+Model DIABET-617; No. of Pages 7
ARTICLE IN PRESS Available online at
ScienceDirect www.sciencedirect.com Diabetes & Metabolism xxx (2014) xxx–xxx
Original article
Association of endothelial lipase Thr111Ile polymorphism with proliferative retinopathy in type 2 diabetes patients C. Arndt a , I. Leclercq a , P. Nazeyrollas b , A. Durlach c , A. Ducasse a , I. Movesayan e , E. Socquard d , C. Clavel c , M.M. Malloy e , C.R. Pullinger e , J.P. Kane e , V. Durlach b,e,∗ a Service d’Ophtalmologie, Hôpital Robert-Debré, Centre Hospitalo-Universitaire, 51092 Reims, France Pôle Thoracique, Cardio-Vasculaire et Neurologique, Centre Hospitalo-Universitaire, 51092 Reims, France c Laboratoire Pol Bouin, Hôpital Maison-Blanche, Centre Hospitalo-Universitaire, 51092 Reims, France d Service d’Endocrinologie, Maladies Métaboliques et de Médecine Interne, Hôpital Robert-Debré, Centre Hospitalo-Universitaire, 51092 Reims, France e Cardiovascular Research Institute, 555, Mission Bay Boulevard South Room 252A, Box 311, San Francisco, CA 94158, USA b
Received 28 October 2013; received in revised form 16 April 2014; accepted 19 April 2014
Abstract Aim. – Our previous study demonstrated that the endothelial lipase (EL) C.584C>T polymorphism (rs2000813, p.Thr111Ile) was significantly associated with diabetic retinopathy (DR). The present work was conducted to see if this specific variant of the EL gene was more specifically linked to the severity of DR. Methods. – This retrospective cohort study was based on a review of the institutional charts of 287 type 2 diabetes patients (mean age = 59.7 years; mean BMI = 29.0 kg/m2 ; mean HbA1c = 8.4%) genotyped for the EL C.584C>T polymorphism (rs2000813, p.Thr111Ile). The stage of DR was also determined for each genotype (CC, CT, TT). Results. – On univariate analysis, the minor allele homozygote TT variant was significantly associated with severe DR (OR: 4.3; 95% CI: 1.4, 13.1) compared with the major CC homozygote. No significant result was found for the CT heterozygote. Multivariate analysis revealed an increased risk for TT homozygotes to present with severe non-proliferative DR (OR: 8.09; 95% CI: 1.23, 53.1) or proliferative DR. Other associations were not significant. Conclusion. – Minor allele homozygosity for this EL variant (c.584C>T) could be a significant risk factor for developing severe, sight-threatening disease due to proliferative DR. Further prospective studies of this EL polymorphism in a larger population sample are needed to confirm these results. © 2014 Published by Elsevier Masson SAS. Keywords: Endothelial lipase gene; c.584C>T polymorphisms (rs2000813; p.Thr111Ile); Proliferative retinopathy; Type 2 diabetes
1. Introduction Type 2 diabetes (T2D) is a major clinical burden and the number of patients affected is expected to increase drastically worldwide, nearly doubling in highly industrialized countries and tripling in developing countries over the next 25 years. More than 300 million diabetic patients are expected worldwide by
∗ Corresponding author. Pôle Thoracique, Cardio-Vasculaire et Neurologique, Centre Hospitalo-Universitaire, 51092 Reims, France. Tel.: +33 3 26 91 82 78. E-mail addresses: [email protected], [email protected] (V. Durlach).
2025 [1]. This diabetic pandemic is also a leading cause of preventable blindness: diabetic retinopathy (DR). The screening and treatment by laser photocoagulation of diabetic patients with DR have proven effective for preventing end-stage vision loss. Unfortunately, our capability for detection and care is limited for economic reasons, making it necessary to target only high-risk patients [2]. Several risk factors for DR have been identified, such as hypertension, chronic hyperglycaemia (with high HbA1c ), body mass index (BMI), neuropathy, microalbuminuria and duration of diabetes [3,4]. Lipids may also play an important role in retinal microvascular complications in T2D patients through increased levels of very low-density lipoprotein (VLDL) and triglyceride (TG),
http://dx.doi.org/10.1016/j.diabet.2014.04.004 1262-3636/© 2014 Published by Elsevier Masson SAS.
Please cite this article in press as: Arndt C, et al. Association of endothelial lipase Thr111Ile polymorphism with proliferative retinopathy in type 2 diabetes patients. Diabetes Metab (2014), http://dx.doi.org/10.1016/j.diabet.2014.04.004
+Model DIABET-617; No. of Pages 7
ARTICLE IN PRESS
2
C. Arndt et al. / Diabetes & Metabolism xxx (2014) xxx–xxx
low-density lipoprotein cholesterol (LDL-C) and decreased levels of serum high-density lipoprotein cholesterol (HDL-C) [5]. In 2005, the Fenofibrate Intervention and Event Lowering in Diabetes (FIELD) study strongly confirmed this hypothesis, as patients treated with fenofibrate underwent less laser treatment [6,7]. These early results were confirmed by the Action to Control Cardiovascular Risk in Diabetes (ACCORD) study five years later: the association of a statin and fenofibrate significantly decreased DR progression compared with a statin alone [8]. Thus, hypolipidaemic treatment plays an important role in DR progression. In addition, genetic factors modulating lipid metabolism are also likely to modulate the expression of DR. By studying the association of an endothelial lipase (EL) polymorphism (c.584C>T, p.I111T, rs2000813) with lipid metabolism and microvascular complications in T2D patients, it was shown that this particular EL polymorphism was significantly associated with DR [9]. In that previous study, however, the stage of DR was not considered. For this reason, in the present retrospective chart review, the relationship between this specific EL polymorphism and stage of DR was evaluated in a subgroup of 287 T2D patients. 2. Methods 2.1. Study population The present study was based on a chart review of patients attending the diabetes center at Reims University Hospital (France) between 1992 and 1993. These patients were taken from our previously published longitudinal cohort of 396 French T2D patients [9], comprising 171 women and 225 men aged 59.5 ± 10.8 years (range: 27–83 years). The study protocol was approved by the local ethics committee, and the criteria for T2D were those defined by the National Diabetes Data Group [10]. An experienced ophthalmologist who had no knowledge of the genetic analyses results blindly reviewed the charts; the latest reported fundus examination was reviewed and used to classify patients according to the American Academy of Ophthalmology grading scale for DR [11]. To simplify our analysis, a normal fundus or mild non-proliferative DR was considered stage I, moderate non-proliferative DR was stage II, severe nonproliferative DR was stage III and proliferative DR or a history of panretinal laser photocoagulation was stage IV. When different stages in either eye were identified, the eye with the most advanced stage was described for the final classification. 2.2. Genetic analysis As previously described, genomic DNA was extracted from white blood cells using phenol–chloroform [12]. Fluorescencepolarization detection with template-directed dye terminator incorporation (FD–TDI) was used for detection of p.Thr111Ile (rs2000813), as described elsewhere [13]. Briefly, the template was amplified by polymerase chain reaction (PCR), and excess deoxynucleotide triphosphate (dNTP) and unincorporated primers were removed using ExoSAP-IT (USB Corporation,
Cleveland, OH, USA), followed by single-base primer extension using a polymorphic site-specific primer (IDT, Skokie, IL, USA) and incorporation of fluorescent dye terminator (PerkinElmer Life Sciences, Boston, MA, USA) in the final extension step. The PCR primers used were ATGAGCGGTATCTTTGAAAAC(F), CTTAAGAAGATTGGGTTTGAGAT(R) and CGTGTCAGCCCTGCACA alleles [C/T]. The assay was read by a microplate reader using the fluorescence-polarization (FP) technique, and the allele present in the target DNA was assigned using algorithms and controls as previously described [13,14]. 2.3. Statistical analysis Patients were classified into either four groups (four-group analysis), comprising no or mild DR (stage I), moderate nonproliferative DR (stage II), severe non-proliferative DR (stage III) and proliferative DR or a history of panretinal laser photocoagulation (stage IV), or into two groups (two-group analysis), comprising no, mild or moderate DR vs severe non-proliferative DR, proliferative DR or a history of panretinal laser photocoagulation (advanced DR). As for the p.Ile111Thr polymorphism, patients were grouped according to common allele carriers (CC, CT) or rare allele homozygotes (TT). SPSS software (version 19, IBM Corporation, Armonk, NY, USA) was used for the statistical analysis. Allele and genotype frequencies were determined by gene counting. A test for the Hardy–Weinberg equilibrium was performed. Comparisons between groups were performed by chi-square tests (2 ) and by exact tests for categorical data. Comparisons of means of normally distributed variables were performed using univariate analysis of variance (ANOVA); non-parametric Kruskal–Wallis tests were used for other variables, and regression of genotype against retinopathy status was performed. Ascending stepwise logistic regression models for retinopathy were constructed; the variables proposed were age, gender and data-driven variables (those reaching statistical significance for an association with DR on univariate analysis). For all analyses, significance was defined as an alpha risk < 0.05. 3. Results 3.1. Study sample The charts of 287 of the initial 396 patients were analyzed, most of whom were Caucasian; 109 patients could not be included in this secondary study for a variety of reasons: patients were lost to follow-up; no ophthalmological examination was done at hospital; and this population had a higher mortality rate. For patients included in our study, their mean duration of diabetes was 12.0 ± 7.9 years, mean BMI was 29.0 ± 5.5 kg/m2 , and they were following a diet and/or taking antidiabetic drugs [metformin (n = 241) and/or sulphonylureas (n = 252)] and/or insulin (n = 35). Lipid-lowering therapy was being used by 27.5% of patients (n = 18 taking statins, n = 61 taking fibrates); 47.9% of patients were being treated for hypertension (24.5%
Please cite this article in press as: Arndt C, et al. Association of endothelial lipase Thr111Ile polymorphism with proliferative retinopathy in type 2 diabetes patients. Diabetes Metab (2014), http://dx.doi.org/10.1016/j.diabet.2014.04.004
+Model
ARTICLE IN PRESS
DIABET-617; No. of Pages 7
C. Arndt et al. / Diabetes & Metabolism xxx (2014) xxx–xxx
3
Table 1 Main characteristics of type 2 diabetes patientsa by genotype.
