REPRODUCTION RESEARCH

ARX/Arx is expressed in germ cells during spermatogenesis in both marsupial and mouse Hongshi Yu1,2, Andrew J Pask1,2,3, Yanqiu Hu1,2, Geoff Shaw1,2 and Marilyn B Renfree1,2 1

ARC Centre of Excellence for Kangaroo Genomics and 2Department of Zoology, The University of Melbourne, Melbourne, Victoria 3010, Australia and 3Department of Molecular and Cell Biology, The University of Connecticut, Storrs, Connecticut 06269, USA

Correspondence should be addressed to M B Renfree at Department of Zoology, The University of Melbourne; Email: [email protected]

Abstract The X-linked aristaless gene, ARX, is essential for the development of the gonads, forebrain, olfactory bulb, pancreas, and skeletal muscle in mice and humans. Mutations cause neurological diseases, often accompanied by ambiguous genitalia. There are a disproportionately high number of testis and brain genes on the human and mouse X chromosomes. It is still unknown whether the X chromosome accrued these genes during its evolution or whether genes that find themselves on the X chromosome evolve such roles. ARX was originally autosomal in mammals and remains so in marsupials, whereas in eutherian mammals it translocated to the X chromosome. In this study, we examined autosomal ARX in tammars and compared it with the X-linked Arx in mice. We detected ARX mRNA in the neural cells of the forebrain, midbrain and hindbrain, and olfactory bulbs in developing tammars, consistent with the expression in mice. ARX was detected by RT-PCR and mRNA in situ hybridization in the developing tammar wallaby gonads of both sexes, suggestive of a role in sexual development as in mice. We also detected ARX/Arx mRNA in the adult testis in both tammars and mice, suggesting a potential novel role for ARX/Arx in spermiogenesis. ARX transcripts were predominantly observed in round spermatids. Arx mRNA localization distributions in the mouse adult testis suggest that it escaped meiotic sex chromosome inactivation during spermatogenesis. Our findings suggest that ARX in the therian mammal ancestor already played a role in male reproduction before it was recruited to the X chromosome in eutherians. Reproduction (2014) 147 279–289

Introduction The X-linked aristaless homeobox gene, ARX, belongs to the family of paired-type homeodomain transcription factors that have essential roles in the development of the forebrain, olfactory bulb, pancreas, skeletal muscle, and gonads in mice and humans (Kitamura et al. 2002, Heller et al. 2005, Yoshihara et al. 2005, Biressi et al. 2008). ARX was initially identified as an important regulator of forebrain development in mice and zebrafish (Schneitz et al. 1993, Miura et al. 1997). Subsequently, ARX orthologs were detected in the forebrain of chickens (Cobos et al. 2005), Xenopus (El-Hodiri et al. 2003, Kelly et al. 2005, Seufert et al. 2005), and Caenorhabditis elegans (Melkman & Sengupta 2005). The ARX protein contains a Q (50) paired-type homeodomain, a C-terminal aristaless domain, and an N-terminal octapeptide and acts as a nuclear transcriptional regulator to activate or inhibit gene expression (Seufert et al. 2005, McKenzie et al. 2007, Biressi et al. 2008, Fullenkamp & El-Hodiri 2008, Colasante et al. 2009). The ARX gene encodes a 562-amino acid protein (Ohira et al. 2002, Stromme et al. 2002) with four characteristic polyalanine (PolyA) tracts where most of the ARX mutations occur q 2014 Society for Reproduction and Fertility ISSN 1470–1626 (paper) 1741–7899 (online)

(Gecz et al. 2006). ARX mutations in humans lead to multiple neurological disorders including X-linked lissencephaly with or without ambiguous genitalia (XLAG syndrome), epilepsy, and mental retardation. ARX plays crucial roles in the development and maintenance of the CNS in embryogenesis and adulthood (Miura et al. 1997, Kitamura et al. 2002, El-Hodiri et al. 2003, Colombo et al. 2004, Poirier et al. 2004, Melkman & Sengupta 2005, Yoshihara et al. 2005, Friocourt et al. 2006). ARX is expressed in the forebrain, predominantly in telencephalic structures, of zebrafish, mice, and humans throughout fetal development. The distribution of ARX mRNA in human fetal brain suggests that ARX is involved in the differentiation and maintenance of specific neuronal cell types in the CNS (Ohira et al. 2002). Arx mutations lead to the development of a small brain with reduced olfactory bulbs, confirming that the Arx gene is necessary for normal brain development (Kitamura et al. 2002, Yoshihara et al. 2005). Arx is expressed at all stages of pancreatic development in the proliferating epithelium, differentiating pancreatic precursors, and islets of Langerhans in mice (Collombat et al. 2003). Deficiency of Arx results in a DOI: 10.1530/REP-13-0361 Online version via www.reproduction-online.org

280

H Yu and others

loss of mature endocrine a-cells with a concomitant increase in the numbers of b- and d-cells (Collombat et al. 2003), suggesting that Arx is required for the specification and differentiation of a-cells (Collombat et al. 2003, 2005). Arx is strongly expressed in differentiating embryonic muscle and is progressively decreased during myogenesis, acting as a positive regulator of the differentiation and specification of skeletal muscle fibers (Biressi et al. 2008). ARX is also important for mammalian gonadal development. In mice, Arx is strongly expressed in the fetal testis, principally in the interstitial cells, including peritubular myoid cells, tunica albuginea, endothelial cells, and interstitial fibroblast-like cells. However, Arx is barely detectable in developing Sertoli cells, Leydig cells, and germ cells (Kitamura et al. 2002). Arxknockout neonatal male mice have smaller testes and seminiferous tubules of a larger diameter, but do not survive to adulthood (Kitamura et al. 2002). Arx functions through a paracrine signaling pathway to promote the differentiation of Leydig cells. Loss of Arx decreases the number of Leydig cells that produce testosterone to maintain testis development, resulting in X-linked lissencephaly with abnormal genitalia (XLAG) syndrome (Ogata et al. 2000, Kitamura et al. 2002). Surprisingly, there have been no detailed studies of ARX expression in the adult testes of any mammal. In addition to its role in testis development, weak expression of Arx is also observed in the developing mouse ovary at the boundary of the mesonephros at E14.5 (Kitamura et al. 2002), but a specific role for Arx in ovary development has not been investigated yet. The X and Y chromosomes have evolved from autosomes in the common mammalian ancestor (Ohno 1967, Skaletsky et al. 2003, Ross et al. 2005, Graves 2006). The human X chromosome comprises an X conserved region (XCR) present in all therian mammals and recently added regions (XAR) present on the X chromosome in eutherians but located on an autosome in the common therian ancestor and in extant marsupials (Alsop et al. 2005). Comparative mapping in tammars, platypuses, chickens, and fish indicates that the XAR was translocated to the human X chromosome in a block of genes, after the divergence of marsupials from eutherian mammals (Graves 2008, Veyrunes et al. 2008, Delbridge et al. 2009). ARX maps to the XAR in tammars and so is X-linked in eutherian mammals while being autosomal (on chromosome 5p) in marsupials (Delbridge et al. 2008) and other non-mammalian vertebrates. Since the X chromosome is hemizygous in males, any genes that confer a reproductive advantage can be directly selected for. As a result, the eutherian X chromosome is thought to have become enriched with genes that have functions related to reproduction (Saifi & Chandra 1999, Wang et al. 2001, Vallender & Lahn 2004, Ropers & Hamel 2005, Delbridge & Graves 2007, Mueller et al. 2008). Reproduction (2014) 147 279–289

