTP-binding site is similar to the observation in E . coli that replication arrest occurs primarily within the binding site of the replication-arrest protein Tus ( 35, 53a).


611

OF TERC IN THE B. SUBTILIS CHROMOSOME Another approach Ito test the hypothesis that the IR elements function in a polar fashion was to relocate the tere fragment at different positions around the chromo some. Initially, a strain was constructed with a 1 . 75-kb IRRlrtp fragment inserted in the usual orientation into the chromosome 25 kb clockwise from the normal tere site , which had been deleted. Ihe displaced tere functioned normally in this strain, indicating that the IRRlrtp fragment could be moved to different locations in the chromosome and still retain activity (41). Recently, Carrigan et al (13) built strains with the tere fragment relocated on the clockwise arm of the chromosome at positions 100° or 139° (on a 360° map) and in either orientation. These strains were tested to determine if the terC fragment retained the ability to arrest clockwise replication forks regardless of its orientation. Surprisingly , only the normal orientation of terC arrested the clockwise replication fork. When IR II was positioned to impede clockwise replication, it failed to do so, demonstrating that the IRRlrtp fragment as a unit showed polarity. Given the sequence similarities between IR II and IR I and the demonstration that RIP binds to both, the simplest explanation for these results is that IR II is unoccupied at normal intracellular concentrations of RTP (ll3). This postulation is consistent with the observation that RTP binds to both IR I-A and IR I-B sites before either of the IR II sites are bound. In addition , if occupation of IR I represses expression of the rtp gene (lR I-A overlaps the presumed transcription start), this will prevent further synthesis of RIP and keep the intracellular level of RTP below that necessary to bind both IR II sites.


RELOCATION

Future Prospects

Analysis of replication arrest in B . subtilis will remain a fertile field for years to come. For instance, it is surprising that the recognition sequence for RTP binding is so small, because the 8-bp consensus binding site would be expected to be present approximately 2000 times in a 4-million-basepair genome. However, if replication arrest required the juxtaposition of two RIP-binding sites as a direct repeat separated by a fixed-length spacer, then the number expected per genome would drop drastically . This then raises the issue of how many RIP-binding sites are necessary for replication arrest. Can a single RIP-binding site function to halt replication, as has been shown for the rer sites in E. coli (discussed below), or are two adjacent RIP binding sites necessary? If two RIP-binding sites are required, how do the two RTP dimers interact with the oncoming replication fork? Unless a DNA loop is formed, which was not detected in the DNase I footprinting studies (55), then the replication fork will encounter the two RIP dimers sequentially rather than simultaneously, perhaps suggesting that the replication fork contains two

612

HILL


copies of the target of RTP, possibly one on each template strand. Also, if the IR II element is truly inactive or is rarely, if ever, occupied by RTP, why has it been conserved? Will additional functional IR elements be discovered on the two arms of the chromosome, as appears to be the case for the E. coli Ter sites, or are the only RTP binding sites in the chromosome found in terC? Finally, experiments directly addressing the molecular mechanism of replica tion arrest in B . subtilis will be of paramount importance, because these alone will determine if the replication-arrest systems of gram-positive and gram negative bacteria are truly different. ESCHERICHIA COLI

The concept of a replication terminus in E. coli was first advanced by Masters & Broda (65) and Bird et al (5) , who concluded that bidirectional replication of the chromosome was initiated from a unique origin, oriC (min 84), and that the two replication forks met on the opposite side of the chromosome in the interval between the trp (min 28) and his (min 44) loci (Figure 2). In the late 1 970s, investigators showed that the region where the converging replication forks met contained an impediment to replication-fork progression. Using E. coli strains with phage or plasmid replication origins integrated asymmetrical ly in the chromosome, the laboratories of Kuempel (50--5 2) and Louam (59, 60) demonstrated that clockwise and counterclockwise replication forks were inhibited between the trp (min 28) and manA (min 36) loci. Thus , replication termination events were confined to this particular part of the chromosome , which was designated the terminus region . Few genetic loci have been mapped to the terminus region compared with the remainder of the chromosome. The lack of genetic markers in the terminus was first observed during bacterial conjugation experiments , when approx imately 8 min passed between transfer of the trp and manA markers. Two possible explanations could account for the genetic gap in the terminus region. One explanation was that trp and manA were in fact positioned very close to one another on the physical map, but the terminus region-replication impediment reduced the rate of conjugation by interfering with DNA transfer, causing a delay between the two markers (52) . The other explanation was that the delay between transfer of the trp and manA markers simply reflected the physical distance between the two loci. This ambiguity regarding the actual physical structure of the terminus region was resolved in the early 1 980s when a cotransduction map spanning the 8-min interval between trp and manA loci was published (6, 1 9) and when Bouche constructed a restriction map of 450 kb that included the entire terminus region, demonstrating that 380 kb sepa rated trp and manA (8, 9) . However, in spite of the advances in our un derstanding of the structure of the terminus , this region still has relatively few


613

min 10010

oriC

TerE


75

TerD TerA

50 Figure 2

TerF

A map of the Escherichia coli chromosome showing the location of the termination

sites (TerA-TerF) relative to the location of the origin of replication and other genetic markers. The sites TerA, TerD, and TerE arrest counterclockwise-traveling replication forks only, whereas TerB, TerC, and TerF arrest clockwise-traveling replication forks. The location of the Ius gene, which produces the Ter-binding protein Tus, is also presented.