Gender (male/female, n/n) Age (years) Body mass index (kg/m2 ) Systolic blood pressure (mmHg) Diastolic blood pressure (mmHg) Diabetes duration (years) HbA1c (%) Coronaropathy [n (%)] Nephropathy [n (%)] Creatinine (mol/L) Microalbuminuria (mg/24 h) Triglycerides (mmol/L) Total cholesterol (mmol/L) HDL cholesterol (mmol/L) LDL cholesterol (mmol/L) Apolipoprotein A (g/L) Apolipoprotein B (g/L) Uricaemia (mol/L) Lipoprotein(a) (mg/L) Retinopathy [n (%)] None or mild Moderate Severe non-proliferative Proliferative
All (n = 287)
CC/CT (n = 256)
TT (n = 31)
P
167/120 59.7 ± 10.4 29.0 ± 5.5 15.9 ± 2.6 9.3 ± 1.5 12.0 ± 7.9 8.4 ± 1.9 57 (20%) 130 (45%) 93.9 ± 22.6 37 ± 114 2.3 ± 2.0 5.8 ± 1.3 1.3 ± 0.4 3.5 ± 1.0 1.32 ± 0.22 1.32 ± 0.35 300 ± 86 206 ± 310
147/109 59.5 ± 10.6 29.0 ± 5.6 15.9 ± 2.7 9.2 ± 1.4 11.9 ± 7.9 8.4 ± 1.9 50 (19%) 116 (45%) 93.2 ± 23.0 38 ± 120 2.3 ± 2.1 5.9 ± 1.3 1.3 ± 0.4 3.5 ± 1.0 1.34 ± 0.20 1.33 ± 0.35 298 ± 87 219 ± 321
20/11 61.5 ± 8.4 29.0 ± 5.5 16.2 ± 2.1 9.5 ± 1.7 12.8 ± 8.4 8.2 ± 1.9 7 (23%) 14 (45%) 99.6 ± 19.8 27 ± 197 2.2 ± 1.6 5.5 ± 0.9 1.3 ± 0.4 3.2 ± 0.9 1.33 ± 0.22 1.18 ± 0.31 306 ± 80 107 ± 169
0.29 0.30 0.78 0.50 0.37 0.57 0.56 0.42 0.57 0.14 0.62 0.72 0.13 0.43 0.06 0.64 0.03 0.67 0.07 < 0.01
225 (78%) 40 (14%) 8 (3%) 14 (5%)
205 (80%) 36 (14%) 6 (2%) 9 (4%)
20 (65%) 4 (13%) 2 (6%) 5 (16%)
a Patients
were following a diet and/or taking antidiabetic drugs [metformin (n = 241) and/or sulphonylureas (n = 252)] and/or insulin (n = 35); lipid-lowering therapy was used by 27.5% (n = 18 with statins, n = 61 with fibrates); 47.9% treated for hypertension (24.5% with ACE inhibitors) were equally distributed in each genotype group; 30% were smokers, with no genotype group differences; most of the women were post-menopausal, and none were taking hormone replacement therapy.
with ACE inhibitors) and were equally distributed across the genotype groups; and 30% were smokers, with no genotype group differences. Most of the women were post-menopausal, but none was taking hormone replacement therapy.
The clinical and biological characteristics of the patients and their distribution according to genotype [CC: 127 (44.3%); CT: 129 (44.9%); and TT: 31 (10.8%)] are presented in Table 1, and their distribution according to retinopathy grading in Table 2.
Table 2 Main characteristics of type 2 diabetes patients by stage of diabetic retinopathy.
Gender (male/female, n/n) Genotype (xC/TT, n/n) Age (years) Body mass index (kg/m2 ) Systolic blood pressure (mmHg) Diastolic blood pressure (mmHg) Diabetes duration (years) HbA1c (%) Coronary disease (n) Nephropathy (n) Creatinine (mol/L) Microalbuminuria (mg/24 h) Triglycerides (mmol/L) Total cholesterol (mmol/L) HDL cholesterol (mmol/L) LDL cholesterol (mmol/L) Apolipoprotein A (g/L) Apolipoprotein B (g/L) Uricaemia (mol/L) Lipoprotein(a) (mg/L)
None or mild (n = 225)
Moderate (n = 40)
Severe non-proliferative (n = 8)
Proliferative (n = 14)
P
129/96 205/20 60.1 ± 10.5 28.7 ± 5.5 157 ± 26 92 ± 14 11.7 ± 7.8 8.1 ± 1.8 45 97 94.4 ± 23.9 38.5 ± 127 2.11 ± 1.52 5.7 ± 1.1 1.26 ± 0.36 3.48 ± 0.93 1.31 ± 0.22 1.29 ± 0.34 302 ± 88 201 ± 260
27/13 36/4 57.4 ± 10.8 29.6 ± 5.8 165 ± 27 96 ± 14 10.5 ± 6.1 9.1 ± 2.0 4 22 89.5 ± 11.6 23.5 ± 36.3 2.6 ± 1.9 6.1 ± 1.5 1.32 ± 0.37 3.57 ± 1.37 1.41 ± 0.23 1.37 ± 0.35 285 ± 78 180 ± 278
4/4 6/2 59.1 ± 6.5 29.8 ± 4.6 177 ± 38 95 ± 24 14.7 ± 8.3 9.5 ± 2.0 2 3 79.5 ± 7.3 61.2 ± 55.6 5.2 ± 7.5 6.5 ± 3.0 1.26 ± 0.45 2.87 ± 1.35 1.28 ± 0.19 1.32 ± 0.35 294 ± 87 123 ± 210
7/7 9/5 59.7 ± 7.9 31.9 ± 5.1 171 ± 24 96 ± 21 20.1 ± 10.0 10.1 ± 2.2 6 8 106.8 ± 27.1 46.9 ± 56.3 2.5 ± 1.3 6.1 ± 1.2 1.23 ± 0.43 3.74 ± 1.05 1.32 ± 0.18 1.41 ± 0.43 299 ± 90 406 ± 775
0.29 < 0.01 0.53 0.15 0.03 0.34 < 0.01 < 0.01 0.10 0.08 0.024 0.33 0.07 0.10 0.82 0.26 0.09 0.57 0.71 0.50
Please cite this article in press as: Arndt C, et al. Association of endothelial lipase Thr111Ile polymorphism with proliferative retinopathy in type 2 diabetes patients. Diabetes Metab (2014), http://dx.doi.org/10.1016/j.diabet.2014.04.004
+Model DIABET-617; No. of Pages 7
ARTICLE IN PRESS
4
C. Arndt et al. / Diabetes & Metabolism xxx (2014) xxx–xxx
Table 3 Risk of retinopathya in endothelial lipase rare allele homozygotes with type 2 diabetes. Genotype (n) Retinopathy grade
xC
TT
No or mild Moderate Severe non-proliferative Proliferative
225 36 6 9
20 4 2 5
a
OR [95% CI]
1.1 [0.4, 3.5] 3.4 [0.6, 18.0] 5.7 [1.7, 18.6]
Using univariate logistic regression of genotype against retinopathy status.
The 111Ile minor allele frequency was similar to those reported in other populations (T allele = 0.333) and did not deviate from Hardy–Weinberg expectations (P = 0.83). Genotype, systolic blood pressure, diabetes duration, HbA1c and serum creatinine were significantly associated with DR status. 3.2. Genotype association with diabetic retinopathy 3.2.1. Four-group analysis Among the homozygotes for the rare allele (TT), the occurrence of stage IV DR (proliferative DR or laser treatment) was highly increased (OR: 5.7; 95% CI: 1.7, 18.6) on univariate analysis. No significant association was found with other stages of advanced DR (moderate or severe non-proliferative DR; Table 3). 3.2.2. Two-group analysis Advanced DR (severe non-proliferative DR, proliferative DR, panretinal laser photocoagulation) was more common in rare allele TT homozygotes (OR: 4.3; 95% CI: 1.4, 13.1) than in major allele CC homozygotes; no significant effects were seen in CT heterozygotes (Table 4). As the effect of the Thr111Ile trait on the occurrence of advanced stages of DR was consistent with a recessive mode of inheritance, all analyses were conducted on genetic data collapsed into carriers of the major allele (CC + CT) and those homozygous for the minor allele (TT). TT carriers had a significantly higher frequency of advanced DR (OR: 4.7; 95% CI: 1.7, 12.6). 3.2.3. Lipid phenotype characteristics of the rare allele carriers Homozygotes for the rare allele displayed modestly decreased LDL-C (P = 0.06) and decreased apolipoprotein B Table 4 Riska of advanced diabetic retinopathy (DR)b in type 2 diabetes patients by genotype of endothelial lipase 1. Genotype
No advanced DR
Advanced DR
CC CT TT xC TT
119 122 24 241 24
8 7 7 15 7
a b
P
OR [95% CI]
0.77 0.018
0.85 [0.3, 13.1] 4.3 [1.4, 13.1]
0.005
4.7 [1.7, 12.6]
Using univariate logistic regression of genotype against retinopathy status. Defined as either severe, non-proliferative or proliferative.