As marsupials occupy an important position in X chromosome evolution in mammals, this study examined the expression of autosomal ARX in the tammar wallaby and compared this with the expression of its X-linked homologue Arx in the mouse. We demonstrate that autosomal ARX was already dynamically expressed during testis development and spermatogenesis before it was recruited to the X chromosome in eutherian mammals.

Materials and methods Animals Tammar wallabies (Macropus eugenii) from Kangaroo Island (South Australia) were maintained in open grassy yards supplemented with fresh vegetables and water ad libitum in our breeding colony in Melbourne, Australia. Pouch young of various ages were removed from their mother’s pouch for sampling. The age of pouch young was estimated using head length from published growth curves (Poole et al. 1991). Samples of mouse (Swiss white) tissue were collected opportunistically from other ethically approved experiments. Mice were bred in the Department of Zoology. All sampling techniques and tissue collection procedures conformed to the Australian National Health and Medical Research Council guidelines (2004) and were approved by the University of Melbourne Animal Experimentation and Ethics Committees.

Tissues Adult tissues from tammars including brain, pituitary, hypothalamus, olfactory bulb, thyroid, muscle, spleen, mammary gland, heart, lung, liver, kidney, and adrenal were collected from three adult females (along with uterus and ovary) and two adult males (along with testes). Fetal gonads 1 day before birth (day 25 of gestation, nZ3), pouch young gonads after birth (dppZdays post partum), d2pp (nZ3), d7pp (nZ3), d10pp (nZ2), d15pp (nZ2), and d24pp (nZ3), and mature gonads (nZ2), as well as adult testes from mice (nZ4) for molecular analysis were snap–frozen in liquid nitrogen and stored at K80 8C until use. Olfactory bulbs were collected from both sexes of pouch young aged between d14 and d89pp. All tissues were collected under RNase-free conditions. Tissues for in situ hybridization were fixed overnight in 4% paraformaldehyde, washed several times with 1! PBS, and stored in 70% ethanol before paraffin embedding and sectioning at 7 mm.

Cloning of tammar ARX gene and gene structure determination Cross-species primers (ARXFw1 and ARXRv1) spanning the conserved regions of ARX were designed to partially clone ARX in tammars. Tammar ARX gene-specific primers (nested primers) were designed from the above PCR fragment for 3 0 and 5 0 RACE to isolate the full gene transcript (the sequences of all primers are listed in Table 1). cDNA template was derived from reverse-transcribed total RNA from the head of a fetal tammar, using the SMART cDNA Library Construction Kit www.reproduction-online.org

ARX has a novel role in spermatogenesis

281

Table 1 Primers designed for the analysis of ARX expression by PCR. Primers

Sequence (5 0 –3 0 )

Application

ARXFw1 ARXRv1 ARXFw2 ARXRv2 SMART IV CDS III

CAGTTTCAGCTGC(A/T)GGA(A/G)CTGG TTCCC(A/C)GG(C/G)AGGAT(A/G)TTGA ACTCACCCTCCAGGTTTGC CTGGGTGATGAGGAGGGA AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG ATTCTAGAGGCCGAGGCGGCCGACATG-d(T)30NK1N (nZA, G, C, or T; NK1ZA, G, or C) AAGCAGTGGTATCAACGCAGAGT ACTCACCCTCCAGGTTTGC TGAGGAGGAAAGGACAGG GATCCATTGGAGGGCAAGTCT CCAAGATCCAACTACGAGCTTTTT

Cross-species cloning and RT-PCR Cross-species cloning and RT-PCR 3 0 RACE 5 0 RACE 5 0 RACE 3 0 RACE

5 0 PCR primers ARXFw3 ARXRv3 18S F 18S R

5 0 RACE RT-PCR RT-PCR RT-PCR RT-PCR

All the primers are listed in the 5 0 to 3 0 orientation; CDSIII, Smart IV, and 5 0 PCR primers were synthesized by SIGMA (Genosys) according to the SMART cDNA Library Construction Kit (Clontech).

(Clontech). 5 0 RACE was first carried out with primer 5 0 PCR and ARXRv1 and then 5 0 PCR and nested primer ARXRv2 were used to carry out 5 0 RACE. 3 0 RACE was carried out using the ARXFw1 and CDS III primers. Nested PCR was carried out using the ARXFw2 and CDS III primers. PCR cycling conditions were as follows: 35 cycles of 30 s, 95 8C; 60 s, 50 8C; and 90 s, 72 8C, in a 25 ml reaction mixture with GoTaq Green Master Mix (Promega) and 0.4 mM of each primer. Comparative analysis was carried out to determine the gene structure of ARX in tammars using the gene structure of humans, mice, rats, South American grey short-tailed opossum (Monodelphis domestica), and the platypus (Ornithorhynchus anatinus) (http://www.ensembl.org/). Partial genomic sequence of M. eugenii was obtained from the trace archives at NCBI (http://www.ncbi.nlm.nih.gov/) to confirm the number of exons and their length and define the position of introns.

Sequence alignment analysis The ARX protein sequences were retrieved from Ensembl (http://www.ensembl.org/) or NCBI (http://www.ncbi.nlm.nih. gov/protein/): human – AAK93901; macaque – ENSMMUP 00000024253; mouse – NP_031518; rat – NP_001093644; dog – NP_001108138; opossum – ENSMODP00000009070; tammar – GU369938; Xenopus – NP_001079329; zebrafish – BAA21764; nematode – NP_509860; and fruit fly – AAF51505. Sequence identity was calculated by BLAST2 (http://blast.ncbi. nlm.nih.gov/Blast.cgi?PROGRAMZblastp&BLAST_PROGRAMSZblastp&PAGE_TYPEZBlastSearch&SHOW_DEFAULTSZon&BLAST_SPECZblast2seq&LINK_LOCZblasttab& LAST_PAGEZblastn&BLAST_INITZblast2seq). ARX protein sequences were aligned with Clustal-X (http://www.molecularevolution.org/software/alignment/clustal) and viewed and edited by GeneDoc (http://www.nrbsc.org/gfx/genedoc/).