known genetic markers . Of the 1 403 loci identified on the most recent map of the E. coli chromosome ( 1 ), only 40 or 2.9% reside within the terminus region, although this interval is equal to 7 . 7% of the total E. coli genome. The E. coli terminus, like its counterpart in B. subtilis, is dispensable for cell viability, indicating that no essential genes are present in this part of the chromosome. An E. coli strain was isolated with a 340-kb deletion that removed almost all of the terminus region (27), and although the cells were filamentous, they were still viable. The barrier to replication forks was also removed in this strain, but this was not the reason for filamentation . Kuempel et al (53) recently reported that loss of the diflocus (min 3 3 . 5), a site for the RecA-indt�pendent recombination pathway mediated by XerC (7), caused thc filamentation. Thus, for standard growth conditions in the laboratory, only deletion of the dif locus causes an observable phenotype; removal of the rest of the terminus region has no apparent effect on cell growth. The feature of the terminus region that has received the most attention in recent years is the barrier to replication-fork progression, or the replication arrest system. Two components have now been identified that are required for replication arrest in E. coli. These are the Ter sites, which are nonpalindromic DNA sequences of approximately 20 bp, and the Tus protein, which is a DNA-binding protein that recognizes and binds specifically to the Ter se-

614

HILL

quences . Although these components have been designated by different names in other-publications , the nomenclature adopted by Bachmann in the latest genetic map of the E. coli chromosome ( 1 ) is used exclusively in this review.


The Ter Sites IDENTIFICATION OF THE CHROMOSOMAL TER SITES The first studies that characterized replication arrest in the terminus region of the E. coli chromo some employed marker frequency assays to determine the relative amount of DNA replication that had occurred at a given position on the chromosome (50-52, 59, 60). Replication was initiated from plasmid or phage origins integrated into the chromosome at positions close to the terminus region, allowing an unambiguous assessment of the progress of the replication fork traversing the terminus region. However, the sensitivity of these marker frequency assays entirely depended on the number of DNA probes used for hybridization, and few chromosomal probes were available initially. As a result, the first replication assays only localized the replication block to broad areas of the terminus region . Clockwise replication forks were halted some where between rae (min 30) and aroD (min 37) and counterclockwise replica tion forks were inhibited between rac and trp (51,52,59,60). In addition, clockwise replication forks could pass through the region where inhibition of counterclockwise replication occurred (5 1 ) , the first hint that the impediment to replication functioned in a polar fashion. Independent reports from Louam's ( 1 7) and Kuempel's (33) laboratories separated the replication block into distinct loci that were specific for arrest of clockwise or counterclockwise replication forks and clearly demonstrated the polarity of the replication-arrest sites. Using an extensive battery of chromo somal probes in the marker frequency assay, both groups showed that two replication-arrest sites were situated at the extremities of the terminus region . Arrest of replication at these sites was not absolute; replication forks were eventually released and continued past the replication-arrest sites. One site , TerA, was located close to pyrF at 28 .5 min and arrested only counterclock wise replication forks. A second site that only halted clockwise replication forks, TerB, was positioned on the opposite side of the terminus region . The map location of TerB by the two groups was different; deMassy et al (17) placed TerB at min 33.5, and Hill et al (33) placed it between min 34 . 5 and 35.7,near manA. This discrepancy was resolved when it was determined that two arrest sites (TerC and TerB) for clockwise replication were present on this side of the terminus (discussed below). The location and polar function of TerA and TerB suggested that, unlike tere in B. subtilis, the replication-arrest sites in the E . coli chromosome were widely separated and positioned at the



615

edges of the terminus region to form a replication-fork trap, allowing replica tion forks to enter but not exit this region . Even with a greater number of chromosomal probes, the marker frequency assays still lacked the sensitivity to accurately locate the sites of replication arrest. A more precise determination of the location of replication arrest was ultimately achIeved by a series of techniques, including marker frequency analysis of deletion mutants (34) , insertion of phage origins into the terminus region (20, 2 1 ) , electrophoretic analysis of the Y-structures formed by arrested re:plication forks (73), and characterization of the replication products of plasmids carrying the chromosomal Ter sites (29, 74). These studies reduced the region of replication arrest to a size amenable to sequencing. The Ter sites were initially identified as nonpalindromic 22- to 23-bp sequences (Figure 3) that resided within 1 00 bp of the site of replication arrest (29 , 36) . The lack of dyad symmetry conferred a directionality to the se quences, (:onsistent with the observed polarity of replication arrest. Thus, the orientation of the TerA sequence in the chromosome was inverted with respect to the orientation of the TerB sequence. In addition to the TerA (min 28) and TerB (min 36) sites reported by Hill et al (36) , Hidaka et al (29) also identified the sequences for TerC (min 34), which correspond to the replication-arrest site mapped by deMassy et al ( 1 7), and TerD (min 27). More recently, TerE (min 23) (30) and TerF (min 48) (B . Sharma & T. Hill , unpublished results) were reported (Figure 3) . The six identified termination sites are asymmetri cally distributed over approximately 25% of the total chromosome, with TerA, TerD, and TerE positioned to arrest counterclockwise replication , and TerB, TerC, and TerF positioned to arrest clockwise replication (Figure 2). These six Ter sites are probably not the only ones in the chromosome, since Fran repAi (5 '�3' )

-

or; (�) - TerR2 «)

-

TerRi (» ¢: ccw

where cw and ccw indicate the clockwise and counterclockwise directions , respectively. The repA1 gene encodes a protein required for replication initiation (76). Replication occurs unidirectionally from the origin, ori (70),