Table 5 Risk of developing different stages of diabetic retinopathy. Retinopathy
Variablesa
OR [95% CI]
No or mild (reference) Moderate (stage II)
– Genotype TT Diabetes duration (years) HbA1c (%) Creatinine (mol/L) Genotype TT Diabetes duration (years) HbA1c (%) Creatinine (mol/L) Genotype TT Diabetes duration (years) HbA1c (%) Creatinine (mol/L)
– 1.51 [0.47, 4.87] 0.97 [0.92, 1.02] 1.33 [1.12, 1.59] 0.98 [0.96, 1.01] 8.09 [1.23, 53.1] 1.04 [0.95, 1.13] 1.46 [0.97, 2.21] 0.91 [0.85, 0.98] 6.22 [1.51, 25.6] 1.11 [1.04, 1.19] 1.78 [1.28, 2.48] 1.01 [0.99, 1.03]
Severe non-proliferative (stage III) Proliferative (stage IV)
a In a multivariate setting by ascending stepwise logistic regression against severity of retinopathy; age, gender and systolic arterial pressure were proposed, but not included; criteria: to enter, P < 0.05; to remove, P > 0.10.
(ApoB) levels (P = 0.03; Table 1); no other differences between rare allele homozygotes and major allele carriers were found, except for DR. 3.2.4. Multivariate analysis Age, gender, genotype, creatinine, diabetes duration, HbA1c and systolic blood pressure were proposed for the multivariate stepwise analysis (Table 2). Predictors in the model included rare allele homozygotes (P = 0.03), diabetes duration (P = 0.01), and HbA1c (P < 0.01) and creatinine (P = 0.01) levels (Table 5). On multivariate analysis, rare allele homozygotes had an increased risk of stage III (severe non-proliferative) or IV (proliferative) DR, with respective ORs (95% CIs) of 8.1 (1.23, 53.1) and 6.2 (1.5, 25.6). 4. Discussion DR remains one of the leading causes of blindness in the developed countries. Although its pathogenesis is still unclear, it is now well established that DR development depends on several factors, such as poor glycaemic control and duration of diabetes: 50% of diabetic patients suffer from DR after 10 years, and 90% after 25 years of chronic hyperglycaemia [15]. Severe forms of DR can lead to retinal detachment, intravitreal haemorrhages and neovascular glaucoma: these complications are resourceintensive, and represent both a drama for affected patients and an economic burden for healthcare systems, as costs increase with severity of the disease. The pathogenesis of proliferative DR is complex and multifactorial, combining both environmental and genetic factors. The Diabetes Control and Complications Trial (DCCT) [16] showed a significant familial tendency for severe DR in both type 2 and type 1 diabetes patients. Thus, numerous studies considering candidate genes as a DR risk factor in patients of various ethnicities have been conducted. Historically, the polyol pathway was the first item of interest towards understanding DR lesions. The AKR1B1 gene coding for aldose reductase is now the gene most significantly associated with DR development:
Please cite this article in press as: Arndt C, et al. Association of endothelial lipase Thr111Ile polymorphism with proliferative retinopathy in type 2 diabetes patients. Diabetes Metab (2014), http://dx.doi.org/10.1016/j.diabet.2014.04.004
+Model DIABET-617; No. of Pages 7
ARTICLE IN PRESS C. Arndt et al. / Diabetes & Metabolism xxx (2014) xxx–xxx
the promoter single-nucleotide polymorphism (SNP) rs759853 and (CA)n microsatellite polymorphism located at the 5 end of the AKR1B1 gene are both significantly associated with DR [17]. The rs2910964 SNP of the ITGA2 gene is also significantly associated with DR, as is the ICAM1 K469E gene (rs13306430 polymorphism) [18]. Multiple polymorphisms of vascular endothelial growth factor (VEGF) have also been studied, and a recent meta-analysis has confirmed the 634G>C polymorphism as having a significant relationship with DR in both an allelic genetic model and a recessive genetic model [19]. Recently, the NP rs1617640 in the promoter of the erythropoietin (EPO) gene [20], the human leucocyte antigen (HLA) gene, the plasminogen activator inhibitor-1 (PAI-1) gene 4G/5G polymorphism [21], the peroxisome proliferator-activated receptor (PPAR)-γ2 gene (rs1801282 (c.34C>G, p.Pro12Ala)) [22,23], complement genes with CFH-rs800292 and CFB-rs1048709 polymorphisms [24] and adiponectin genes (rs2241766) [25] have also been correlated with DR. However, these results need to be confirmed in larger clinical and fundamental studies, as their exact molecular mechanisms remain unclear. ACE (angiotensin-converting enzyme), sorbitol dehydrogenase (–888G>C polymorphism) and NOS3 (endothelial nitric oxide synthase) genes have also been studied, but no statistically significant associations with DR were found [17,26]. The involvement of the Thr111Ile missense polymorphism of EL and the occurrence of DR in 396 T2D patients have already been demonstrated by a longitudinal follow-up [9]. In the present study, the first to examine the relationship between the Thr111Ile EL variant and DR stage in T2D patients, a subgroup of 287 patients was investigated: homozygotes for the rare allele of the Thr111Ile EL polymorphism presented with more advanced stages of DR and especially more proliferative DR. This study highlights a new gene of interest in DR pathogenesis. Only a modest influence of the EL c.584C>T polymorphism on lipid parameters was found, except for lower ApoB values in TT patients, but the study was limited by the modest size of the series. Nevertheless, the involvement of lipid metabolism on DR progression is plausible: the FIELD study results showed that fenofibrate, a PPAR-␣ agonist lowered TG concentrations and raised HDL-C in 9795 T2D patients [7,27]. In that largescale, prospective, multinational randomized controlled trial, the fenofibrate group needed significantly less laser panphotocoagulation (P = 0.0003) than the placebo group. Five years later, these results were confirmed by 10,251 TD2 patients in the ACCORD study [8]. Intensive dyslipidaemia therapy using fenofibrate plus a statin decreased DR progression by 40% over 4 years (P = 0.006) vs a statin alone. A significant reduction of TG level in the fenofibrate group was also seen. Although fenofibrate’s exact molecular mechanisms remain unclear, the current thinking is that this treatment might be influencing multiple pathways involved in the pathogenesis of DR [28]. First, fenofibrate could affect DR via lipid-related mechanisms by lowering TG, LDL-C and ApoB, and raising ApoA-1 and HDL-C. However, no relationship was found between the lipid-modifying effects of fenofibrate and the incidence or
5
progression of DR in either the FIELD or ACCORD study [6,8,29]. Yet, fenofibrate could modulate the qualitative properties of lipoproteins, such as ApoA-1, an independent protective factor for DR development, or by reducing lipoprotein-associated phospholipase A2 (Lp-PLA2) and its proinflammatory effects [30]. Second, emerging data also suggest therapeutic mechanisms for its active metabolite (fenofibric acid) independent of serum lipid changes [28], including anti-apoptotic activity and endothelial function improvement, antioxidant and anti-inflammatory activity, neuroprotective effects, preventative effects on blood–retinal barrier breakdown and anti-angiogenic activity by PPAR-␣ activation [31–33], which a recent study has confirmed. In both type 1 and type 2 diabetes models, a high-glucose medium was sufficient to downregulate PPAR-␣ expression in cultured retinal cells. Finally, diabetic PPAR-␣ knockout mice developed more severe DR. Thus, PPAR-␣ activation could be a new key to prevent DR progression [34]. In addition, it is now also known that EL activates PPAR-␣ via HDL hydrolysis [35,36]. EL is itself activated by hyperglycaemia [37], metabolic inflammation via tumour necrosis factor (TNF)-␣ and leptin [38], and mechanical forces on vascular endothelium [39]. By activating PPAR-␣, EL could inhibit vascular cell adhesion molecule (VCAM)-1 expression, endothelial adhesion molecules and capillary occlusion. Variants of EL (for example, Asn396Ser) have already been associated with lower activity of the enzyme and higher HDL-C values [36]. According to the PolyPhen (polymorphism phenotyping) prediction tool, Thr111Ile is a missense variant that does not damage either EL function or EL lipolytic activity. However, this variant was associated with increased plasma HDL-C in a metaanalysis of more than 100,000 subjects. This could be explained by the high linkage disequilibrium (LD) between the 229 T>G and Thr111Ile polymorphisms observed in the Study of Inherited Risk of Coronary Atherosclerosis (SIRCA) participants. As the 229 T>G (rs34474737) variant is known to decrease EL promoter activity and to raise plasma EL in humans, this LD could be the key to understanding how the Thr111Ile variant is associated with reduced EL levels and perhaps also DR [40]. Other hypotheses have been suggested. As a phospholipase, EL could alter the bilipid layer of endothelial cell membranes. By increasing adhesion of leucocytes, this would lead to capillary non-perfusion. The Thr111Ile EL variant gene could also be associated with a yet unidentified mutation that alters its biological function. Further fundamental research might elucidate more clearly the role of EL and its variants in microangiopathy development. Our present study was limited by its reduced sample size, such that the statistical power of the subgroup analyses might not have been sufficient to detect more significant associations with lipids levels. Also, some patients’ charts had no retinography and our conclusions were based on the ophthalmologist’s fundus examinations with no possibility of a control. Nevertheless, and in the light of the present study findings, the EL Thr111Ile polymorphism might be strongly associated with proliferative DR. Larger prospective studies are now required to confirm these initial results. If confirmed, then genetic screening
Please cite this article in press as: Arndt C, et al. Association of endothelial lipase Thr111Ile polymorphism with proliferative retinopathy in type 2 diabetes patients. Diabetes Metab (2014), http://dx.doi.org/10.1016/j.diabet.2014.04.004
+Model DIABET-617; No. of Pages 7
ARTICLE IN PRESS
6
C. Arndt et al. / Diabetes & Metabolism xxx (2014) xxx–xxx
may help in the early detection of high-risk diabetic patients. Focusing our means solely on this population could improve both healthcare spending and the diabetic population’s care. Disclosure of interest The authors declare that they have no conflicts of interest concerning this article. Acknowledgements They would like to thank Prs Antonio Brunetti and Eusebio Chieffari for their valuable advice and reviewing of this work. Funding: The authors of this article did not benefit of any funding.