Non-quantitative RT-PCR Total RNA was isolated using RNAwiz (Ambion, Inc., Austin, TX, USA) according to the manufacturer’s instructions. The quality and quantity of total RNA were verified by gel electrophoresis and optical density reading with a Nanodrop www.reproduction-online.org

(ND-1000 Spectrophotometer, Wilmington, DE, USA). Total RNA of 2 mg was treated with DNaseI (Ambion, Inc.) for 30 min at 37 8C. Total RNA of 1 mg was reverse-transcribed using the SuperScript III kit (Invitrogen). To check the expression pattern of ARX in developing tissues and adult tissues, PCR was carried out in a 25 ml reaction mixture with GoTaq Green Master Mix and 0.4 mmol of each primer (ARXFw3 and ARXRv3). Amplification conditions were as follows: 95 8C, 30 s; 53.5 8C, 60 s; and 72 8C, 120 s for 35 cycles (ARX) or 25 cycles (18S). Samples were analyzed on a 1.2 and 2% agarose gel for ARX and 18S respectively.

RNA isolation and northern blotting hybridization Total RNA was isolated from snap-frozen adult tissues with RNAwiz (Ambion, Inc.). The concentration and quality of total RNA were examined as described above. Equivalent amounts of RNA (about 12 mg) were subjected to electrophoresis in a 1% agarose gel containing formaldehyde (Sambrook & Russell 2001). Northern blotting was carried out according to standard methods. Hybridization was carried out at 42 8C in ULTRAhyb solution (Ambion, Inc.) with [a-32P]dCTP-labeled cDNA probe from exon 2 to the end of 3 0 UTR.

ARX mRNA in situ hybridization Antisense and sense RNA probes were prepared separately in the exon 2 region and were about 680 bp in length. Probes were synthesized and labeled with digoxigenin-UTP using SP6 or T7 RNA polymerase. Tissues were fixed in 4% paraformaldehyde overnight at 4 8C, rinsed several times with 1! PBS, embedded in paraffin, and sectioned onto polylysine slides (Menzel-Gla¨ser, Braunschweig, Germany). After dewaxing, the sections were washed several times with 1! PBS, glycine, Triton X-100, and triethanolamine buffer and were then immediately hybridized with probes at 42 8C. Hybridization signals were detected using anti-Dig alkaline phosphataseconjugated antibody and visualized with NBT/BCIP chromogen, according to the manufacturer’s instructions (Roche GmbH). The sections were counterstained with 0.1% Fast Red (Aldrich Chemical Corp., Milwaukee, WI, USA). Reproduction (2014) 147 279–289

282

H Yu and others

Results Tammar ARX gene is highly conserved among mammals The tammar ARX gene was cloned using degenerate primers and RACE PCR (GenBank accession number GU369938). ARX mRNA has 2747 bp, consisting of five exons (Fig. 1A). The sequence was confirmed from the trace archives of the tammar (http://blast.ncbi.nlm.nih. gov/Blast.cgi) and compared with the human ARX gene structure, in which the conserved homeobox region spans exon 2 to exon 4.

The tammar ARX gene encodes a protein of 552 amino acids, highly conserved with eutherian ARX (Fig. 1B). We compared the ARX proteins of humans, mice, tammars, and Xenopus to determine which regions were under strongest selection (Fig. 1C). ARX is especially conserved within the functional domains including the N-terminal octapeptide, known to repress transcriptional activity and act as a nuclear localization signals recognized by importin, the homeodomain with its characteristic helix-turn-helix DNA-interacting motif and the C-terminal aristaless transcription activation domain.

(A)

(B)

(C)

Figure 1 Characterization of tammar ARX. (A) The tammar ARX gene has five exons (black/white boxes) with a total open reading frame length of 2719 bp. The white portion of boxes indicates the UTRs and black portions indicate protein-coding sequences (CDS). The length of each exon is labeled above the box. The broken line between exons represents introns of unknown size, while intron 4 (the solid line between exon 4 and exon 5) has a length of 2621 bp. (B) Cross-species ARX protein sequence comparison. The highest identity (93%) was observed between tammars and opossums and the lowest identity was observed between mammals and invertebrates as expected. (C) ARX protein sequence alignment between humans, mice, tammars, and Xenopus. The octapeptide (dashed box), nuclear localization signals (NLS, black underline), homeodomain (dashed box), fourth polyalanine (p(A)4 dashed box), and aristaless domain (dashed box) are highly conserved in all the species. The first and third p(A) are highly conserved in humans, mice, and tammars. The amino acids shaded black are identical across all the species. Reproduction (2014) 147 279–289

www.reproduction-online.org

ARX has a novel role in spermatogenesis

283

There are three conserved nuclear localization signals (NLS) localized in the N-terminal region and both sides of the homeodomain in humans, mice, tammars, and Xenopus. Interestingly, three of the four PolyA tracts important for brain development in humans and mice are found only in therian mammals. However, the fourth tract is conserved in all the four species (Fig. 1C). Tammar ARX revealed highly conserved and novel sites of expression ARX plays critical roles in development of the forebrain, olfactory bulb, and gonads during embryogenesis in mice. To examine tammar ARX gene expression, we carried out RT-PCR using various tissues. Tammar ARX was widely expressed during embryogenesis (data not shown) and was cloned from the developing brain. We detected ARX expression throughout gonadal development (Fig. 2). ARX was detected in the gonads before sexual differentiation (2 days before birth), during the time that testicular cords begin to form in males (around day 2pp) and when the cortex and medulla form in the ovary in females (around day 7–8pp), and later during germ cell proliferation in the ovary (on days 2–20pp) and when the ovarian germ cells begin to enter meiosis (around day 25pp) (Renfree et al. 1996). There was no obvious difference in ARX expression between male and female samples at any time point (Fig. 2), suggesting that it may be important in sexual differentiation of both sexes. Using RT-PCR and northern blotting, we examined ARX expression in various adult tissues and confirmed the broad expression pattern in the brain observed in a previous report on the tammar (Delbridge et al. 2008). A northern blot confirmed that there was only one transcript of w2.8 kb in adult testis (Fig. 3), in contrast to the three isoforms detected in human skeletal muscle (Stromme et al. 2002). Interestingly, ARX was most strongly expressed in the adult testis, but, by comparison, it was only weakly expressed in the olfactory bulb, ovary, and skeletal muscle (Fig. 3). This finding suggests a previously unreported potential role for ARX in the adult testis. Therefore, we compared ARX mRNA localization and protein distribution in the adult testes of a marsupial and a eutherian mammal.