617

positioned approximately 200 bp from the 3' end of the repA1 gene. The origin contains binding sites for the RepA protein (64), and replication is directed away from the repAI gene, as indicated by the arrow. In the plasmids R 1 and RlOO , two Ter sites, TerRI and TerR2, are present as an inverted repeat and are positioned about 500 bp from the 3' end of the repAI gene. In the RepFIC origin of P307 (77) , only the TerRI site is present, also located 500 bp 3 ' of the repAI gene . The TerRI site is oriented to arrest clockwise replication, and the TerR2 site will arrest counterclockwise replication forks. An initial postulation was that the TerRI site might arrest the nascent replica tion fork if replication was actually initiated from the RepA-binding sites in the minimal origin region (36). However, because the TerRI site was lO -fold less efficient than the TerR2 site in vivo, it was suggested that the newly synthesize:d replication fork would only be transiently arrested at this site and would ultimately pass through the block site to replicate the plasmid genome. More recent studies (66) have demonstrated that, although the minimal replication-origin region was adjacent to the repAI gene, the 5' end of the leading strand was initiated beyond both the TerRI and TerR2 sites, approx imately 800 bp from the 3' end of the repA1 gene and bypassing the TerRI site altogether. The role of the Ter sites in the replication cycle of plasmids remains obscure. I nterestingly , deletion of the region containing TerRI in R lOO results in the formation of plasmid multimers (7 1 ) . In the absence of TerRI, rolling circle replication may be initiated , leading to multimer formation. Alternate ly, the Ter sites may assist in the resolution of the plasmid multimers by an unknown mechanism. Inserting Ter sites into plasmids also reportedly affects plasmid maintenance. Introduction of a properly oriented TerB site into a hybrid plasmid containing a phage M 1 3 origin of replication caused plasmid instability (83). Maintenance of the plasmid could be increased by over expressing the phage replication protein gpIl, and it was suggested that the observed iinstability resulted from replication arrest at the TerB site. TER SEQUENCES Figure 3 lists the 1 3 known Ter sequences from plasmids and the E. coli chromosome, along with a derived consensus sequence. Although 22 to 23 basepairs were originally identified as the length for the Ter sites, the truly invariant nucleotides are restricted to the G residue at position 6 and the 1 1 -bp sequence between residues 9 through 1 9. The one exception to this rule is TerF, which has a G substitution at position 18. Of the 32 interference and protection sites mapped in the Tus-TerB complex (24) (discussed below), 29 are located in the core region between positions 6 and 1 9 , confirming the importance of these basepairs in the Ter sequence. The four nucleotides from positions 2 through 5 , although not invariant nor protected by Tus binding , are generally A-T rich. The conservaCOMPARISON OF THE

618

HILL


tion of these A-T residues suggests that sequence context may influence Tus binding, although this has not yet been directly tested. Sista et al (79) have reported the effects of several mutations in the core region on Tus binding and replication-arrest activity. The Ter sites that contained single mutations at positions 1 0 , 1 2 , 1 3 , and 14 did not bind Tus protein and consequently could no longer form productive replication-arrest complexes. However, Tus was able to bind to Ter sites containing single substitutions at positions 6, 8 , 1 1 , 1 6 , and 1 8 , and these mutated sequences still retained the ability to arrest DNA replication. The Tus Protein IDENTIFICATION OF A TRANS-ACTING TERMINATION FACTOR The first suggestion that a protein might be involved in replication arrest came in the early 1 980s from Germino & Bastia, who examined cell-free replication of hybrid R6K1ColEl plasmids. Replication of the hybrid plasmid substrates in vitro was arrested at the R6K terminus regardless of whether the crude cell extracts were prepared from cells that carried an R6K plasmid or not, suggest ing that R6K did not encode a factor necessary for repl ication arrest (23). These results led the authors to speculate that any trans-acting factor needed for replication arrest must be supplied from the host cell. The gene required for replication arrest in the E. coli chromosome was identified by Hill et al (34) in a genetic study using deletion mutations to map the location of the TerA and TerB sites. They observed that deletions that removed the TerB site also inactivated the TerA site, even though over 300 kb separated the two sites. The deletion mutants regained TerA activity if a plasmid carrying the TerB region was provided. It was postulated that a trans-acting factor encoded by a gene in the vicinity of TerB was required for replication arrest and that this gene encoded a DNA-binding protein that associated with the Ter sites. The gene was named t us (terminus utilization substance) . Sequencing of the t us gene region revealed an open reading frame encoding a basic protein with a predicted molecular mass of 36,000 (32, 37) . The t us gene produced a DNA-binding protein that associated with the Ter sites (37, 46, 80) , and inactivation of the tus gene by insertional mutagenesis abolished DNA binding in vitro and replication arrest in vivo (37, 46) . The predicted amino acid sequence of the Tus protein did not contain significant homology to the helix-turn-helix , leucine zipper, or zinc-finger motifs com mon to other known DNA-binding proteins (37) .

EXPRESSION OF THE TUS GENE The TerB site was located immediately upstream of the t us gene, between the promoter and the start codon, suggest ing that t us gene expression was regulated by Tus binding to the TerB site



619

(37). Both in vivo (32, 74a, 75) and in vitro (68) analysis of tus gene expression verified autoregulation. Hidaka et al (32) introduced a single mutation into the TerB site that inactivated Tus binding and subsequently increased .tus gene expression, suggesting autoregulation. Natarajan ct al (68) and Roecklein and coworkers (74a, 75) have mapped the 5 ' end of the tus mRNA and demonstrated that the primary transcriptional start for the tus gene lies within the TerB sequence . In the presence of Tus, the level of transcrip tion was at least 30-fold lower than in the absence of Tus, suggesting that RNA polymerase was prevented from transcribing the gene. This hypothesis was confirmed in vitro by DNase I footprinting studies that showed that binding of Tus excluded binding of RNA polymerase (68). Thus, Tus binding at the TerB site occludes RNA polymerase and represses transcription of the tus gene. The region containing the tus gene encodes several other genes as well (75). Immediately 3' of the tus gene is fume, which encodes a fumarase whose function is unknown (9 1 ) . The tus and fumC genes are transcribed convergently, and the stop codon of the tus gene overlaps the stop codon of thefumC gene . A potential rho-independent terminator for tus resides within the coding sequences of fumC, and the transcriptional terminator for fumC is positioned within tus (90) . The effect, if any , of fumC transcription on the expression of tus has not been determined. Two genes encoding potential sensor/regulator proteins, dubbed urpT (unidentified regulatory protein/ Terminus) and uspT (unidentified sensory protein/Terminus), were identified 5 ' of the tus gen� . The 3' end of uspT was only 78 bp upstream of tus, with no obvious transcriptional terminator present in the intragenic region. Transcripts originating in these upstream genes did not extend into the tus gene in a tus + strain (74a) . However, in a tus- strain, readthrough transcription was observed, suggesting that Tus binding to TerB not only regulates tus expres sion by promoter occlusion, but also by impeding the progression of an actively transcribing RNA polymerase. In spite of the proximity of urpT and uspT to tus, they do not appear to contribute to replication arrest because insertional inactivation of uspT had no effect on the function of the Ter sites (37) . PROPERTIES OF THE TUS PROTEIN Several laboratories have purified Tus protein to homogeneity (32, 35, 45; E. Lee & A. Kornberg , -unpublished results), and several of the physical and biochemical properties of purified Tus protein were recently determined (F. Coskun-Ari & T. Hill, unpublished results). Both gel filtration and sedimentation equilibrium studies have demonstrated that the soluble form of the Tus protein was a monomer, consistent with earlier reports using gel filtration alone (79). The Tus protein had a frictional coefficient of 1.06 and an axial ratio of 2, indicating that the