Appendix A. Supplementary data Supplementary data (French summary) associated with this article can be found, in the online version, at http://dx.doi.org/ 10.1016/j.diabet.2014.04.004. References [1] Delcourt C, Massin P, Rosilio M. Epidemiology of diabetic retinopathy: expected vs reported prevalence of cases in the French population. Diabetes Metab 2009;35:431–8. [2] Chou CF, Zhang X, Crews JE, Barker LE, Lee PP, Saaddine JB. Impact of geographic density of eye care professionals on eye care among adults with diabetes. Ophthalmic Epidemiol 2012;19:340–9. [3] Tan GS, Ikram MK, Wong TY. Traditional and novel risk factors of diabetic retinopathy and research challenges. Curr Med Chem 2013;20(26):3189–99. [4] Li X, Wang Z. Prevalence and incidence of retinopathy in elderly diabetic patients receiving early diagnosis and treatment. Exp Ther Med 2013;5:1393–6. [5] Aldebasi YH, Mohieldein AH, Almansour YS, Almutairi BL. Dyslipidemia and lipid peroxidation of Saudi type 2 diabetics with proliferative retinopathy. Saudi Med J 2013;34:616–22. [6] Scott R, Best J, Forder P, Taskinen MR, Simes J, Barter P, et al. Fenofibrate Intervention and Event Lowering in Diabetes (FIELD) study: baseline characteristics and short-term effects of fenofibrate [ISRCTN64783481]. Cardiovasc Diabetol 2005;4:13. [7] Keech A, Simes RJ, Barter P, Best J, Scott R, Taskinen MR, et al. Effects of long-term fenofibrate therapy on cardiovascular events in 9795 people with type 2 diabetes mellitus (the FIELD study): randomised controlled trial. Lancet 2005;366:1849–61. [8] Chew EY, Ambrosius WT, Davis MD, Danis RP, Gangaputra S, Greven CM, et al. Effects of medical therapies on retinopathy progression in type 2 diabetes. N Engl J Med 2010;363:233–44. [9] Durlach V, Durlach A, Movesayan I, Socquard E, Zellner C, Clavel C, et al. Association of endothelial lipase Thr111Ile polymorphism with lipid metabolism and microvascular complications in type 2 diabetic patients. Diabetes Metab 2011;37:64–71. [10] Classification and diagnosis of diabetes mellitus and other categories of glucose, intolerance, National Diabetes Data, Group. Diabetes 1979;28:1039–57. [11] Wilkinson CP, Ferris 3rd FL, Klein RE, Lee PP, Agardh CD, et al. Proposed international clinical diabetic retinopathy and diabetic macular edema disease severity scales. Ophthalmology 2003;110:1677–82.
[12] Tight blood pressure control and risk of macrovascular and microvascular complications in type 2 diabetes: UKPDS 38. UK Prospective Diabetes Study Group. BMJ 1998;317:703–13. [13] Chen X, Levine L, Kwok PY. Fluorescence polarization in homogeneous nucleic acid analysis. Genome Res 1999;9:492–8. [14] Kwok PY. SNP genotyping with fluorescence polarization detection. Hum Mutat 2002;19:315–23. [15] Kowluru RA, Chan PS. Oxidative stress and diabetic retinopathy. Exp Diabetes Res 2007;2007:43603. [16] Clustering of long-term complications in families with diabetes in the diabetes control and complications, trial., The Diabetes Control and Complications Trial Research, Group. Diabetes 1997;46:1829–39. [17] Abhary S, Hewitt AW, Burdon KP, Craig JE. A systematic metaanalysis of genetic association studies for diabetic retinopathy. Diabetes 2009;58:2137–47. [18] Su X, Chen X, Liu L, Chang X, Yu X, Sun K. Intracellular adhesion molecule-1 K469E gene polymorphism and risk of diabetic microvascular complications: a meta-analysis. PLoS One 2013;8:e69940. [19] Qiu M, Xiong W, Liao H, Li F. VEGF –634G>C polymorphism and diabetic retinopathy risk: a meta-analysis. Gene 2013;518:310–5. [20] Tong Z, Yang Z, Patel S, Chen H, Gibbs D, Yang X, et al. Promoter polymorphism of the erythropoietin gene in severe diabetic eye and kidney complications. Proc Natl Acad Sci U S A 2008;105: 6998–7003. [21] Zhang T, Pang C, Li N, Zhou E, Zhao K. Plasminogen activator inhibitor1 4G/5G polymorphism and retinopathy risk in type 2 diabetes: a metaanalysis. BMC Med 2013;11:1. [22] Ma J, Li Y, Zhou F, Xu X, Guo G, Qu Y. Meta-analysis of association between the Pro12Ala polymorphism of the peroxisome proliferatoractivated receptor-gamma2 gene and diabetic retinopathy in Caucasians and Asians. Mol Vis 2012;18:2352–60. [23] Tariq K, Malik SB, Ali SH, Maqsood SE, Azam A, Muslim I, et al. Association of Pro12Ala polymorphism in peroxisome proliferator activated receptor gamma with proliferative diabetic retinopathy. Mol Vis 2013;19:710–7. [24] Wang J, Yang MM, Li YB, Liu GD, Teng Y, Liu XM. Association of CFH and CFB gene polymorphisms with retinopathy in type 2 diabetic patients. Mediators Inflamm 2013;2013:748435. [25] Choe EY, Wang HJ, Kwon O, Kim KJ, Kim BS, Lee BW, et al. Variants of the adiponectin gene and diabetic microvascular complications in patients with type 2 diabetes. Metabolism 2013;62:677–85. [26] Ferreira FN, Crispim D, Canani LH, Gross JL, Dos Santos KG. Association study of sorbitol dehydrogenase –888G>C polymorphism with type 2 diabetic retinopathy in Caucasian-Brazilians. Exp Eye Res 2013;115C: 140–3. [27] Colhoun H. After FIELD: should fibrates be used to prevent cardiovascular disease in diabetes? Lancet 2005;366:1829–31. [28] Simo R, Roy S, Behar-Cohen F, Keech A, Mitchell P, Wong TY. Fenofibrate: a new treatment for diabetic retinopathy. Molecular mechanisms and future perspectives. Curr Med Chem 2013;20:3258–66. [29] Cetin EN, Bulgu Y, Ozdemir S, Topsakal S, Akin F, Aybek H, et al. Association of serum lipid levels with diabetic retinopathy. Int J Ophthalmol 2013;6:346–9. [30] Sasongko MB, Wong TY, Nguyen TT, Shaw JE, Jenkins AJ, Wang JJ. Novel versus traditional risk markers for diabetic retinopathy. Diabetologia 2012;55:666–70. [31] Hiukka A, Maranghi M, Matikainen N, Taskinen MR. PPARalpha: an emerging therapeutic target in diabetic microvascular damage. Nat Rev Endocrinol 2010;6:454–63. [32] Abcouwer SF. Direct effects of PPARalpha agonists on retinal inflammation and angiogenesis may explain how fenofibrate lowers risk of severe proliferative diabetic retinopathy. Diabetes 2013;62:36–8. [33] Chen Y, Hu Y, Lin M, Jenkins AJ, Keech AC, Mott R, et al. Therapeutic effects of PPARalpha agonists on diabetic retinopathy in type 1 diabetes models. Diabetes 2013;62:261–72. [34] Hu Y, Chen Y, Ding L, He X, Takahashi Y, Gao Y, et al. Pathogenic role of diabetes-induced PPAR-alpha down-regulation in microvascular dysfunction. Proc Natl Acad Sci U S A 2013;110(38).
Please cite this article in press as: Arndt C, et al. Association of endothelial lipase Thr111Ile polymorphism with proliferative retinopathy in type 2 diabetes patients. Diabetes Metab (2014), http://dx.doi.org/10.1016/j.diabet.2014.04.004
+Model DIABET-617; No. of Pages 7
ARTICLE IN PRESS C. Arndt et al. / Diabetes & Metabolism xxx (2014) xxx–xxx
[35] Ahmed W, Orasanu G, Nehra V, Asatryan L, Rader DJ, Ziouzenkova O, et al. High-density lipoprotein hydrolysis by endothelial lipase activates PPARalpha: a candidate mechanism for high-density lipoprotein-mediated repression of leukocyte adhesion. Circ Res 2006;98:490–8. [36] Edmondson AC, Brown RJ, Kathiresan S, Cupples LA, Demissie S, Manning AK, et al. Loss-of-function variants in endothelial lipase are a cause of elevated HDL cholesterol in humans. J Clin Invest 2009;119:1042–50. [37] Pierart C, Serrano V, Rubio L, Ebensperger R, Foncea R. [Glucose effect in the expression of endothelial lipase in human endothelial cells and in patients with diabetes mellitus type 2]. Nutr Hosp 2011;26:916–21.
7
[38] Gauster M, Hiden U, van Poppel M, Frank S, Wadsack C, Hauguelde Mouzon S, et al. Dysregulation of placental endothelial lipase in obese women with gestational diabetes mellitus. Diabetes 2011;60: 2457–64. [39] Choi SY, Hirata K, Ishida T, Quertermous T, Cooper AD. Endothelial lipase: a new lipase on the block. J Lipid Res 2002;43:1763–9. [40] Khetarpal SA, Edmondson AC, Raghavan A, Neeli H, Jin W, Badellino KO, et al. Mining the LIPG allelic spectrum reveals the contribution of rare and common regulatory variants to HDL cholesterol. PLoS Genet 2011;7:e1002393.