Figure 2 Tammar ARX gene expression in developing gonads. The tammar ARX gene was expressed in the developing ovary and testis at all stages examined from before birth (fetus: at 25 days gestation) to day 45 post partum throughout the period of gonadal sex determination and differentiation. 18S rRNA was the positive control, and the last lane is the negative control where template DNA was omitted from the PCR. www.reproduction-online.org

Figure 3 Northern blotting and RT-PCR in tammar adult tissues. Northern blot (top panel) identified a single transcript of 2.8 kb that was predominant in the testis, but not detected in other tissues consistent with the RT-PCR. RT-PCR (middle panel) revealed that ARX was strongly expressed in the adult testis and weakly expressed in the olfactory bulb, adrenal, ovary, and muscle. 18S (bottom panel) was the positive control for the RT-PCR.

Tammar ARX maintains a conserved localization in the developing brain and gonads ARX plays an important role in brain development in humans, mice, and zebrafish. To examine ARX expression and localization within the developing brain in marsupials, we examined the head on the day of birth, a stage that is equivalent to early intra-uterine development period of most eutherian mammals (Fig. 4A and B). ARX mRNA was detected in the epidermis (Fig. 4C) surrounding the head, and strong expression was detected in the tongue and palate epithelium (Fig. 4D and E), as well as in the nasal epithelium. ARX mRNA staining was also detected in the olfactory bulb (Fig. 4F) and the vomeronasal organ (VNO) (Fig. 4G) and, using RT-PCR, strongly in the developing olfactory bulb (data not shown). Tammar ARX was expressed in the neuronal cells at the site of the trigeminal ganglion (Fig. 4H), telencephalon (Fig. 4I), mesencephalon, metencephalon (Fig. 4J), and myelencephalon (Fig. 4K) in a pattern similar to that observed in mice and zebrafish. We examined ARX mRNA distribution in the developing gonads of tammar wallabies from before birth to 26 days after birth with mRNA in situ hybridization (Fig. 5). Germ cells in the tammar wallaby testis are still actively mitotically proliferating in the postnatal testis, peaking in number on day 25pp. At this stage, the germ cells are developing gonocytes and are not yet spermatogonia (Tyndale-Biscoe & Renfree 1987). Before sex determination, tammar ARX was localized in the cytoplasm of germ cells (Fig. 5A and B). Two days after birth, during the formation of testicular cords, ARX was detected in the cytoplasm of somatic cells and germ cells Reproduction (2014) 147 279–289

284

H Yu and others

Figure 4 ARX has a conserved mRNA localization in the developing brain. In situ hybridization of the tammar head with antisense ARX. mRNA distribution is indicated by dark blue staining (A). The sense probe hybridization control is shown in the inset box. The tissue is also shown with hematoxylin and eosin staining (B). mRNA was localized in the spinosum and granulosa cells of epidermis (C) surrounding the head and in the tongue epithelium (D) and palate epithelium (E). ARX staining was also found in the olfactory bulb (F) and vomeronasal organ (G), both regions important for smell and signal detection in mammals. ARX transcripts were found in the conserved regions of the developing brain in the neural cells of trigeminal ganglion (H), telencephalon (I), metencephalon (J), and myelencephalon (K).

(Fig. 5C and D). With testicular cord formation, ARX was expressed in the cytoplasm of some developing Sertoli cells and in germ cells (Fig. 5E). During ovarian differentiation (Fig. 5F), it was also cytoplasmic in the germ cells and some somatic cells. Around 25 days after birth, when male germ cells began to enter mitotic arrest, ARX was similarly detected in the cytoplasm of some Sertoli cells and germ cells (Fig. 5G). When female germ cells began to enter meiosis about day 25 after birth, ARX was observed predominantly in the cytoplasm of germ cells as well as somatic cells (Fig. 5H). Reproduction (2014) 147 279–289

Dynamic regulation of tammar ARX during spermatogenesis in the adult testis ARX mRNA was abundant in spermatogenic cells at specific stages and in some somatic cells (Fig. 6). Interestingly, unlike in the developing gonocytes, there was no expression in the mitotic spermatogonia and expression was only observed in these cells after the initiation of meiosis (Fig. 6A, B, C, D, and E). ARX mRNA was especially abundant in spermatocytes (Fig. 6A). As meiosis proceeded, it became restricted to the newly www.reproduction-online.org

ARX has a novel role in spermatogenesis

285

spermatids. No mRNA expression was detected in Sertoli cells at any stage (Fig. 6B). Dynamic regulation of Arx during spermatogenesis in the adult mouse testis This study, to our knowledge, is the first report of ARX expression in any adult mammalian testis. To determine whether our findings in the tammar represent a conserved role of ARX in the adult testis, we examined Arx expression at the mRNA level in the adult mouse testis. The Arx mRNA expression pattern in the mouse testis was similar to that in the tammar testis, especially in spermatogenic cells. There was no detectable staining in the spermatogonia and somatic cells (Fig. 7A, B, C, and D), but strong expression was detected in the primary and secondary spermatocytes as well as round spermatids (Fig. 7A, B, C, and D). At later stages of the spermatogenic cycle, there was very weak staining in the cytoplasm of elongated spermatids (Fig. 7A), but no mRNA staining was detected in the mature spermatozoa (Fig. 7B).