620

HILL

polypeptide was nearly spherical . The stokes radius was 23 A , suggesting that the protein would cover approximately 13 bp when bound to DNA, somewhat less than the 17 bp protected from hydroxyl-radical treatment (24) . The E280 was 39,400 M - I cm- I , very close to the predicted value of 38 , 800 M - I cm- I calculated using Wetlaufer's method (88). The pI of the native protein was 7 . 5 (F. Coskun-Ari & T. Hill , unpublished results), although the calculated isoelectric point based on the nucleotide sequence of the tus gene was 1 0 . 1 (37 ) . The difference in the observed and predicted pI may simply reflect the the folding of the native protein or may result from a posttranslational modification , such as phosphorylation or nucleotide binding. Tus binds to the Ter sites as a monomer (79), an observation that is consistent with the monomeric form of the soluble protein. The Replication-Arrest Complex

The Tus-Ter complex is unique among DNA-protein complexes in its intrinsic ability to arrest DNA replication . Consequently, most of the recent in vestigations of this unusual protein-DNA complex have focused on the molecular mechanism of replication-fork arrest and the details of Tus binding to a Ter site. In these studies , two potential mechanisms have been considered for the activity of Tus-Ter complexes against DNA replication forks . The first of these is specific protein-protein interactions between Tus and some com ponent of the approaching replication fork that impairs function of the repli some component and halts the replication fork . The second model is a general block to protein translocation along the DNA; that is, Tus binds to the Ter site in such a way as to impede protein translocation from one direction but not from the other . If the Tus-Ter complex acts as a might be reflected by the affinity of Tus for the Ter sites and by the stability of the complex. Consequently, Gottlieb et al (24) used filter-binding studies of the Tus binding to the Ter sites to measure these parameters . Their work demonstrated a very high affinity of Tus for the chromosomal TerB site, with an equilibrium binding constant (Ko) of 3.4 x 1 0 1 3 M . The dissociation rate constant (kd) was 2 . 1 x 10- 5 3ec- 1 and the halflife was 550 min , indicating that the Tus-TerB complex was very stable. The association rate (ka) of Tus-TerB complex formation was 1 .4 X 108 M- I sec- I , in the range expected for simple diffusion-controlled bimolecular reactions. The interaction of Tus with the R6KTerR2 site, which is a less efficient replication-arrest site (29, 74) , revealed a Ko of 1 x 10- 1 1 M , or an affinity 30 times lower than the binding of Tus to TerB . This difference was primarily the result of a faster dissociation rate of the Tus-TerR2 complex, with a halflife of 43 min. In contrast, Sista et EQUILIBRIUM AND KINETIC CONSTANTS

simple barrier to replication-fork progression, this property

-



62 1

al (79) used a gel mobility-shift assay and reported a Ko of 5 X 1 0- 9 M for the Tus-R6KTerR interaction . The 500-fold difference between the reported values for the Tus-R6K interaction probably results from the different buffers used in the binding studies . The sta.bility o f the Tus-TerB complex, which i s more than 1 00 times greater than the halflife of the lac repressor-operator complex, may cause cell cycle-dependent regulation of tus gene expression. When Tus binds to the TerB site, tus gene expression should be repressed until either the bound Tus protein dissociates or is displaced by a counterclockwise-traveling replication fork. Thus, in E. coli cells with doubling times of 30-40 minutes , tus gene expression should be restricted to the period of the cell cycle when replication forks reach the terminus region . A variety of footprinting studies have been used to probe the structure of the Tus-Ter complex . Footprinting of Tus-R6KTerR com plexes by copper-phenanthroline (80) and DNase I (32) demonstrated that 1 5-24 bp of the conserved Ter sequence were protected from cleavage by bound Tus protein . Sista et al (79) employed a combination of hydroxyl radical footprinting, methylation interference, alkylation interference, and methylation protection studies to show that Tus protein contacted both major and minor grooves and was positioned asymmetrically on the R6KTerR sites , consistent with the observed polarity of function. Gottlieb et al (24) used a similar collection of chemical-modification techniques to examine the Tus-TerB complex and also observed an asymmet ric arrangement of protein-DNA contacts on the chromosomal Ter site (Figure 4) . However, a greater number of protected residues were observed on the TerB site as compared to the R6KTerR sites, which probably reflects the lower equilibrium constant and greater stability of the Tus-TerB complex . The pattern of the protected residues indicated that the Tus protein was primarily positioned on one side of the double-helix , with protein fingers extending in the major groove to the other side of the helix. Interestingly , the side of the Tus-TerB complex that halts an approaching replication fork had a greater number of protected residues, and more importantly, these contacts extended across both the major and minor grooves on the front side of the complex and in the major groove on the back side of the DNA, suggesting that Tus was firmly clamped onto the Ter site in this region . By comparison, on the side of the Tus-TerB complex that is permissive for replication-fork progression, only a single strand was contacted by the Tus protein (Figure 4) . This observation, in conjunction with the stability of the Tus-TerB com plex , suggested a possible model for generalized inhibition of DNA unwinding proteins (24). A DNA-unwinding protein moving towards the Tus-TerB complex from the nonpermissive direction would encounter the DNA FOOTPRINT