Please cite this article in press as: Arndt C, et al. Association of endothelial lipase Thr111Ile polymorphism with proliferative retinopathy in type 2 diabetes patients. Diabetes Metab (2014), http://dx.doi.org/10.1016/j.diabet.2014.04.004
ARTICLE IN PRESS Available online at
ScienceDirect www.sciencedirect.com Diabetes & Metabolism xxx (2014) xxx–xxx
Original article
Association of endothelial lipase Thr111Ile polymorphism with proliferative retinopathy in type 2 diabetes patients C. Arndt a , I. Leclercq a , P. Nazeyrollas b , A. Durlach c , A. Ducasse a , I. Movesayan e , E. Socquard d , C. Clavel c , M.M. Malloy e , C.R. Pullinger e , J.P. Kane e , V. Durlach b,e,∗ a Service d’Ophtalmologie, Hôpital Robert-Debré, Centre Hospitalo-Universitaire, 51092 Reims, France Pôle Thoracique, Cardio-Vasculaire et Neurologique, Centre Hospitalo-Universitaire, 51092 Reims, France c Laboratoire Pol Bouin, Hôpital Maison-Blanche, Centre Hospitalo-Universitaire, 51092 Reims, France d Service d’Endocrinologie, Maladies Métaboliques et de Médecine Interne, Hôpital Robert-Debré, Centre Hospitalo-Universitaire, 51092 Reims, France e Cardiovascular Research Institute, 555, Mission Bay Boulevard South Room 252A, Box 311, San Francisco, CA 94158, USA b
Received 28 October 2013; received in revised form 16 April 2014; accepted 19 April 2014
Abstract Aim. – Our previous study demonstrated that the endothelial lipase (EL) C.584C>T polymorphism (rs2000813, p.Thr111Ile) was significantly associated with diabetic retinopathy (DR). The present work was conducted to see if this specific variant of the EL gene was more specifically linked to the severity of DR. Methods. – This retrospective cohort study was based on a review of the institutional charts of 287 type 2 diabetes patients (mean age = 59.7 years; mean BMI = 29.0 kg/m2 ; mean HbA1c = 8.4%) genotyped for the EL C.584C>T polymorphism (rs2000813, p.Thr111Ile). The stage of DR was also determined for each genotype (CC, CT, TT). Results. – On univariate analysis, the minor allele homozygote TT variant was significantly associated with severe DR (OR: 4.3; 95% CI: 1.4, 13.1) compared with the major CC homozygote. No significant result was found for the CT heterozygote. Multivariate analysis revealed an increased risk for TT homozygotes to present with severe non-proliferative DR (OR: 8.09; 95% CI: 1.23, 53.1) or proliferative DR. Other associations were not significant. Conclusion. – Minor allele homozygosity for this EL variant (c.584C>T) could be a significant risk factor for developing severe, sight-threatening disease due to proliferative DR. Further prospective studies of this EL polymorphism in a larger population sample are needed to confirm these results. © 2014 Published by Elsevier Masson SAS. Keywords: Endothelial lipase gene; c.584C>T polymorphisms (rs2000813; p.Thr111Ile); Proliferative retinopathy; Type 2 diabetes
1. Introduction Type 2 diabetes (T2D) is a major clinical burden and the number of patients affected is expected to increase drastically worldwide, nearly doubling in highly industrialized countries and tripling in developing countries over the next 25 years. More than 300 million diabetic patients are expected worldwide by
∗ Corresponding author. Pôle Thoracique, Cardio-Vasculaire et Neurologique, Centre Hospitalo-Universitaire, 51092 Reims, France. Tel.: +33 3 26 91 82 78. E-mail addresses: [email protected], [email protected] (V. Durlach).
2025 [1]. This diabetic pandemic is also a leading cause of preventable blindness: diabetic retinopathy (DR). The screening and treatment by laser photocoagulation of diabetic patients with DR have proven effective for preventing end-stage vision loss. Unfortunately, our capability for detection and care is limited for economic reasons, making it necessary to target only high-risk patients [2]. Several risk factors for DR have been identified, such as hypertension, chronic hyperglycaemia (with high HbA1c ), body mass index (BMI), neuropathy, microalbuminuria and duration of diabetes [3,4]. Lipids may also play an important role in retinal microvascular complications in T2D patients through increased levels of very low-density lipoprotein (VLDL) and triglyceride (TG),
http://dx.doi.org/10.1016/j.diabet.2014.04.004 1262-3636/© 2014 Published by Elsevier Masson SAS.
Please cite this article in press as: Arndt C, et al. Association of endothelial lipase Thr111Ile polymorphism with proliferative retinopathy in type 2 diabetes patients. Diabetes Metab (2014), http://dx.doi.org/10.1016/j.diabet.2014.04.004
+Model DIABET-617; No. of Pages 7
ARTICLE IN PRESS
2
C. Arndt et al. / Diabetes & Metabolism xxx (2014) xxx–xxx
low-density lipoprotein cholesterol (LDL-C) and decreased levels of serum high-density lipoprotein cholesterol (HDL-C) [5]. In 2005, the Fenofibrate Intervention and Event Lowering in Diabetes (FIELD) study strongly confirmed this hypothesis, as patients treated with fenofibrate underwent less laser treatment [6,7]. These early results were confirmed by the Action to Control Cardiovascular Risk in Diabetes (ACCORD) study five years later: the association of a statin and fenofibrate significantly decreased DR progression compared with a statin alone [8]. Thus, hypolipidaemic treatment plays an important role in DR progression. In addition, genetic factors modulating lipid metabolism are also likely to modulate the expression of DR. By studying the association of an endothelial lipase (EL) polymorphism (c.584C>T, p.I111T, rs2000813) with lipid metabolism and microvascular complications in T2D patients, it was shown that this particular EL polymorphism was significantly associated with DR [9]. In that previous study, however, the stage of DR was not considered. For this reason, in the present retrospective chart review, the relationship between this specific EL polymorphism and stage of DR was evaluated in a subgroup of 287 T2D patients. 2. Methods 2.1. Study population The present study was based on a chart review of patients attending the diabetes center at Reims University Hospital (France) between 1992 and 1993. These patients were taken from our previously published longitudinal cohort of 396 French T2D patients [9], comprising 171 women and 225 men aged 59.5 ± 10.8 years (range: 27–83 years). The study protocol was approved by the local ethics committee, and the criteria for T2D were those defined by the National Diabetes Data Group [10]. An experienced ophthalmologist who had no knowledge of the genetic analyses results blindly reviewed the charts; the latest reported fundus examination was reviewed and used to classify patients according to the American Academy of Ophthalmology grading scale for DR [11]. To simplify our analysis, a normal fundus or mild non-proliferative DR was considered stage I, moderate non-proliferative DR was stage II, severe nonproliferative DR was stage III and proliferative DR or a history of panretinal laser photocoagulation was stage IV. When different stages in either eye were identified, the eye with the most advanced stage was described for the final classification. 2.2. Genetic analysis As previously described, genomic DNA was extracted from white blood cells using phenol–chloroform [12]. Fluorescencepolarization detection with template-directed dye terminator incorporation (FD–TDI) was used for detection of p.Thr111Ile (rs2000813), as described elsewhere [13]. Briefly, the template was amplified by polymerase chain reaction (PCR), and excess deoxynucleotide triphosphate (dNTP) and unincorporated primers were removed using ExoSAP-IT (USB Corporation,
Cleveland, OH, USA), followed by single-base primer extension using a polymorphic site-specific primer (IDT, Skokie, IL, USA) and incorporation of fluorescent dye terminator (PerkinElmer Life Sciences, Boston, MA, USA) in the final extension step. The PCR primers used were ATGAGCGGTATCTTTGAAAAC(F), CTTAAGAAGATTGGGTTTGAGAT(R) and CGTGTCAGCCCTGCACA alleles [C/T]. The assay was read by a microplate reader using the fluorescence-polarization (FP) technique, and the allele present in the target DNA was assigned using algorithms and controls as previously described [13,14]. 2.3. Statistical analysis Patients were classified into either four groups (four-group analysis), comprising no or mild DR (stage I), moderate nonproliferative DR (stage II), severe non-proliferative DR (stage III) and proliferative DR or a history of panretinal laser photocoagulation (stage IV), or into two groups (two-group analysis), comprising no, mild or moderate DR vs severe non-proliferative DR, proliferative DR or a history of panretinal laser photocoagulation (advanced DR). As for the p.Ile111Thr polymorphism, patients were grouped according to common allele carriers (CC, CT) or rare allele homozygotes (TT). SPSS software (version 19, IBM Corporation, Armonk, NY, USA) was used for the statistical analysis. Allele and genotype frequencies were determined by gene counting. A test for the Hardy–Weinberg equilibrium was performed. Comparisons between groups were performed by chi-square tests (2 ) and by exact tests for categorical data. Comparisons of means of normally distributed variables were performed using univariate analysis of variance (ANOVA); non-parametric Kruskal–Wallis tests were used for other variables, and regression of genotype against retinopathy status was performed. Ascending stepwise logistic regression models for retinopathy were constructed; the variables proposed were age, gender and data-driven variables (those reaching statistical significance for an association with DR on univariate analysis). For all analyses, significance was defined as an alpha risk < 0.05. 3. Results 3.1. Study sample The charts of 287 of the initial 396 patients were analyzed, most of whom were Caucasian; 109 patients could not be included in this secondary study for a variety of reasons: patients were lost to follow-up; no ophthalmological examination was done at hospital; and this population had a higher mortality rate. For patients included in our study, their mean duration of diabetes was 12.0 ± 7.9 years, mean BMI was 29.0 ± 5.5 kg/m2 , and they were following a diet and/or taking antidiabetic drugs [metformin (n = 241) and/or sulphonylureas (n = 252)] and/or insulin (n = 35). Lipid-lowering therapy was being used by 27.5% of patients (n = 18 taking statins, n = 61 taking fibrates); 47.9% of patients were being treated for hypertension (24.5%
Please cite this article in press as: Arndt C, et al. Association of endothelial lipase Thr111Ile polymorphism with proliferative retinopathy in type 2 diabetes patients. Diabetes Metab (2014), http://dx.doi.org/10.1016/j.diabet.2014.04.004
+Model
ARTICLE IN PRESS
DIABET-617; No. of Pages 7
C. Arndt et al. / Diabetes & Metabolism xxx (2014) xxx–xxx
3
Table 1 Main characteristics of type 2 diabetes patientsa by genotype.