Discussion Figure 5 mRNA in situ showing ARX localization in tammar developing gonads. ARX mRNA localization in the developing gonads of tammars. mRNA distribution is indicated by dark blue staining and tissue is counterstained with 0.1% Nuclear Fast Red. On day 25 of gestation, ARX was detected in the cytoplasm of germ cells (A and B). On day 2 after birth during the formation of testicular cords, ARX mRNA was detected in the cytoplasm of some Sertoli cells and germ cells (C), and no difference in ARX mRNA was found in the equivalently staged ovary (D). On day 8 after birth, there was strong staining in the cytoplasm of germ cells and some Sertoli cells in the testis (E), and during ovarian differentiation, the same pattern of ARX staining was observed in the cytoplasm of germ cells and some somatic cells in the ovary (F). When male germ cells began to enter mitotic arrest on day 25 after birth, ARX transcripts were strongly expressed in the cytoplasm of germ cells and some Sertoli cells (G). When female germ cells began to enter meiosis on day 16 after birth, ARX staining was observed in the cytoplasm of both germ cells and somatic cells (H). A, C, E, and G show developing testes, while B, D, F, and H show developing ovaries. Black dotted box represents gonads; blue dotted box represents seminiferous tubules; and blue dotted line in H separates the cortex and medulla in the ovary. Scale barZ100 mm.

formed round spermatids, but there was no staining in the spermatocytes (Fig. 6B). As round spermatids developed, ARX staining became weaker in the cytoplasm, but it was still strong in the round spermatids (Fig. 6C). No mRNA staining was detected in the elongated spermatids and spermatozoa (Fig. 6D and E), but there was still strong expression in the cytoplasm of round spermatids at these stages (Fig. 6D and E). ARX mRNA was also observed in some Leydig cells (Fig. 6A) and peritubular myoid cells at early stages of the spermatogenic cycle (Fig. 6A, B, C, D, and E) before round spermatids were transformed into elongated www.reproduction-online.org

Comparative analysis of ARX/Arx in tammars and mice suggests that it has a highly conserved expression pattern during spermatogenesis, despite its different chromosomal location in these two species (X-linked in mice vs autosomal in marsupials). This study is the first to demonstrate that ARX may have a highly conserved role in spermatogenesis in addition to its established roles in neurogenesis. Evolution and conservation of ARX ARX has a conserved five-exon gene structure across eutherian and marsupial mammals and fruit flies. ARX is highly conserved at the protein level, with up to 93% identity between tammars and opossums, 85% with primates, and 56% with zebrafish (Fig. 1B). Conservation is even higher across the functional domains, such as the octapeptide domain, nuclear localization domain, homeodomain, and aristaless domain from the amphibian Xenopus to eutherian mammals. As in the mouse, the tammar ARX has three nuclear localization signals (NLS) that are identical to those of other species, consistent with their conserved role in directing and importing ARX into the nucleus, possibly mediated by importin (Lin et al. 2009, Shoubridge et al. 2010). Thus, ARX has been highly conserved despite its physical relocation in the genome from an autosome to the XAR of the eutherian X chromosome (Delbridge et al. 2008). ARX has conserved roles in early development. The strong mRNA staining of neural cells in the forebrain, midbrain, and hindbrain suggests that ARX plays a pivotal role in CNS development in tammars as it does in Reproduction (2014) 147 279–289

286

H Yu and others

Figure 6 mRNA in situ showing ARX localization in tammar adult testis. In situ hybridization of adult tammar testes with antisense ARX. mRNA distribution is indicated by dark blue staining and tissue is counterstained with 0.1% Nuclear Fast Red. Tammar ARX was strongly expressed in the round spermatids (RS) throughout all stages (A, B, C, D, E, F, and G) and there was no expression in the spermatogonia (SG), but there was stagespecific expression in other spermatogenic cells from the spermatocytes (SP) to the elongating spermatids (ES). At early stage I (A), ARX was expressed in the SP and some of the Leydig cells (LC) and peritubular myoid cells (PC) in the seminiferous cord. Slightly later in spermatogenesis at stage I (B), ARX was expressed in the RS and some of the LC, but in no other spermatogenic cells and Sertoli cells (SC). At stage IV (C), ARX was still strongly expressed in the RS, but weakly in the cytoplasm of ES. By stage V/VI (D), ARX was restricted to the RS. With the continuation of spermatogenesis (stage VIII, E), ARX was observed in the SP again besides the RS. At the early stage of spermatogenesis (F) and later stages (G), there was a dynamic expression of ARX in the LC but no expression in the SG in all the stages. The stages of spermatogenesis are described in Tyndale-Biscoe & Renfree (1987). SG, spermatogonia; SP, spermatocytes; RS, round spermatids; ES, elongating/elongated spermatids; SZ, spermatozoa; LC, Leydig cells; PC, peritubular myoid cells; SC, Sertoli cells. Scale barZ100 mm.

mice (Kitamura et al. 2002, Seufert et al. 2005). The similarity in tammar and murine ARX/Arx localization in the developing olfactory bulbs suggests that ARX is important for the normal development of this organ (Yoshihara et al. 2005). The mRNA distribution both in the olfactory epithelium and in the VNO suggests that ARX could be important for developing the sense of smell that is so essential for directing newborn wallabies into the pouch to locate the teats (Schneider et al. 2009). Taken together, the conserved expression pattern in the developing brain of marsupials and mice suggests that ARX is a critical gene for brain development throughout therian mammalian evolution. Strong mRNA staining was also observed in the epithelium of the tongue and palate and in the underlying muscle. Early tongue development is especially important in the head of the newborn marsupial, which must be able to attach to the nipple and suck at the very early stages of development (Hughes & Hall 1988). No obvious differences based on the RT-PCR were detected between the developing testis and ovary in tammar wallabies, similar to mice (Kitamura et al. 2002). The mRNA cellular location (Fig. 5) is similar to the pattern shown using whole-mount in situ hybridization of the mouse E11.5 testes (Colombo et al. 2004) and Reproduction (2014) 147 279–289

E14.5 gonads (Kitamura et al. 2002). Tammar ARX mRNA had a restricted pattern of expression in adult tissues with the highest expression in the adult testis and extremely weak expression in the olfactory bulb, adrenal, ovary, and muscle. By contrast, ARX is highly expressed in skeletal muscle in humans (Ohira et al. 2002, Stromme et al. 2002). ARX escapes meiotic sex chromosome inactivation during spermatogenesis This is the first report of the mRNA expression of ARX in the adult testis of any mammal during spermatogenesis. The spermatogenic cycle of the germ cells in the testis is coordinated and maintained by the somatic cells including the Sertoli cells, peritubular myoid cells, and Leydig cells that participate in spermatogenesis via their response to gonadotrophic signals (LH and FSH) from the hypothalamic–pituitary–testicular axis (Roser 2008, Yan et al. 2008, He et al. 2009, Li et al. 2009, Walker 2009, Cheng et al. 2010). However, most of the genes on the sex chromosomes are silenced during the meiotic phase of spermatogenesis by a process known as meiotic sex chromosome inactivation (MSCI), but are active in the mitotic stage and early meiosis (Hornecker et al. 2007, www.reproduction-online.org

ARX has a novel role in spermatogenesis

Figure 7 Arx localization in the adult mouse testis. mRNA in situ hybridization of adult mouse testes with antisense mouse Arx. mRNA localization is indicated by dark blue staining and tissue is counterstained with 0.1% Nuclear Fast Red. At stage II (A), Arx mRNA was mainly localized to the cytoplasm of SP and RS and there was no expression in SG, PC, and LC; at stage VII (B), Arx was also expressed in the cytoplasm of SP and RS, but no expression was detected in SG and SZ; at stage X (C), Arx was stained in SP and weakly in ES, but no staining was found in SG and LC; at stage XI (D), Arx was only detected in RS, but not in SG, ES, and SC. The stages of spermatogenesis are described in Hess & de Franca (2008). The abbreviations are the same as those in Fig. 6. Scale barZ100 mm.

