The Eurasian

Eurasian j Med2014;46:176-81

_________________

Journal of Medicine________________

Original Article

Association between Hepatocyte Growth Factor (HGF) Gene Polymorphisms and Serum HGF Levels in Patients with Rheumatoid Arthritis Romatoid A rtritli Hastalarda Serum Hepatosit Büyüme Faktörü (HGF) Düzeyleri ile HGF Gen Polimorfizmleri Arasındaki İlişki Fatih Kara', Abdulkadir Yildirim1, Musa Gumusdere1, Saliha Karatay2, Kadir Yildirim2, Ebubekir Bakan1 ’Department of Biochemistry, Atatürk University Faculty of Medicine, Erzurum, Turkey departm ent of Physical Medicine and Rehabilitation, Atatürk University Faculty of Medicine, Erzurum, Turkey

Abstract

Özet

Objective: Rheumatoid arthritis (RA) is a chronic inflammatory dis­ ease characterized by proliferation and insufficient apoptosis o f sy­ novial cell, inflammatory cell infiltration, angiogenesis, and destruc­ tion o f joints. Hepatocyte growth factor (HGF) has many functions, such as regulation o f inflammation, angiogenesis, and inhibition of apoptosis. The purpose of this study was to investigate the associa­ tion between intron 13 C/A and intron 14T/C HGF gene polymor­ phisms and serum HGF levels in patients with RA.

Amaç: Romatoid artrit (RA), eklemlerde yıkım, anjiyogenezis, inflamatuar hücre infiltrasyonu, sinovyal hücre apoptozisinde yetersizlik ve proliferasyon ile karakterize kronik inflamatuar bir hastalıktır. He­ patosit büyüme faktörü (HGF), apoptozis inhibisyonu, anjiyogenezis ve inflamasyonun regülasyonu gibi bazı fonksiyonlara sahiptir. Bu çalışmanın amacı, RA'lı hastalarda serum HGF düzeyleri ile intron 13 C/A ve intron 14T/C HGF gen polimorfizmleri arasındaki ilişkiyi araş­ tırmaktı.

Materials and Methods: 100 patients w ith RA and 123 healthy con­ trols were included in this study. Serum HGF concentrations were measured using ELISA kit. Gene polymorphisms were determined by allelic discrimination analysis using the real-time PCR method.

Gereç ve Yöntem: Bu çalışma 100 RA'lı hasta ve 123 sağlıklı kontrol üzerinde yürütüldü. Serum HGF konsantrasyonları, ELISA yöntemiy­ le; gen polimorfizmleri ise allelik diskriminasyon analiziyle real-time PCR yöntemiyle belirlendi.

Results: HGF levels, frequency of AA genotype and A allele for in­ tron 13 C/A polymorphism and frequency of CC genotype and C al­ lele for intron 14T/C polymorphism were increased in patients with RA compared to healthy controls. There was no overall associations between genotypes and serum HGF concentrations in both patient and control groups.

Bulgular: RA'lı hastalarda, HGF düzeyleri, intron 13 C/A polimorfizmi için Aalleli ve AA genotip frekansı, intron 14T/C polimorfizmi için ise C alleli ve CC genotip frekansı kontrollere göre artmıştı. Hem hasta hem de kontrol gruplarında serum HGF konsantrasyonları ile HGF genotipleri arasında anlamlı bir ilişki yoktu.

Conclusion: Our results indicate that HGF protein and gene may play an im portant role in the etiopathogenesis o f RA. However, further studies are required for a better understanding of mechanisms re­ lated to the disease process. Keywords: Hepatocyte growth factor, HGF intron 13 C/A, HGF intron 14T/C, polymorphism, rheumatoid arthritis

Introduction Rheumatoid arthritis (RA) is a chronic, progressive disease that affects the joints and leads to significant deformities that disrupt the quality of life. It is 3 times more prevalent in women than in men and it influences nearly 1% of the

Sonuç: HGF protein ve geni, RA etyopatogenezinde önemli role sa­ hip olabilir. Bununla birlikte hastalık süreciyle ilişkili mekanizmaların anlaşılabilmesi için daha ileri çalışmalara ihtiyaç vardır. Anahtar Kelimeler: Hepatosit büyüme faktörü, HGF intron 13 C/A, HGF intron 14T/C, polimorfizm, romatoid artrit

population. Although numerous studies on RA have been conducted over many years, its etiology still has not been clarified exactly [1,2]. Studies on illuminating etiopathogenesis of RA gain attention for the equilibrium between pro- and anti-inflam­ matory cytokines that play role in initiation and continua­ tion of chronic inflammatory process in synovial membrane

Received: September 22, 2013 / Accepted: March 1 5 ,2 0 1 4 /Available Online Date: August 26,2014 C.-J

0#

Correspondence to: Abdulkadir Yildirim, Department of Biochemistry, Atatürk University Faculty of Medicine, Erzurum, Turkey