Gender (male/female, n/n) Age (years) Body mass index (kg/m2 ) Systolic blood pressure (mmHg) Diastolic blood pressure (mmHg) Diabetes duration (years) HbA1c (%) Coronaropathy [n (%)] Nephropathy [n (%)] Creatinine (mol/L) Microalbuminuria (mg/24 h) Triglycerides (mmol/L) Total cholesterol (mmol/L) HDL cholesterol (mmol/L) LDL cholesterol (mmol/L) Apolipoprotein A (g/L) Apolipoprotein B (g/L) Uricaemia (mol/L) Lipoprotein(a) (mg/L) Retinopathy [n (%)] None or mild Moderate Severe non-proliferative Proliferative
All (n = 287)
CC/CT (n = 256)
TT (n = 31)
P
167/120 59.7 ± 10.4 29.0 ± 5.5 15.9 ± 2.6 9.3 ± 1.5 12.0 ± 7.9 8.4 ± 1.9 57 (20%) 130 (45%) 93.9 ± 22.6 37 ± 114 2.3 ± 2.0 5.8 ± 1.3 1.3 ± 0.4 3.5 ± 1.0 1.32 ± 0.22 1.32 ± 0.35 300 ± 86 206 ± 310
147/109 59.5 ± 10.6 29.0 ± 5.6 15.9 ± 2.7 9.2 ± 1.4 11.9 ± 7.9 8.4 ± 1.9 50 (19%) 116 (45%) 93.2 ± 23.0 38 ± 120 2.3 ± 2.1 5.9 ± 1.3 1.3 ± 0.4 3.5 ± 1.0 1.34 ± 0.20 1.33 ± 0.35 298 ± 87 219 ± 321
20/11 61.5 ± 8.4 29.0 ± 5.5 16.2 ± 2.1 9.5 ± 1.7 12.8 ± 8.4 8.2 ± 1.9 7 (23%) 14 (45%) 99.6 ± 19.8 27 ± 197 2.2 ± 1.6 5.5 ± 0.9 1.3 ± 0.4 3.2 ± 0.9 1.33 ± 0.22 1.18 ± 0.31 306 ± 80 107 ± 169
0.29 0.30 0.78 0.50 0.37 0.57 0.56 0.42 0.57 0.14 0.62 0.72 0.13 0.43 0.06 0.64 0.03 0.67 0.07 < 0.01
225 (78%) 40 (14%) 8 (3%) 14 (5%)
205 (80%) 36 (14%) 6 (2%) 9 (4%)
20 (65%) 4 (13%) 2 (6%) 5 (16%)
a Patients
were following a diet and/or taking antidiabetic drugs [metformin (n = 241) and/or sulphonylureas (n = 252)] and/or insulin (n = 35); lipid-lowering therapy was used by 27.5% (n = 18 with statins, n = 61 with fibrates); 47.9% treated for hypertension (24.5% with ACE inhibitors) were equally distributed in each genotype group; 30% were smokers, with no genotype group differences; most of the women were post-menopausal, and none were taking hormone replacement therapy.
with ACE inhibitors) and were equally distributed across the genotype groups; and 30% were smokers, with no genotype group differences. Most of the women were post-menopausal, but none was taking hormone replacement therapy.
The clinical and biological characteristics of the patients and their distribution according to genotype [CC: 127 (44.3%); CT: 129 (44.9%); and TT: 31 (10.8%)] are presented in Table 1, and their distribution according to retinopathy grading in Table 2.
Table 2 Main characteristics of type 2 diabetes patients by stage of diabetic retinopathy.
Gender (male/female, n/n) Genotype (xC/TT, n/n) Age (years) Body mass index (kg/m2 ) Systolic blood pressure (mmHg) Diastolic blood pressure (mmHg) Diabetes duration (years) HbA1c (%) Coronary disease (n) Nephropathy (n) Creatinine (mol/L) Microalbuminuria (mg/24 h) Triglycerides (mmol/L) Total cholesterol (mmol/L) HDL cholesterol (mmol/L) LDL cholesterol (mmol/L) Apolipoprotein A (g/L) Apolipoprotein B (g/L) Uricaemia (mol/L) Lipoprotein(a) (mg/L)
None or mild (n = 225)
Moderate (n = 40)
Severe non-proliferative (n = 8)
Proliferative (n = 14)
P
129/96 205/20 60.1 ± 10.5 28.7 ± 5.5 157 ± 26 92 ± 14 11.7 ± 7.8 8.1 ± 1.8 45 97 94.4 ± 23.9 38.5 ± 127 2.11 ± 1.52 5.7 ± 1.1 1.26 ± 0.36 3.48 ± 0.93 1.31 ± 0.22 1.29 ± 0.34 302 ± 88 201 ± 260
27/13 36/4 57.4 ± 10.8 29.6 ± 5.8 165 ± 27 96 ± 14 10.5 ± 6.1 9.1 ± 2.0 4 22 89.5 ± 11.6 23.5 ± 36.3 2.6 ± 1.9 6.1 ± 1.5 1.32 ± 0.37 3.57 ± 1.37 1.41 ± 0.23 1.37 ± 0.35 285 ± 78 180 ± 278
4/4 6/2 59.1 ± 6.5 29.8 ± 4.6 177 ± 38 95 ± 24 14.7 ± 8.3 9.5 ± 2.0 2 3 79.5 ± 7.3 61.2 ± 55.6 5.2 ± 7.5 6.5 ± 3.0 1.26 ± 0.45 2.87 ± 1.35 1.28 ± 0.19 1.32 ± 0.35 294 ± 87 123 ± 210
7/7 9/5 59.7 ± 7.9 31.9 ± 5.1 171 ± 24 96 ± 21 20.1 ± 10.0 10.1 ± 2.2 6 8 106.8 ± 27.1 46.9 ± 56.3 2.5 ± 1.3 6.1 ± 1.2 1.23 ± 0.43 3.74 ± 1.05 1.32 ± 0.18 1.41 ± 0.43 299 ± 90 406 ± 775
0.29 < 0.01 0.53 0.15 0.03 0.34 < 0.01 < 0.01 0.10 0.08 0.024 0.33 0.07 0.10 0.82 0.26 0.09 0.57 0.71 0.50
Please cite this article in press as: Arndt C, et al. Association of endothelial lipase Thr111Ile polymorphism with proliferative retinopathy in type 2 diabetes patients. Diabetes Metab (2014), http://dx.doi.org/10.1016/j.diabet.2014.04.004
+Model DIABET-617; No. of Pages 7
ARTICLE IN PRESS
4
C. Arndt et al. / Diabetes & Metabolism xxx (2014) xxx–xxx
Table 3 Risk of retinopathya in endothelial lipase rare allele homozygotes with type 2 diabetes. Genotype (n) Retinopathy grade
xC
TT
No or mild Moderate Severe non-proliferative Proliferative
225 36 6 9
20 4 2 5
a
OR [95% CI]
1.1 [0.4, 3.5] 3.4 [0.6, 18.0] 5.7 [1.7, 18.6]
Using univariate logistic regression of genotype against retinopathy status.
The 111Ile minor allele frequency was similar to those reported in other populations (T allele = 0.333) and did not deviate from Hardy–Weinberg expectations (P = 0.83). Genotype, systolic blood pressure, diabetes duration, HbA1c and serum creatinine were significantly associated with DR status. 3.2. Genotype association with diabetic retinopathy 3.2.1. Four-group analysis Among the homozygotes for the rare allele (TT), the occurrence of stage IV DR (proliferative DR or laser treatment) was highly increased (OR: 5.7; 95% CI: 1.7, 18.6) on univariate analysis. No significant association was found with other stages of advanced DR (moderate or severe non-proliferative DR; Table 3). 3.2.2. Two-group analysis Advanced DR (severe non-proliferative DR, proliferative DR, panretinal laser photocoagulation) was more common in rare allele TT homozygotes (OR: 4.3; 95% CI: 1.4, 13.1) than in major allele CC homozygotes; no significant effects were seen in CT heterozygotes (Table 4). As the effect of the Thr111Ile trait on the occurrence of advanced stages of DR was consistent with a recessive mode of inheritance, all analyses were conducted on genetic data collapsed into carriers of the major allele (CC + CT) and those homozygous for the minor allele (TT). TT carriers had a significantly higher frequency of advanced DR (OR: 4.7; 95% CI: 1.7, 12.6). 3.2.3. Lipid phenotype characteristics of the rare allele carriers Homozygotes for the rare allele displayed modestly decreased LDL-C (P = 0.06) and decreased apolipoprotein B Table 4 Riska of advanced diabetic retinopathy (DR)b in type 2 diabetes patients by genotype of endothelial lipase 1. Genotype
No advanced DR
Advanced DR
CC CT TT xC TT
119 122 24 241 24
8 7 7 15 7
a b
P
OR [95% CI]
0.77 0.018
0.85 [0.3, 13.1] 4.3 [1.4, 13.1]
0.005
4.7 [1.7, 12.6]
Using univariate logistic regression of genotype against retinopathy status. Defined as either severe, non-proliferative or proliferative.