Cloutier & Turner 2010). Tammar ARX is autosomal, but mouse Arx is X-linked. We examined the change in the expression of ARX/Arx between marsupials and mice during spermatogenesis to gain insight into how sex and reproduction-related (SRR) genes evolved. While tammar ARX can be expressed at any stage of spermatogenesis due to its autosomal localization, mouse Arx would not be expressed in the meiotic phase of spermatogenesis if it is silenced by MSCI. Tammar ARX mRNA was predominantly transcribed in the cytoplasm of spermatocytes and round spermatids within the seminiferous tubules, which is similar to that of NANOG expression in the adult testis (Kuijk et al. 2010). This requires expression during meiosis when genes on the sex chromosomes are normally silenced. If mouse Arx is subject to MSCI, it would not be expressed at equivalent stages in the germ cells of the adult testis. To determine whether this is the case, we carried out mRNA in situ hybridization in mouse testes and, surprisingly, found an expression pattern in the germ line that was almost identical to that observed in tammar testes. Thus, ARX appears to escape MSCI to maintain its role in postmeiotic stages of spermatogenesis. Relationship of autosomal ARX in a marsupial with X-linked Arx in mouse An important aim of this study was to understand the fundamental question of why a disproportionately high www.reproduction-online.org

287

number of testis and brain genes have accumulated on the human and mouse X chromosomes. It is still unknown whether the X chromosome has accrued testis and brain genes during its evolution or whether genes that find themselves on the X chromosome evolve these roles. We examined how gene expression changed for the ARX gene when it became relocated from an autosome in the therian mammalian ancestor to the X chromosome in eutherians. ARX was originally autosomal in mammals and remains so in marsupials, making it an excellent comparison to the mouse X-linked Arx. Our findings suggest that ARX/Arx already played a role in male reproduction long before it was recruited to the X chromosome in eutherians, adding to the pool of data suggesting that the eutherian X chromosome actively recruits testis genes (Saifi & Chandra 1999, Wang et al. 2001, Vallender & Lahn 2004, Mueller et al. 2008). Our investigations also uncovered the previously unreported dynamic expression of ARX/Arx during spermatogenesis. However, as yet, there is no direct evidence to confirm a functional role for ARX/Arx in spermatogenesis. In mice, mutations in Arx cause early postnatal death (Kitamura et al. 2002), making it impossible to examine the function of Arx in spermatogenesis in adults. A conditional knockout approach is needed to clarify this question. In non-traditional model species such as marsupials, functional analyses are extremely difficult and it is not possible at present to generate a transgenic or conditional transgenic tammar. However, X-linked ARX/Arx mRNA is expressed in spermatocytes and round spermatids in both tammars and mice maintaining this profile of expression for over 160 million years of divergent evolution (Fig. 7). In addition, if mouse Arx is subject to MSCI, it would not be expressed at these stages in the germ cells of the adult testis. Our study provides strong evidence that Arx must escape MSCI. Thus, we postulate that the dynamic expression of Arx/ARX during spermatogenesis in both mice and tammars is highly suggestive of a potential role in spermatogenesis.

Conclusions A similar but subtly different expression pattern during spermatogenesis between tammars and mice highlights the similarities in the basic processes of gametogenesis in marsupial and eutherian mammals. Although ARX is located on an autosome in tammars and not on the X chromosome as in eutherians, its expression does not appear to have been altered. This lends support to the theory that the mammalian X chromosome may selectively acquire SRR genes, rather than such genes evolving SRR functions after relocation to the X chromosome. Mouse Arx escapes MSCI during spermatogenesis, suggesting that it has a potentially important function in mammalian spermatogenesis that Reproduction (2014) 147 279–289

288

H Yu and others

has remained highly conserved for over 160 million years.

Declaration of interest The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding This study was supported by the Australian Research Council Centre of Excellence in Kangaroo Genomics, a Federation Fellowship to M B Renfree, and a National Health and Medical Research Council R D Wright Fellowship to A J Pask, and an NHMRC project grant to M B Renfree, G Shaw, and A J Pask.

Acknowledgements The authors thank all the members of the tammar research team.

References Alsop AE, Miethke P, Rofe R, Koina E, Sankovic N, Deakin JE, Haines H, Rapkins RW & Marshall Graves JA 2005 Characterizing the chromosomes of the Australian model marsupial Macropus eugenii (tammar wallaby). Chromosome Research 13 627–636. (doi:10.1007/s10577005-0989-2) Biressi S, Messina G, Collombat P, Tagliafico E, Monteverde S, Benedetti L, Cusella De Angelis MG, Mansouri A, Ferrari S, Tajbakhsh S et al. 2008 The homeobox gene Arx is a novel positive regulator of embryonic myogenesis. Cell Death and Differentiation 15 94–104. (doi:10.1038/sj. cdd.4402230) Cheng CY, Wong EW, Yan HH & Mruk DD 2010 Regulation of spermatogenesis in the microenvironment of the seminiferous epithelium: new insights and advances. Molecular and Cellular Endocrinology 315 49–56. (doi:10.1016/j.mce.2009.08.004) Cloutier JM & Turner JM 2010 Meiotic sex chromosome inactivation. Current Biology 20 R962–R963. (doi:10.1016/j.cub.2010.09.041) Cobos I, Broccoli V & Rubenstein JL 2005 The vertebrate ortholog of Aristaless is regulated by Dlx genes in the developing forebrain. Journal of Comparative Neurology 483 292–303. (doi:10.1002/cne. 20405) Colasante G, Sessa A, Crispi S, Calogero R, Mansouri A, Collombat P & Broccoli V 2009 Arx acts as a regional key selector gene in the ventral telencephalon mainly through its transcriptional repression activity. Developmental Biology 334 59–71. (doi:10.1016/j.ydbio.2009.07.014) Collombat P, Mansouri A, Hecksher-Sorensen J, Serup P, Krull J, Gradwohl G & Gruss P 2003 Opposing actions of Arx and Pax4 in endocrine pancreas development. Genes and Development 17 2591–2603. (doi:10.1101/gad.269003) Collombat P, Hecksher-Sorensen J, Broccoli V, Krull J, Ponte I, Mundiger T, Smith J, Gruss P, Serup P & Mansouri A 2005 The simultaneous loss of Arx and Pax4 genes promotes a somatostatin-producing cell fate specification at the expense of the alpha- and beta-cell lineages in the mouse endocrine pancreas. Development 132 2969–2980. (doi:10.1242/dev.01870) Colombo E, Galli R, Cossu G, Gecz J & Broccoli V 2004 Mouse orthologue of ARX, a gene mutated in several X-linked forms of mental retardation and epilepsy, is a marker of adult neural stem cells and forebrain GABAergic neurons. Developmental Dynamics 231 631–639. (doi:10.1002/dvdy.20164) Delbridge ML & Graves JA 2007 Origin and evolution of spermatogenesis genes on the human sex chromosomes. Society of Reproduction and Fertility Supplement 65 1–17. Reproduction (2014) 147 279–289