Phone: +90 442 231 66 10 e-mail: [email protected] ©Copyright 2014 by the Atatürk University School of Medicine-Available online at www.eajm.org DOI:10.5152/eajm.2014.41

Eurasian J Med 2014; 46:176-81

Kara et al. HGF Polymorphisms and Serum Levels in Rheumatoid Arthritis

[3], a n g io g e n e sis [4 ,5 ] and a lte ra tio n s in syno via l cell a p o p itosis [6]. H e p a to cyte g ro w th fa c to r (HGF) was o rig in a lly id e n ti­

177

gene p o ly m o rp h is m s was d e te rm in e d using th e rea l-tim e PCR apparatus (A p p lie d Biosystems 7300) by th e TaqMan allelic d is c rim in a tio n m e th o d .

fie d in 1984 as a fa c to r th a t stim ulates h e p a to cyte p ro lif­

A llele specific TaqM an probes th a t are u tilize d in th e

e ra tio n and na m ed acco rd in g to th is fu n c tio n [7 ,8 ]. However,

analysis process w e re as fo llo w s: For in tro n 13 C/A o f HGF

researches in th e fo llo w in g years revealed th a t HGF also

gene 5'- FAM - GCACAAATTATAGTCCAGAGCTTACçGTCTGG

stim ulates th e p ro life ra tio n o f cells o th e r th a n h e p a to cyte

CAAG CAG ATG TG ATC AG CT-Tam ra-3'

[9], and has a n g io g e n ic [10], a n ti-in fla m m a to ry [11], p ro - and

G C A C A A A T T A T A G T C C A G A G C T T A C a_G T

a n ti- a p o p to tic [12] pro pe rties.

CTGGCAAGCAGATGTGATCAGCT-Tamra-3';

and

5 '-

fo rw a rd

VICp rim ­

A im o f o u r stu d y is to in ve stig a te in tro n 13 C/A (rs2074725)

er 5'-CTACCTCTGGAGGCACAAA TTA-3' and reverse p rim e r

and in tro n 1 4 T /C (rs2074724) HGF g e ne p o ly m o rp h is m s in

5'-G G G TAC AAC C TTC AG G AC C A -3'andforintron14T/C 5'-FAM -

p a tie n ts w ith RA and eva lu ate serum HGF levels to com pare

CTACAGGAGAAAGAAGTAGTGAGGAtTGAAAAAAGCCTATTGA

p a tie n ts w ith h e a lth y c o n tro l group.

CAATTTAG-Tamra-3' and 5'-VIC-CTACAGGAGAAAGAAGTAGT G AGG AçTG AAAAAAGCCTATTG ACAATTTAG-Ta m ra-3'.

Materials and Methods Statistical analysis This stu d y was in itia te d a fte r th e a p pro val o f th e Ethical

Statistical analysis was p e rfo rm e d using th e Statistical

C o m m itte e o f A ta tü rk U n iv e rs ity M ed ica l Faculty (date:

Package fo r Social Sciences (SSPS) so ftw a re package version

15.05.2009 and n u m b e r: 137), and w ritte n in fo rm e d co n ­

11.5 fo r W in d o w s (SPSS Inc, C hicago, USA). The n o rm a l dis­

sent was o b ta in e d fro m all pa tien ts. This stu d y includes

trib u tio n o f variables was evaluated using th e K o lm o g o ro v-

100 p a tie n ts w ith RA th a t d iag nose d in th e D e p a rtm e n t

S m irn o v test. The M ann W h itn e y U and Kruskal W allis tests

o f Physical M e d icin e and R e h a b ilita tio n M edical Faculty o f

w e re used to com p are th e analysis results w h ic h w ere n o t

A ta tü rk U niversity, and th e c o n tro l g ro u p consists o f 123

n o rm a lly d is trib u te d . The C hi-square te st was a p p lie d to

h e a lth y (having no system ic disease) p a rtic ip a n ts w hose

evaluate th e d is trib u tio n o f gene p o ly m o rp h is m s a m o n g th e

m ean age and g e n d e r p e rcen ta ge are sim ilar to th e p a tie n t

p a tie n t and c o n tro l groups. For statistical significance, p30 m in, (2) six o r m o re te n d e r jo in ts , (3) th re e

W h ile serum HGF co n ce n tra tio n was fo u n d 1431 ±851

o r m ore sw o lle n jo in ts , and (4) e ry th ro c y te se d im e n ta tio n

p g /m L in th e p a tie n t g ro up , it was 1135±647 p g /m L in th e

rate (ESR) >28 m m /h .

c o n tro l g ro up . D ifferences b e tw e e n th e p a tie n t and c o n tro l

Venous b lo o d sam ples w e re c o lle cte d fro m each in d iv id u ­

gro up s w ere sta tistica lly s ig n ific a n t (p