Table 5 Risk of developing different stages of diabetic retinopathy. Retinopathy
Variablesa
OR [95% CI]
No or mild (reference) Moderate (stage II)
– Genotype TT Diabetes duration (years) HbA1c (%) Creatinine (mol/L) Genotype TT Diabetes duration (years) HbA1c (%) Creatinine (mol/L) Genotype TT Diabetes duration (years) HbA1c (%) Creatinine (mol/L)
– 1.51 [0.47, 4.87] 0.97 [0.92, 1.02] 1.33 [1.12, 1.59] 0.98 [0.96, 1.01] 8.09 [1.23, 53.1] 1.04 [0.95, 1.13] 1.46 [0.97, 2.21] 0.91 [0.85, 0.98] 6.22 [1.51, 25.6] 1.11 [1.04, 1.19] 1.78 [1.28, 2.48] 1.01 [0.99, 1.03]
Severe non-proliferative (stage III) Proliferative (stage IV)
a In a multivariate setting by ascending stepwise logistic regression against severity of retinopathy; age, gender and systolic arterial pressure were proposed, but not included; criteria: to enter, P < 0.05; to remove, P > 0.10.
(ApoB) levels (P = 0.03; Table 1); no other differences between rare allele homozygotes and major allele carriers were found, except for DR. 3.2.4. Multivariate analysis Age, gender, genotype, creatinine, diabetes duration, HbA1c and systolic blood pressure were proposed for the multivariate stepwise analysis (Table 2). Predictors in the model included rare allele homozygotes (P = 0.03), diabetes duration (P = 0.01), and HbA1c (P < 0.01) and creatinine (P = 0.01) levels (Table 5). On multivariate analysis, rare allele homozygotes had an increased risk of stage III (severe non-proliferative) or IV (proliferative) DR, with respective ORs (95% CIs) of 8.1 (1.23, 53.1) and 6.2 (1.5, 25.6). 4. Discussion DR remains one of the leading causes of blindness in the developed countries. Although its pathogenesis is still unclear, it is now well established that DR development depends on several factors, such as poor glycaemic control and duration of diabetes: 50% of diabetic patients suffer from DR after 10 years, and 90% after 25 years of chronic hyperglycaemia [15]. Severe forms of DR can lead to retinal detachment, intravitreal haemorrhages and neovascular glaucoma: these complications are resourceintensive, and represent both a drama for affected patients and an economic burden for healthcare systems, as costs increase with severity of the disease. The pathogenesis of proliferative DR is complex and multifactorial, combining both environmental and genetic factors. The Diabetes Control and Complications Trial (DCCT) [16] showed a significant familial tendency for severe DR in both type 2 and type 1 diabetes patients. Thus, numerous studies considering candidate genes as a DR risk factor in patients of various ethnicities have been conducted. Historically, the polyol pathway was the first item of interest towards understanding DR lesions. The AKR1B1 gene coding for aldose reductase is now the gene most significantly associated with DR development:
Please cite this article in press as: Arndt C, et al. Association of endothelial lipase Thr111Ile polymorphism with proliferative retinopathy in type 2 diabetes patients. Diabetes Metab (2014), http://dx.doi.org/10.1016/j.diabet.2014.04.004
+Model DIABET-617; No. of Pages 7
ARTICLE IN PRESS C. Arndt et al. / Diabetes & Metabolism xxx (2014) xxx–xxx
the promoter single-nucleotide polymorphism (SNP) rs759853 and (CA)n microsatellite polymorphism located at the 5 end of the AKR1B1 gene are both significantly associated with DR [17]. The rs2910964 SNP of the ITGA2 gene is also significantly associated with DR, as is the ICAM1 K469E gene (rs13306430 polymorphism) [18]. Multiple polymorphisms of vascular endothelial growth factor (VEGF) have also been studied, and a recent meta-analysis has confirmed the 634G>C polymorphism as having a significant relationship with DR in both an allelic genetic model and a recessive genetic model [19]. Recently, the NP rs1617640 in the promoter of the erythropoietin (EPO) gene [20], the human leucocyte antigen (HLA) gene, the plasminogen activator inhibitor-1 (PAI-1) gene 4G/5G polymorphism [21], the peroxisome proliferator-activated receptor (PPAR)-γ2 gene (rs1801282 (c.34C>G, p.Pro12Ala)) [22,23], complement genes with CFH-rs800292 and CFB-rs1048709 polymorphisms [24] and adiponectin genes (rs2241766) [25] have also been correlated with DR. However, these results need to be confirmed in larger clinical and fundamental studies, as their exact molecular mechanisms remain unclear. ACE (angiotensin-converting enzyme), sorbitol dehydrogenase (–888G>C polymorphism) and NOS3 (endothelial nitric oxide synthase) genes have also been studied, but no statistically significant associations with DR were found [17,26]. The involvement of the Thr111Ile missense polymorphism of EL and the occurrence of DR in 396 T2D patients have already been demonstrated by a longitudinal follow-up [9]. In the present study, the first to examine the relationship between the Thr111Ile EL variant and DR stage in T2D patients, a subgroup of 287 patients was investigated: homozygotes for the rare allele of the Thr111Ile EL polymorphism presented with more advanced stages of DR and especially more proliferative DR. This study highlights a new gene of interest in DR pathogenesis. Only a modest influence of the EL c.584C>T polymorphism on lipid parameters was found, except for lower ApoB values in TT patients, but the study was limited by the modest size of the series. Nevertheless, the involvement of lipid metabolism on DR progression is plausible: the FIELD study results showed that fenofibrate, a PPAR-␣ agonist lowered TG concentrations and raised HDL-C in 9795 T2D patients [7,27]. In that largescale, prospective, multinational randomized controlled trial, the fenofibrate group needed significantly less laser panphotocoagulation (P = 0.0003) than the placebo group. Five years later, these results were confirmed by 10,251 TD2 patients in the ACCORD study [8]. Intensive dyslipidaemia therapy using fenofibrate plus a statin decreased DR progression by 40% over 4 years (P = 0.006) vs a statin alone. A significant reduction of TG level in the fenofibrate group was also seen. Although fenofibrate’s exact molecular mechanisms remain unclear, the current thinking is that this treatment might be influencing multiple pathways involved in the pathogenesis of DR [28]. First, fenofibrate could affect DR via lipid-related mechanisms by lowering TG, LDL-C and ApoB, and raising ApoA-1 and HDL-C. However, no relationship was found between the lipid-modifying effects of fenofibrate and the incidence or
5
progression of DR in either the FIELD or ACCORD study [6,8,29]. Yet, fenofibrate could modulate the qualitative properties of lipoproteins, such as ApoA-1, an independent protective factor for DR development, or by reducing lipoprotein-associated phospholipase A2 (Lp-PLA2) and its proinflammatory effects [30]. Second, emerging data also suggest therapeutic mechanisms for its active metabolite (fenofibric acid) independent of serum lipid changes [28], including anti-apoptotic activity and endothelial function improvement, antioxidant and anti-inflammatory activity, neuroprotective effects, preventative effects on blood–retinal barrier breakdown and anti-angiogenic activity by PPAR-␣ activation [31–33], which a recent study has confirmed. In both type 1 and type 2 diabetes models, a high-glucose medium was sufficient to downregulate PPAR-␣ expression in cultured retinal cells. Finally, diabetic PPAR-␣ knockout mice developed more severe DR. Thus, PPAR-␣ activation could be a new key to prevent DR progression [34]. In addition, it is now also known that EL activates PPAR-␣ via HDL hydrolysis [35,36]. EL is itself activated by hyperglycaemia [37], metabolic inflammation via tumour necrosis factor (TNF)-␣ and leptin [38], and mechanical forces on vascular endothelium [39]. By activating PPAR-␣, EL could inhibit vascular cell adhesion molecule (VCAM)-1 expression, endothelial adhesion molecules and capillary occlusion. Variants of EL (for example, Asn396Ser) have already been associated with lower activity of the enzyme and higher HDL-C values [36]. According to the PolyPhen (polymorphism phenotyping) prediction tool, Thr111Ile is a missense variant that does not damage either EL function or EL lipolytic activity. However, this variant was associated with increased plasma HDL-C in a metaanalysis of more than 100,000 subjects. This could be explained by the high linkage disequilibrium (LD) between the 229 T>G and Thr111Ile polymorphisms observed in the Study of Inherited Risk of Coronary Atherosclerosis (SIRCA) participants. As the 229 T>G (rs34474737) variant is known to decrease EL promoter activity and to raise plasma EL in humans, this LD could be the key to understanding how the Thr111Ile variant is associated with reduced EL levels and perhaps also DR [40]. Other hypotheses have been suggested. As a phospholipase, EL could alter the bilipid layer of endothelial cell membranes. By increasing adhesion of leucocytes, this would lead to capillary non-perfusion. The Thr111Ile EL variant gene could also be associated with a yet unidentified mutation that alters its biological function. Further fundamental research might elucidate more clearly the role of EL and its variants in microangiopathy development. Our present study was limited by its reduced sample size, such that the statistical power of the subgroup analyses might not have been sufficient to detect more significant associations with lipids levels. Also, some patients’ charts had no retinography and our conclusions were based on the ophthalmologist’s fundus examinations with no possibility of a control. Nevertheless, and in the light of the present study findings, the EL Thr111Ile polymorphism might be strongly associated with proliferative DR. Larger prospective studies are now required to confirm these initial results. If confirmed, then genetic screening
Please cite this article in press as: Arndt C, et al. Association of endothelial lipase Thr111Ile polymorphism with proliferative retinopathy in type 2 diabetes patients. Diabetes Metab (2014), http://dx.doi.org/10.1016/j.diabet.2014.04.004
+Model DIABET-617; No. of Pages 7
ARTICLE IN PRESS
6
C. Arndt et al. / Diabetes & Metabolism xxx (2014) xxx–xxx
may help in the early detection of high-risk diabetic patients. Focusing our means solely on this population could improve both healthcare spending and the diabetic population’s care. Disclosure of interest The authors declare that they have no conflicts of interest concerning this article. Acknowledgements They would like to thank Prs Antonio Brunetti and Eusebio Chieffari for their valuable advice and reviewing of this work. Funding: The authors of this article did not benefit of any funding.