Delbridge ML, McMillan DA, Doherty RJ, Deakin JE & Graves JA 2008 Origin and evolution of candidate mental retardation genes on the human X chromosome (MRX). BMC Genomics 9 65. (doi:10.1186/14712164-9-65) Delbridge ML, Patel HR, Waters PD, McMillan DA & Marshall Graves JA 2009 Does the human X contain a third evolutionary block? Origin of genes on human Xp11 and Xq28 Genome Research 19 1350–1360. (doi:10.1101/gr.088625.108) El-Hodiri HM, Qi XL & Seufert DW 2003 The Xenopus arx gene is expressed in the developing rostral forebrain. Development Genes and Evolution 212 608–612. (doi:10.1007/s00427-002-0282-8) Friocourt G, Poirier K, Rakic S, Parnavelas JG & Chelly J 2006 The role of ARX in cortical development. European Journal of Neuroscience 23 869–876. (doi:10.1111/j.1460-9568.2006.04629.x) Fullenkamp AN & El-Hodiri HM 2008 The function of the Aristaless-related homeobox (Arx) gene product as a transcriptional repressor is diminished by mutations associated with X-linked mental retardation (XLMR). Biochemical and Biophysical Research Communications 377 73–78. (doi:10.1016/j.bbrc.2008.09.116) Gecz J, Cloosterman D & Partington M 2006 ARX: a gene for all seasons. Current Opinion in Genetics & Development 16 308–316. (doi:10.1016/ j.gde.2006.04.003) Graves JA 2006 Sex chromosome specialization and degeneration in mammals. Cell 124 901–914. (doi:10.1016/j.cell.2006.02.024) Graves JA 2008 Weird animal genomes and the evolution of vertebrate sex and sex chromosomes. Annual Review of Genetics 42 565–586. (doi:10.1146/annurev.genet.42.110807.091714) He Z, Kokkinaki M & Dym M 2009 Signaling molecules and pathways regulating the fate of spermatogonial stem cells. Microscopic Research and Technique 72 586–595. (doi:10.1002/jemt.20698) Heller RS, Jenny M, Collombat P, Mansouri A, Tomasetto C, Madsen OD, Mellitzer G, Gradwohl G & Serup P 2005 Genetic determinants of pancreatic epsilon-cell development. Developmental Biology 286 217–224. (doi:10.1016/j.ydbio.2005.06.041) Hess RA & de Franc¸a LR 2008 Spermatogenesis and Cycle of the Seminiferous Epithelium. In molecular mechanisms in spermatogenesis (Advances in Experimental Medicine and Biology, vol 636), pp. 1–15. Ed Yan Cheng C. Texas: Landes Bioscience/Springer ScienceCBusiness Media. Hornecker JL, Samollow PB, Robinson ES, Vandeberg JL & McCarrey JR 2007 Meiotic sex chromosome inactivation in the marsupial Monodelphis domestica. Genesis 45 696–708. (doi:10.1002/dvg.20345) Hughes RL & Hall LS 1988 Structural adaptations of the newborn marsupial. In The Developing Marsupial, pp. 8–27. Eds Tyndale-Biscoe CH and Janssens PA. Berlin: Springer-Verlag. Kelly LE, Davy BE, Berbari NF, Robinson ML & El-Hodiri HM 2005 Recombineered Xenopus tropicalis BAC expresses a GFP reporter under the control of Arx transcriptional regulatory elements in transgenic Xenopus laevis embryos. Genesis 41 185–191. (doi:10.1002/gene. 20113) Kitamura K, Yanazawa M, Sugiyama N, Miura H, Iizuka-Kogo A, Kusaka M, Omichi K, Suzuki R, Kato-Fukui Y, Kamiirisa K et al. 2002 Mutation of ARX causes abnormal development of forebrain and testes in mice and X-linked lissencephaly with abnormal genitalia in humans. Nature Genetics 32 359–369. (doi:10.1038/ng1009) Kuijk EW, de Gier J, Lopes SM, Chambers I, van Pelt AM, Colenbrander B & Roelen BA 2010 A distinct expression pattern in mammalian testes indicates a conserved role for NANOG in spermatogenesis. PLoS ONE 5 e10987. (doi:10.1371/journal.pone.0010987) Li MW, Mruk DD, Lee WM & Cheng CY 2009 Cytokines and junction restructuring events during spermatogenesis in the testis: an emerging concept of regulation. Cytokine & Growth Factor Reviews 20 329–338. (doi:10.1016/j.cytogfr.2009.07.007) Lin W, Ye W, Cai L, Meng X, Ke G, Huang C, Peng Z, Yu Y, Golden JA, Tartakoff AM et al. 2009 The roles of multiple importins for nuclear import of murine aristaless-related homeobox protein. Journal of Biological Chemistry 284 20428–20439. (doi:10.1074/jbc.M109. 004242) McKenzie O, Ponte I, Mangelsdorf M, Finnis M, Colasante G, Shoubridge C, Stifani S, Gecz J & Broccoli V 2007 Aristaless-related homeobox gene, the gene responsible for West syndrome and related www.reproduction-online.org