622

HILL

A) 5 I

Nucleotide

, Sequence

10 I

+ + + ++ + + +

15 I

20 I R R R G T


t t B}

Figure 4 Location of protein-DNA contact sites in the Tus-Ter8 complex. (A) Circied nucieo tides indicate guanine residues protected from DMS methylation. Filled-in circles between nucleotides indicate strong alkylation interference sites and open circles indicate weak alkylation interference sites. Small arrows denote hydroxyl radical protected sites. The large arrow shows

the last nucleotide of leading-strand synthesis. The heavy bar between the strands denotes the core sequence common to all known Ter sequences. (8) Three-dimensional representation of DNA-protein contacts in the Tus-Ter complex. Closed circles show the position of hydroxyl radical-protected nucleotides; open triangles indicate positions of alkylation interference; and hexagons containing the letter

"0" indicate OMS-protected guanine residues. Reproduced with

permission from Ref. 24.

region of the TerB site where Tus contacted both major and minor grooves. The unwinding protein would not be able to pass through the stable barrier formed by the Tus-TerB complex. However, a DNA-unwinding protein moving towards the Tus-TerB complex from the permissive direction would encounter the protein-DNA complex where the Tus protein contacted only one strand of the TerB site (Figure 4) . The DNA-unwinding protein would separate the strands of the TerB site, destabilizing the complex and allowing passage of the unwinding protein. The pattern of protein-DNA contacts observed in the Tus-TerB complex could also accomodate the protein-protein interaction model equally well, because Tus contacts were positioned close to the last nucleotide synthesized by the leading strand (Figure 4) . This observation suggested that a domain of the Tus protein could interact specifically with a helicase approaching from the nonpermissive direction, thereby halting its DNA unwinding activity. If the helicase approached from the permissive direction, it would pass un impeded because the orientation of the Tus protein would not permit correct protein-protein interactions between the helicase and Tus.


In vitro studies of replication arrest have been employed to identify the component of the replisome that interacts with the Tus protein and the mechanism by which replication is halted. That the Tus-Ter complex alone was sufficient to arrest DNA replica tion was established by inhibition of a bona fide replication fork using an in vitro systl!m composed entirely of purified proteins (35 , 54) . The arrest of DNA replication in vitro faithfully mimicked in vivo replication arrest, in that replication inhibition depended upon the orientation of the Tus-Ter complex with respect to the direction of replication-fork progression. In addition , these studies demonstrated that the primary arrest sites of the leading strand were the first and second nucleotides of the Ter site (Figure 3) (35 , 53a) . A likely candidate for Tus-mediated arrest o f replication i s the replicative helicase, which separates the DNA strands in advance of the pol III holoen zyme. To examine the effect of the Tus-Ter complex on helicase activity, a relatively simple helicase assay has been employed to monitor strand dis placement in the presence of Tus. In this assay, a partial DNA heteroduplex consisting of a short oligodeoxyribonucleic acid hybridized to a circular ssDNA molecule is incubated with a purified DNA helicase. The intrinsic unwinding activity of the helicase displaces the oligomer and the displaced oligomer can be easily separated from the heteroduplex substrate by elec trophoresis. Since no other replication proteins are necessary for this assay, the direct action of Tus on the helicase can be determined. In addition, several different helicases can be tested using this simple protocol . Lee et al (54) demonstrated that a Tus-TerB complex was capable o f an orientation-dependent inhibition of unwinding activity of the DnaB (the major replicative: helicase of E. coli) , Rep , and DvrD helicases. The polarity of helicase inhibition was the same as observed for replication-fork inhibition in vivo. The orientation of the Tus-TerB complex that arrested helicase activity was independent of the direction of helicase movement; DnaB unwinds duplex DNA in the 5 ' to 3 ' direction, and Rep and DvrD unwind in the 3 ' to 5 ' direction. In a separate study, Khatri et al (45) tested the same three helicases, except that they used a R6KTerR site instead of the chromosomal Ter site. They reported that the Tus-R6KTerR complex only showed polar inhibition of DnaB activity; Rep and DvrD activity were unaffected. More recently, however, the results regarding DvrD have been reversed, and Bedorsian & Bastia (3) now report that the Tus-R6KTerR complex does halt DvrD in 2L polar manner. These n:sults suggested that the antihelicase activity of Tus was responsible for replication-fork arrest. More recent studies have strengthened this view of Tus as an antihelicase. The list of helicases and the direction of unwinding inhibited by the Tus-TerB complex in an orientation-dependent manner now include SV-40 T antigen (3 ' to 5 ' ) (3 1 ) , helicase I from F plasmid, helicase B