Appendix A. Supplementary data Supplementary data (French summary) associated with this article can be found, in the online version, at http://dx.doi.org/ 10.1016/j.diabet.2014.04.004. References [1] Delcourt C, Massin P, Rosilio M. Epidemiology of diabetic retinopathy: expected vs reported prevalence of cases in the French population. Diabetes Metab 2009;35:431–8. [2] Chou CF, Zhang X, Crews JE, Barker LE, Lee PP, Saaddine JB. Impact of geographic density of eye care professionals on eye care among adults with diabetes. Ophthalmic Epidemiol 2012;19:340–9. [3] Tan GS, Ikram MK, Wong TY. Traditional and novel risk factors of diabetic retinopathy and research challenges. Curr Med Chem 2013;20(26):3189–99. [4] Li X, Wang Z. Prevalence and incidence of retinopathy in elderly diabetic patients receiving early diagnosis and treatment. Exp Ther Med 2013;5:1393–6. [5] Aldebasi YH, Mohieldein AH, Almansour YS, Almutairi BL. Dyslipidemia and lipid peroxidation of Saudi type 2 diabetics with proliferative retinopathy. Saudi Med J 2013;34:616–22. [6] Scott R, Best J, Forder P, Taskinen MR, Simes J, Barter P, et al. Fenofibrate Intervention and Event Lowering in Diabetes (FIELD) study: baseline characteristics and short-term effects of fenofibrate [ISRCTN64783481]. Cardiovasc Diabetol 2005;4:13. [7] Keech A, Simes RJ, Barter P, Best J, Scott R, Taskinen MR, et al. Effects of long-term fenofibrate therapy on cardiovascular events in 9795 people with type 2 diabetes mellitus (the FIELD study): randomised controlled trial. Lancet 2005;366:1849–61. [8] Chew EY, Ambrosius WT, Davis MD, Danis RP, Gangaputra S, Greven CM, et al. Effects of medical therapies on retinopathy progression in type 2 diabetes. N Engl J Med 2010;363:233–44. [9] Durlach V, Durlach A, Movesayan I, Socquard E, Zellner C, Clavel C, et al. Association of endothelial lipase Thr111Ile polymorphism with lipid metabolism and microvascular complications in type 2 diabetic patients. Diabetes Metab 2011;37:64–71. [10] Classification and diagnosis of diabetes mellitus and other categories of glucose, intolerance, National Diabetes Data, Group. Diabetes 1979;28:1039–57. [11] Wilkinson CP, Ferris 3rd FL, Klein RE, Lee PP, Agardh CD, et al. Proposed international clinical diabetic retinopathy and diabetic macular edema disease severity scales. Ophthalmology 2003;110:1677–82.
[12] Tight blood pressure control and risk of macrovascular and microvascular complications in type 2 diabetes: UKPDS 38. UK Prospective Diabetes Study Group. BMJ 1998;317:703–13. [13] Chen X, Levine L, Kwok PY. Fluorescence polarization in homogeneous nucleic acid analysis. Genome Res 1999;9:492–8. [14] Kwok PY. SNP genotyping with fluorescence polarization detection. Hum Mutat 2002;19:315–23. [15] Kowluru RA, Chan PS. Oxidative stress and diabetic retinopathy. Exp Diabetes Res 2007;2007:43603. [16] Clustering of long-term complications in families with diabetes in the diabetes control and complications, trial., The Diabetes Control and Complications Trial Research, Group. Diabetes 1997;46:1829–39. [17] Abhary S, Hewitt AW, Burdon KP, Craig JE. A systematic metaanalysis of genetic association studies for diabetic retinopathy. Diabetes 2009;58:2137–47. [18] Su X, Chen X, Liu L, Chang X, Yu X, Sun K. Intracellular adhesion molecule-1 K469E gene polymorphism and risk of diabetic microvascular complications: a meta-analysis. PLoS One 2013;8:e69940. [19] Qiu M, Xiong W, Liao H, Li F. VEGF –634G>C polymorphism and diabetic retinopathy risk: a meta-analysis. Gene 2013;518:310–5. [20] Tong Z, Yang Z, Patel S, Chen H, Gibbs D, Yang X, et al. Promoter polymorphism of the erythropoietin gene in severe diabetic eye and kidney complications. Proc Natl Acad Sci U S A 2008;105: 6998–7003. [21] Zhang T, Pang C, Li N, Zhou E, Zhao K. Plasminogen activator inhibitor1 4G/5G polymorphism and retinopathy risk in type 2 diabetes: a metaanalysis. BMC Med 2013;11:1. [22] Ma J, Li Y, Zhou F, Xu X, Guo G, Qu Y. Meta-analysis of association between the Pro12Ala polymorphism of the peroxisome proliferatoractivated receptor-gamma2 gene and diabetic retinopathy in Caucasians and Asians. Mol Vis 2012;18:2352–60. [23] Tariq K, Malik SB, Ali SH, Maqsood SE, Azam A, Muslim I, et al. Association of Pro12Ala polymorphism in peroxisome proliferator activated receptor gamma with proliferative diabetic retinopathy. Mol Vis 2013;19:710–7. [24] Wang J, Yang MM, Li YB, Liu GD, Teng Y, Liu XM. Association of CFH and CFB gene polymorphisms with retinopathy in type 2 diabetic patients. Mediators Inflamm 2013;2013:748435. [25] Choe EY, Wang HJ, Kwon O, Kim KJ, Kim BS, Lee BW, et al. Variants of the adiponectin gene and diabetic microvascular complications in patients with type 2 diabetes. Metabolism 2013;62:677–85. [26] Ferreira FN, Crispim D, Canani LH, Gross JL, Dos Santos KG. Association study of sorbitol dehydrogenase –888G>C polymorphism with type 2 diabetic retinopathy in Caucasian-Brazilians. Exp Eye Res 2013;115C: 140–3. [27] Colhoun H. After FIELD: should fibrates be used to prevent cardiovascular disease in diabetes? Lancet 2005;366:1829–31. [28] Simo R, Roy S, Behar-Cohen F, Keech A, Mitchell P, Wong TY. Fenofibrate: a new treatment for diabetic retinopathy. Molecular mechanisms and future perspectives. Curr Med Chem 2013;20:3258–66. [29] Cetin EN, Bulgu Y, Ozdemir S, Topsakal S, Akin F, Aybek H, et al. Association of serum lipid levels with diabetic retinopathy. Int J Ophthalmol 2013;6:346–9. [30] Sasongko MB, Wong TY, Nguyen TT, Shaw JE, Jenkins AJ, Wang JJ. Novel versus traditional risk markers for diabetic retinopathy. Diabetologia 2012;55:666–70. [31] Hiukka A, Maranghi M, Matikainen N, Taskinen MR. PPARalpha: an emerging therapeutic target in diabetic microvascular damage. Nat Rev Endocrinol 2010;6:454–63. [32] Abcouwer SF. Direct effects of PPARalpha agonists on retinal inflammation and angiogenesis may explain how fenofibrate lowers risk of severe proliferative diabetic retinopathy. Diabetes 2013;62:36–8. [33] Chen Y, Hu Y, Lin M, Jenkins AJ, Keech AC, Mott R, et al. Therapeutic effects of PPARalpha agonists on diabetic retinopathy in type 1 diabetes models. Diabetes 2013;62:261–72. [34] Hu Y, Chen Y, Ding L, He X, Takahashi Y, Gao Y, et al. Pathogenic role of diabetes-induced PPAR-alpha down-regulation in microvascular dysfunction. Proc Natl Acad Sci U S A 2013;110(38).
Please cite this article in press as: Arndt C, et al. Association of endothelial lipase Thr111Ile polymorphism with proliferative retinopathy in type 2 diabetes patients. Diabetes Metab (2014), http://dx.doi.org/10.1016/j.diabet.2014.04.004
+Model DIABET-617; No. of Pages 7
ARTICLE IN PRESS C. Arndt et al. / Diabetes & Metabolism xxx (2014) xxx–xxx
[35] Ahmed W, Orasanu G, Nehra V, Asatryan L, Rader DJ, Ziouzenkova O, et al. High-density lipoprotein hydrolysis by endothelial lipase activates PPARalpha: a candidate mechanism for high-density lipoprotein-mediated repression of leukocyte adhesion. Circ Res 2006;98:490–8. [36] Edmondson AC, Brown RJ, Kathiresan S, Cupples LA, Demissie S, Manning AK, et al. Loss-of-function variants in endothelial lipase are a cause of elevated HDL cholesterol in humans. J Clin Invest 2009;119:1042–50. [37] Pierart C, Serrano V, Rubio L, Ebensperger R, Foncea R. [Glucose effect in the expression of endothelial lipase in human endothelial cells and in patients with diabetes mellitus type 2]. Nutr Hosp 2011;26:916–21.
7
[38] Gauster M, Hiden U, van Poppel M, Frank S, Wadsack C, Hauguelde Mouzon S, et al. Dysregulation of placental endothelial lipase in obese women with gestational diabetes mellitus. Diabetes 2011;60: 2457–64. [39] Choi SY, Hirata K, Ishida T, Quertermous T, Cooper AD. Endothelial lipase: a new lipase on the block. J Lipid Res 2002;43:1763–9. [40] Khetarpal SA, Edmondson AC, Raghavan A, Neeli H, Jin W, Badellino KO, et al. Mining the LIPG allelic spectrum reveals the contribution of rare and common regulatory variants to HDL cholesterol. PLoS Genet 2011;7:e1002393.
Please cite this article in press as: Arndt C, et al. Association of endothelial lipase Thr111Ile polymorphism with proliferative retinopathy in type 2 diabetes patients. Diabetes Metab (2014), http://dx.doi.org/10.1016/j.diabet.2014.04.004