ARX has a novel role in spermatogenesis disorders, is a Groucho/transducin-like enhancer of split dependent transcriptional repressor. Neuroscience 146 236–247. (doi:10.1016/ j.neuroscience.2007.01.038) Melkman T & Sengupta P 2005 Regulation of chemosensory and GABAergic motor neuron development by the C. elegans Aristaless/ Arx homolog alr-1. Development 132 1935–1949. (doi:10.1242/dev. 01788) Miura H, Yanazawa M, Kato K & Kitamura K 1997 Expression of a novel aristaless related homeobox gene ‘Arx’ in the vertebrate telencephalon, diencephalon and floor plate. Mechanisms of Development 65 99–109. (doi:10.1016/S0925-4773(97)00062-2) Mueller JL, Mahadevaiah SK, Park PJ, Warburton PE, Page DC & Turner JM 2008 The mouse X chromosome is enriched for multicopy testis genes showing postmeiotic expression. Nature Genetics 40 794–799. (doi:10. 1038/ng.126) Ogata T, Matsuo N, Hiraoka N & Hata JI 2000 X-linked lissencephaly with ambiguous genitalia: delineation of further case. American Journal of Medical Genetics 94 174–176. (doi:10.1002/1096-8628(20000911)94:2 !174::AID-AJMG11O3.0.CO;2-O) Ohira R, Zhang YH, Guo W, Dipple K, Shih SL, Doerr J, Huang BL, Fu LJ, Abu-Khalil A, Geschwind D et al. 2002 Human ARX gene: genomic characterization and expression. Molecular Genetics and Metabolism 77 179–188. (doi:10.1016/S1096-7192(02)00126-9) Ohno S 1967 Sex Chromosomes and Sex Linked Genes. Springer-Verlag, Berlin, Heidelberg, New York. 192 pp. Poirier K, Van Esch H, Friocourt G, Saillour Y, Bahi N, Backer S, Souil E, Castelnau-Ptakhine L, Beldjord C, Francis F et al. 2004 Neuroanatomical distribution of ARX in brain and its localisation in GABAergic neurons. Brain Research. Molecular Brain Research 122 35–46. (doi:10.1016/ j.molbrainres.2003.11.021) Poole WE, Simms NG, Wood JT & Lubulwa M 1991 Tables for age determination of the Kangaroo Island wallaby (tammar), Macropus eugenii, from body measurements. In Technical memorandum No. 32. Division of Wildlife and Ecology, CSIRO, Canberra, Australia. Renfree MB, O WS, Short RV & Shaw G 1996 Sexual differentiation of the urogenital system of the fetal and neonatal tammar wallaby, Macropus eugenii. Anatomica Embryology 194 111–134. Ropers HH & Hamel BC 2005 X-linked mental retardation. Nature Reviews. Genetics 6 46–57. (doi:10.1038/nrg1501) Roser JF 2008 Regulation of testicular function in the stallion: an intricate network of endocrine, paracrine and autocrine systems. Animal Reproduction Science 107 179–196. (doi:10.1016/j.anireprosci.2008. 05.004) Ross MT, Grafham DV, Coffey AJ, Scherer S, McLay K, Muzny D, Platzer M, Howell GR, Burrows C, Bird CP et al. 2005 The DNA sequence of the human X chromosome. Nature 434 325–337. (doi:10.1038/ nature03440) Saifi GM & Chandra HS 1999 An apparent excess of sex- and reproductionrelated genes on the human X chromosome. Proceedings. Biological Sciences 266 203–209. (doi:10.1098/rspb.1999.0623) Sambrook J & Russell DW 2001 Molecular cloning: a laboratory manual. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press. 999 pp.

www.reproduction-online.org

289

Schneider NY, Fletcher TP, Shaw G & Renfree MB 2009 The olfactory system of the tammar wallaby is developed at birth and directs the neonate to its mother’s pouch odours. Reproduction 138 849–857. (doi:10.1530/REP-09-0145) Schneitz K, Spielmann P & Noll M 1993 Molecular genetics of aristaless, a prd-type homeo box gene involved in the morphogenesis of proximal and distal pattern elements in a subset of appendages in Drosophila. Genes and Development 7 114–129. (doi:10.1101/gad.7.1.114) Seufert DW, Prescott NL & El-Hodiri HM 2005 Xenopus aristaless-related homeobox (xARX) gene product functions as both a transcriptional activator and repressor in forebrain development. Developmental Dynamics 232 313–324. (doi:10.1002/dvdy.20234) Shoubridge C, Tan MH, Fullston T, Cloosterman D, Coman D, McGillivray G, Mancini GM, Kleefstra T & Gecz J 2010 Mutations in the nuclear localization sequence of the Aristaless related homeobox; sequestration of mutant ARX with IPO13 disrupts normal subcellular distribution of the transcription factor and retards cell division. PathoGenetics 3 1. (doi:10.1186/1755-8417-3-1) Skaletsky H, Kuroda-Kawaguchi T, Minx PJ, Cordum HS, Hillier L, Brown LG, Repping S, Pyntikova T, Ali J, Bieri T et al. 2003 The malespecific region of the human Y chromosome is a mosaic of discrete sequence classes. Nature 423 825–837. (doi:10.1038/nature01722) Stromme P, Mangelsdorf ME, Shaw MA, Lower KM, Lewis SM, Bruyere H, Lutcherath V, Gedeon AK, Wallace RH, Scheffer IE et al. 2002 Mutations in the human ortholog of Aristaless cause X-linked mental retardation and epilepsy. Nature Genetics 30 441–445. (doi:10.1038/ng862) Tyndale-Biscoe CH & Renfree MB 1987 Reproductive Physiology of Marsupials. Cambridge: Cambridge University Press, 476 pp. Vallender EJ & Lahn BT 2004 How mammalian sex chromosomes acquired their peculiar gene content. Bioessays 26 159–169. (doi:10.1002/bies. 10393) Veyrunes F, Waters PD, Miethke P, Rens W, McMillan D, Alsop AE, Grutzner F, Deakin JE, Whittington CM, Schatzkamer K et al. 2008 Bird-like sex chromosomes of platypus imply recent origin of mammal sex chromosomes. Genome Research 18 965–973. (doi:10.1101/gr.7101908) Walker WH 2009 Molecular mechanisms of testosterone action in spermatogenesis. Steroids 74 602–607. (doi:10.1016/j.steroids.2008.11.017) Wang PJ, McCarrey JR, Yang F & Page DC 2001 An abundance of X-linked genes expressed in spermatogonia. Nature Genetics 27 422–426. (doi:10.1038/86927) Yan HH, Mruk DD & Cheng CY 2008 Junction restructuring and spermatogenesis: the biology, regulation, and implication in male contraceptive development. Current Topics in Developmental Biology 80 57–92. (doi:10.1016/S0070-2153(07)80002-0) Yoshihara S, Omichi K, Yanazawa M, Kitamura K & Yoshihara Y 2005 Arx homeobox gene is essential for development of mouse olfactory system. Development 132 751–762. (doi:10.1242/dev.01619)

Received 7 August 2013 First decision 9 September 2013 Revised manuscript received 2 December 2013 Accepted 4 December 2013

Reproduction (2014) 147 279–289