THE MECHANISM OF REPLICATION ARREST


623


624

H ILL

from mouse cells (both 5 ' to 3 ' ) (3 1 ) , and priA (3 ' to 5 ' ) (28a, 53a) . SV-40 T antigen was also shown to be inhibited by a Tus-R6KTerR complex (3) , but in these studies the 3' -to-5 ' T-antigen helicase activity appeared to be inhibited by the orientation of the Tus-Ter complex that was normally permissive for replication. Because this inhibition seemed unlikely , thc authors speculated that a 5 ' -to-3 ' activity of the T-antigen was preferentially inhibited by the usual orientation of the Tus-Ter complex. In addition to its antihelicase activity , the Tus-TerB complex reportedly prevents strand displacement by a variety of polymerases, including T5 , T7 , and E . coli pol I large fragment (53a) . Against these enzymes, however, inhibition of strand displacement occurred regardless of the orientation of the Ter site, suggesting that the strength of the protein-DNA interactions in the Tus-TerB complex was sufficient to impede the progress of the polymerases . The extent o f polymerization into the TerB site o n either side b y T 7 pol was also determined. From the nonpermissive side, T7 pol replicated up to the fourth nucleotide of the consensus sequence, and from the permissive side, replication occurred up to the sixth nucleotide (Figure 4) . These endpoints of polymerization coincided almost exactly with the limits of the Tus footprint on the TerB site shown by Gottlieb et al (24) , lending credence to the suggestion that the strength of the Tus-TerB complex alone is sufficient to halt these polymerase activities. Although the multitude of replication enzymes inhibited by the Tus-Ter complex suggests a generalized mechanism for arrest rather than specific protein-protein interactions, some results are inconsistent with this model . For instance, the Dda helicase of T4 phage was not inhibited by either orientation of a Tus-R6KterR complex (3) . More recently , results by Hasai & Marians (28a) have provided the most compelling evidence to date that protein-protein interactions may play a role in replication arrest and, in the process, have challenged the utility of helicase assays that use short oligomeric substrates for monitoring helicase activity . Using substrates with a short (60 base) TerB oligomer hybridized to a single-stranded circle, orientation-dependent inhibi tion of DnaB (5 ' to 3 ' ) and PriA (3 ' to 5 ' ) helicases was observed, consistent with reports from other laboratories . Also, strand displacement by a q,x-type primosome , which contains both the DnaB and PriA helicases, was inhibited by both orientations of the Tus-TerB complex. However, when a TerB substrate containing an elongated duplex of approximately 250 bp was tested, the primosome was still halted in both directions as before , but PriA was only partially inhibited by the nonpermissive orientation, and DnaB passed through the Tus-TerB complex in both orientations . Thus, the effect of the Tus-TerB complex on helicase activity differed on short oligomeric substrates versus elongated duplex substrates. Also, in contrast to other published reports , Hasai & Marians did not observe inhibition of DvrD helicase with either



625

orientation of the Tus-TerB complex on either short or elongated substrates. The authors postulated that studies assaying helicase activity using oligomeric substrates might only be observing strand-displacement activity rather than true helicase activity . On longer duplex substrates, strand-displacement activ ity gave way to true DNA unwinding, this transition occurring somewhere between 2 and 1 0 duplex DNA turns . Thus , the distribution of protein-DNA contacts and the stability of the Tus-TerB complex in the nonpermissive orientation could account for the generalized inhibition of helicase strand displacement on oligomeric substrates . However, these characteristics of the Tus-TerB complex were not sufficient to halt helicases once bona fide duplex unwinding had commenced, suggesting that protein-protein interactions must be an integral step in Tus-mediated arrest of DNA replication . Why Do Ter Sites Exist? Beyond their obvious role as endpoints of DNA replication , the biological

function and selective advantage of Ter sites in the prokaryotic chromosome remain a mystery . The benefit of having chromosomal replication-arrest sites is attested to by the striking similarities in the organization of the replication arrest systems of B . subtilis, a gram-positive bacterium, and E. coli, a gram-negative bacterium, and by the identification of a system in Salmonella typhimurium (75) that is homologous to the Ter sites and Tus protein of E . coli. The conservation o f replication-arrest systems in bacteria and the identification of functionally similar systems in yeast ( 1 1 ) , peas (28) , and viruses (22) strongly support the argument that replication-arrest sites confer an evolutionary advantage to the cel l . However, the exact nature of this advantage remains unclear, especially in light of the apparent dispensability of the replication-arrest system. The absence of an observable phenotype in tus- E. coli strains grown in normal laboratory conditions prompted Roecklein et al (75) to compare the growth characteristics of tus+ and tus::kanr strains in a variety of other laboratory conditions . The two strain types were tested in rich vs minimal medium, after medium shifts , in anaerobic conditions, following UV irradia tion, and following exposure to agents that inhibit DNA synthesis. The authors could not detect significant differences in growth between the wild type strain and the strain carrying the tus null mutation in any of these conditions. These results indicated that the simple set of growth parameters available in the laboratory are not sufficient to produce an observable phe notype in tus- cells. In a more natural environment, where the bacterium encounters a more complicated set of growth conditions, the selective advan tage for a tus+ strain or a clear phenotype for a tus- strain might be more readily observed. Loss of the replication-arrest system appears to elicit an observable phe-


626

HILL

notype only in E . coli strains that replicate the chromosome unidirectionally ( 15). In these strains , called intRl strains, oriC is inactivated and replaced by the unidirectional replication origin from plasmid R l (69) . As a result, the replication cycle of these strains is highly asymmetric . The chromosome is replicated predominately, if not entirely, in either the clockwise or counter clockwise direction , depending upon the orientation of the inserted plasmid origin. Thus, to complete the chromosome, the single replication fork must pass through a series of active termination sites. When intR l strains contain a functional tus gene, the cells are long filaments that pinch off. However, when the tus gene is inactivated, filamentation is significantly reduced , indicating that the abnormal phenotype is linked to replication arrest. A second characteristic of the tus+ intRl strains is that they require a functional recA gene for viability (S . Dasgupta & K. Nordstrom, unpublished results) . The dependence of these strains on recA can be alleviated by inactivating the tus gene, suggesting that arrested replication forks in the chromosome of tus+ intR l strains produce structures that must be resolved by RecA. Alternately , stable DNA replication (sdr) , which requires RecA (47), may b e needed to complete the chromosome. An intriguing observation reported recently by Louam et al (58) was the increased frequency of RecA-mediated homologous recombination associated with the replication-arrest sites. In this study, the frequency of recombination at a given point on the chromosome was measured by monitoring the excision of a temperature-sensitive prophage that had been inserted into a transposon via homologous recombination . Excision of the prophage could be easily scored, allowing an accurate determination of the frequency of homologous recombination at many different points around the E. coli chromosome. The excision frequency was consistent ( 10-5) for the majority of the chromosome (from min 44 clockwise to min 23), increased significantly ( 10- to 1 00-fold) at the edges of the terminus region near TerA and TerB , and reached a

maximum of 10-2 at min 3 3 . 8 , near the TerC locus. The increased frequency of recombination in the vicinity of the replication-arrest sites depended upon a functional recA gene, indicating that the machinery for homologous recombination is required to excise the prophage. The authors suggested that RecA activity, in conjunction with the presence of an arrested replication fork, could account for the observed level of hyperrecombination. Recent data from other laboratories also support the hypothesis that an increased recombination frequency is associated with the replication-arrcst sites. T. Horiuchi and coworkers (unpublished results) found that recombinational hotspots were located in the terminus region and that in some cases hyperrecombination depended on the presence of a functional tus gene, suggesting that the replication-arrest sites were involved. Also , Bierne et al (4) have reported that the TerB locus can act as a deletion hotspot when


627


inserted in the proper orientation into hybrid plasmids containing phage M 1 3 origins of replication. Although the significance of these observations i s unclear with regards to Ter-site function and the role of Ter sites i n the physiology of E. coli, they suggest that these sites are associated with cellular activities in addition to replication arrest. Although the frequency of Ter-site usage in exponentially growing E. coli is unknown, TerC is probably uscd most often in replication cycles that utilize a replication-arrest site. Louam et al (58) pointed out that TerC is almost

equidistant from oriC and that the region of the chromosome just upstream of TerC is replicated predominantly in the clockwise direction . Thus, the TerC region is the preferred region of replication termination. Clearly, however, other Ter sites are also utilized in a significant percentage of replication cycles. Pelletier et al (73) demonstrated that replication forks were arrested at both TerA and TerB in exponentially growing cells, indicating that these two sites were used relatively frequently. Surprisingly, strains containing chromo

somal inversions that doubled the distance from oriC to TerB compared with the distance from oriC to TerA also showed significant use of both the TerA and TerB sites, even though replication of the clockwise arm of the chromo some should have taken twice as long as replication of the counterclockwise arm. The replication rates of the individual chromosomal arms might be adjusted to compensate for the difference in replication distance, al lowing both replication forks to arrive at the terminus region at the same time. Although the Ter sites are distributed and oriented to form a replication fork trap and thus limit the end of the replication cycle to the terminus region, the recent identification of the replication-arrest sites TerE and TerF well outside of the traditional terminus region suggests that replicati on arrest by the Ter sites may serve other purposes as well. It is unlikely that a significant portion of replication forks originating from oriC would reach these arrest sites because the replication forks must first traverse the two arrest sites located closer to the terminus region before arriving at the outermost sites (Figure 2) . However, if replication forks were initiated at origins other than oriC, then these nonterminus replication-arrest sites would limit replication along the terminus-to-origin axis while allowing replication to proceed nor mally along the origin-to-terminus axis. Examples of secondary replication origins that might utilize the replication-arrest sites outside of the terminus region are the sdr origins (47), prophage origins, or replication origins of integrated plasmids. Future Prospects

The preceding section clearly shows that our understanding of the selective advantage of replication arrest is fragmentary at best. Unfortunately , the


628

HILL

intriguing questions posed by the existence of such a highly conserved, yet apparently dispensable system of replication arrest are also the most difficult to address. Perhaps the recent association of hyperrecombination with replication-arrest sites is the first step in obtaining a broader understanding of the function of the replication-arrest systems of bacteria. From the biochemi cal standpoint, many questions regarding the ability of the Tus-Ter complex to arrest DNA replication also remain, but these appear to be more tractable. The mechanics of Tus-mediated arrest of replication using in vitro replication systems will continue to be explored in an effort to elucidate the action of Tus against replication-fork components. X-ray crystallography of the Tus-Ter complex should provide a wealth of information regarding the protein-DNA contacts and the possible implications of these contacts in Tus-mediated replication arrest. Also, a genetic approach involving the isolation of mutant Tus proteins would help clarify the mechanism of Tus action . If Tus uses protein-protein interactions to arrest DNA replication, the domain of the protein that interacts with the replication fork might be distinct from the DNA-binding domain of the protein. If this is so , it should be possible to introduce mutations that enable Tus to bind normally to a Ter site but impair the ability of the Tus-Ter complex to arrest DNA replication. Alternately , if all mutations in Tus that affect the efficiency of replication arrest also impair Tus binding, then this result would suggest that the replication arrest and DNA-binding functions are inseparable, a notion consistent with a general ized action against DNA-translocating proteins . Mutations in the tus gene may also help sort out the physiological advantage of the replication-arrest system. Probably the most exciting applications of the study of replication-arrest systems will be the use of these systems as tools to examine other aspects of DNA replication and cell division. By inserting Ter sites at specific locations in a plasmid or chromosome, one can trap replication forks at defined points within the replicon. The products of the arrested replication fork can then be readily analyzed. The E. coli Ter sites have already been exploited to examine the initiation events of plasmid R l 162 (93), and the tere region of B. subtilis was used to map the initiation site of plasmid pAMJ31 ( 10) . Other potential uses of the replication-arrest system include dissection of the final steps of chromosome replication , analysis of the distribution of replisome proteins at the arrested replication fork, determination of membrane binding of the terminus region of E. coli, and possibly examination of the coordination of DNA replication with the onset of cell division. Clearly, the study of replica tion arrest and the use of replication-arrest systems to analyze the biology and biochemistry of DNA replication will continue to yield valuable information for many years to come.


629

ACKNOWLEDGMENTS

The author gratefully acknowledges Ann Flower, Peter Kuempe1, B ryan Roecklein, Molly Schmid, and Gerry Wake for critically evaluating the contents of this manuscript.


Literature Cited I . Bachmann, B. J. 1 990. Linkage map of Escherichia coli K- 1 2 , Edition 8. Micro bioi. Rev. 54: 1 30-97 2. Bastia, D. , Germino, J . , Crosa, J. H . , Ram, J . 1 98 1 . The nucleotide sequence surrounding the replication terminus of plasmid R6K. Proc. Natl. Acad. Sci. USA 78:2095-99 3. Bedrosian, C. L . , Bastia, D. 1 99 1 . Es cherichia coli replication terminator pro tein impedes simian virus 40 (SY40) DNA n�pljcation fork movement and SY40 large tumor antigen helicase activ ity in vitro at a prokaryotic terminus se quence. Proc. Natl. Acad. Sci. USA 88:261 8-22 4. Bierne, H . , Ehrlich, S. D . , Michel, B . 1 99 1 . The replication termination signal terB of the Escherichia coli chromosome is a deletion hot spot. EMBO J. 1 0:2699-2705 5. Bird, R. E . , Louarn, J . , Martuscelli , J . , Caro, L. 1972. Origin and sequence of chromosome replication in Escherichia coli. J. Mol. Bioi. 70:549-66 6. Bitner, R . M . , Kuempel , P. L. 1 98 1 . PI transduction map spanning the replica tion terminus of Escherichia coli K 1 2 . Mol. Gen. Genet. 1 84:208- 1 2 7 . Blakely. G . , Colloms, S . , May, G . , Burke, M . , Sherratt, D. 1 99 1 . Es cherichia coli XerC recombinase is re quired for chromosomal segregation at cell division. New Bioi. 3 :789-98 8. Bouche, J. P. 1982. Physical map of a 470 kilobase pair region flanking the ter minus of DNA replication in the Es cherichia coli K 1 2 genome. J. Mol. Bioi. 1 54: 1-20 9. Bouche, J. P . , Gelugne, J. P. , Louarn, J . , Louarn, J. M . , Kaiser, K. 1 982. Re lationships between the physical and ge netic maps of a 470 X 103 base-pair region around the terminus of Es cherichia coli K I 2 DNA replication. J. Mol. Bioi. 154:21-32 10. Braund, C., Ehrlich, S . D. , Janniere, L. 1 99 1 . Unidirectional theta replication of the structurally stable Enterococcus faecalis plasmid pAMb l . EMBO J. 10: 2 1 7 1-77

I I . Brewer, B. J . , Fangman, W. L. 1 988. A replication fork barrier at the 3 ' end of yeast ribosomal RNA gene. Cell 55: 637-43 1 2 . Carrigan, C. M . , Haarsma, J. A . , Smith, J . A . , Smith, M. T . , Wake, R . G . 1 987. Sequence features o f the replication terminus of the Bacillus sub tilis chromosome . Nucleic Acids Res. 1 5 :8501-9 1 3 . Carrigan, C. M . , Pack, R. A . , Smith, M. T . , Wake, R. G. 1 991 . Nonnal terC region of the Bacillus subtilis chromo some acts in a polar manner to arrest the clockwise replication fork. J. Mol. Bioi. 222 : 1 97-207 14. Crosa, J. H. 1 980. Three origins of replication are active in vivo in the R plasmid RSFI040. J. Bioi. Chern. 255: 1 1 075-77 1 5. Dasgupta, S . , Bernander, R . , Nord strom, K. 1 99 1 . In vivo effect of the tus gene on cell division in an Escherichia coli strain where chromosome replica tion is under control of plasmid R I . Res. Microbial. 142 : 1 77-80 16. de Boer, P. A. J . , Cook, W. R . , Roth field, L. I. 1 990. Bacterial cell division . Annu. Rev. Genet. 24:249-74 1 7 . deMassy, B . , Bejar, S . , Louarn, J . , Louarn, J . M . , Bouche, J . P . 1 987. In hibition of replication forks exiting the terminus region of the Escherichia coli chromosome occurs at two loci sepa rated by 5 min. Proc. NaIL. Acad. Sci. USA 84: 1 759-63 1 8 . DiGate, R. J . , Marians, K. J. 1 988. Identification of a potent decatenating enzyme from Escherichia coli. J. Bioi. Chern. 263: 1 3366--7 3 19. Fouts, K. E . , Barbour, S . D. 1 982. In sertions of transposons through the ma jor cotransduction gap of Escherichia coli K 1 2 . J. Bacterial. 149: 1 06-- 1 3 2 0 . Fran

DNA methylation is stable during replication and cell cycle arrest.

Frequent exchange of the DNA polymerase during bacterial chromosome replication.

A new bacterial gene (groPC) which affects lambda DNA replication.

DNA replication, the bacterial cell cycle, and cell growth.

Escherichia coli Tus protein acts to arrest the progression of DNA replication forks in vitro.

Mitotic UV irradiation induces a DNA replication-licensing defect that potentiates G1 arrest response.

DNA replication.

In Vitro Whole Genome DNA Binding Analysis of the Bacterial Replication Initiator and Transcription Factor DnaA.

The bacterial DnaA-trio replication origin element specifies single-stranded DNA initiator binding.

DNA replication proteins as potential targets for antimicrobials in drug-resistant bacterial pathogens.

Bacterial DNA replication initiation factor priA is related to proteins belonging to the 'DEAD-box' family.

Prokaryotic DNA replication.

Editorial. DNA replication.

Animal Mitochondrial DNA Replication.

Mutations and DNA replication.

DNA virus replication compartments.

Macrophage activation induced by Brucella DNA suppresses bacterial intracellular replication via enhancing NO production.

Self-replication of DNA rings.

Defects of mitochondrial DNA replication.

Eukaryotic DNA replication complex.

Papillomavirus DNA replication.

DNA replication and beyond.

Eukaryotic DNA replication.

SnapShot: Origins of DNA replication.