IJCA-18048; No of Pages 3 International Journal of Cardiology xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
International Journal of Cardiology journal homepage: www.elsevier.com/locate/ijcard
Letter to the Editor
Association of endothelial nitric oxide synthase gene mini-satellite marker VNTR polymorphism with ischemic stroke in the Chinese Uyghur population Yeqing Tong a,b,c,1, Yanwei Zhang c,1, Faxian Zhan b,1, Zhihong Wang a,1, Xu-hua Guan b, Jianping Liu c, Xiaoxv Yin a, Yijie Geng c, Jian-jun Ye b, Shuang-yi Hou b, Jiafa Liu b,⁎, Zuxun Lu a,⁎⁎, Jin-quan Cheng c,⁎⁎⁎ a b c
School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430030, PR China Hubei Center for Disease Control and Prevention, Wuhan 430079, PR China Key Laboratory of Molecular Biology of Guangdong Province, Shenzhen Center for Disease Control and Prevention, Shenzhen 518020, PR China
a r t i c l e
i n f o
Article history: Received 10 April 2014 Accepted 12 April 2014 Available online xxxx Keywords: High capillary electrophoresis eNOS Variable number of tandem repeat Ischemic stroke Uyghurs
The eNOS gene is located on 7q35–36 and comprises 26 exons spanning 21 kb. Toward 5-flanking region, the 27-bp variable number of tandem repeat (VNTR) polymorphism (4a/4b) within intron 4 [Supplementary Fig. 1] is associated with alterations in promoter activity and altered plasma NO concentrations and has been reported to be implicated in the development of ischemic stroke (IS) [1–4]. It was proposed that VNTR polymorphism was associated with IS in Americans [5]. However, the validity of the association remained controversial. The Uyghur population, a minority group confirmed from Turkish nomads with 60% European ancestry and 40% East Asian ancestry living in Xinjiang which has its own language, religious beliefs and lifestyles, may be very different from either Han population or American/ European populations [6]. Our aim was to determine whether the VNTRs have functional influence on IS in this unique population using a tailed primer protocol and to procure wider genetic inferences of
⁎ Corresponding author. Fax: + 86 27 87652049. ⁎⁎ Corresponding author. Fax: + 86 27 83693756. ⁎⁎⁎ Corresponding author. Fax: + 86 755 25626488. E-mail addresses: [email protected] (J. Liu), [email protected] (Z. Lu), [email protected] (J. Cheng). 1 These authors have equally contributed to this work.
locus effects across Caucasians and Blacks with different geographic origins and lifestyles. The study patients were enrolled among the inpatients attending the Stroke Unit of two Xinjiang hospitals consecutively. Due to religious belief and harsh medical environment as well as the living environment in which this ethnic group is clustered, the collection of blood sample was extremely difficult. All subjects were provided written informed consents as IJC. A total of 100 typical Uyghur IS subjects were enrolled into the case–control study. The diagnosis of IS was established according to TOAST classification. All stroke cases were first-ever IS determined by CT or MRI. Concurrently, 100 age, gender and ethnically-matched normal healthy controls were randomly collected. Subjects with history of stroke, Alzheimer's disease, brain aneurysm, and Parkinson's disease were excluded from controls. An epidemiological investigation was performed with a standardized questionnaire to record epidemiological features. The VNTR amplification was performed with three primers: Forward primer CACGACGTTGTAAAACGACAGGCCCTATGGTAGTGCCTTT (F) with a M13 universal tail, Reverse primer TCTCTTAGTGCTGTGGTCAC (R), and the third primer labeled with cy5 dye (Cy5-CACGACGTTGTAAAACGAC). The final products contained the fluorescence dye that can be detected by the Beckman-Coulter Genetic Analysis System. Alleles were identified by high performance capillary electrophoresis with GenomeLab Separation Gel and a DNA size kit-600 (Beckman Coulter, USA) on CEQ 8800 Genetic Analysis System. OR at 95% CI was determined to describe the strength of association by multivariate logistic regression model. The characteristics of patients and controls were summarized in Supplementary Table 1. TC, FBG, WHR, hypertension, history of heart diseases, and negative events may increase the risk of IS, with a trend for HDL to be a protective factor for IS. There were three genotypes of eNOS (4b/4b-wild type, 4a/4bmutant, 4a/4a-homozygous) in cases and controls (Supplementary Fig. 2). The genotypes in controls were in Hardy–Weinberg equilibrium (P N 0.05). With regard to genotype frequency, there was no significant association among patients and controls (P N 0.05), however the risk allele (4a) appeared to be at a risk threshold for IS (OR = 1.63, 95% CI: 0.93–2.88, P = 0.09). After adjustment for confounders, there was still no significant difference in carriage rate of VNTR among patients and controls (P N 0.05) [Table 1].
http://dx.doi.org/10.1016/j.ijcard.2014.04.147 0167-5273/© 2014 Elsevier Ireland Ltd. All rights reserved.
Please cite this article as: Tong Y, et al, Association of endothelial nitric oxide synthase gene mini-satellite marker VNTR polymorphism with ischemic stroke in the Chinese Uyghur population, Int J Cardiol (2014), http://dx.doi.org/10.1016/j.ijcard.2014.04.147
2
Y. Tong et al. / International Journal of Cardiology xxx (2014) xxx–xxx
Table 1 Association between eNOS 27 bp VNTR allele distribution and risk of IS between cases and controls for Chinese Uyghur population. Uyghur Cases (n = 100) eNOS 27 VNTR 4b/4b 4a/4b 4a/4a 4a/4b+4a/4a Alleles 4a 4b MAF
69 27 4 31
35 165 0.145
Controls (n = 100) 79 19 2 21
23 177 0.115
P value
Crude OR (95% CI)
P value
Adjusted ORa(95% CI)
0.15 0.34 0.11
1.00 1.63(0.83–3.18) 2.29(0.41–12.89) 1.69(0.89–3.21)
0.13 0.33 0.09
1.66(0.86–3.20) 2.30(0.41–12.90) 1.71(0.91–3.23)
0.09
1.63(0.93–2.88)
…
… …
MAF: Minor Allele Frequency. a Adjustment for hypertension, negative events, alcohol use, BMI and WHR.
Fig. 1A compares VNTR genotype frequency between patients and controls in Hans and Uyghurs. There were significant differences in VNTR heterozygous and 4b/4b homozygous frequency between patients in both ethnic groups. There were no significant differences in 4a/4a homozygous frequency (P = 0.22) between patients in both ethnic groups. Moreover, it is worth noting that the risk allele frequency for VNTR in Uyghurs was higher (0.15) than that observed previously in Hans (0.11) but in close proximity to American white populations (0.15). However, there were no significant differences in the carriagerate of three genotypes (P N 0.05) between controls in both ethnic groups.
An extended comparison among various populations was conducted, which may provide some insights into the relationship between VNTR and IS that is beyond what single population analysis can reveal. Based on the comparisons, there was a significant association between 4b/4b genotype and IS in Americans rather than Africans and Asians [5,7–9]. The pooling analyses yielded an overall ORs (4a/4b vs 4b4b) of 0.65 (95% CI, 0.46–0.92; P b 0.001) in Americans and an overall ORs of 0.88 (95% CI, 0.68–1.13; P N 0.05) in Africans as well as an overall ORs of 1.17 (95% CI, 0.85–1.68; P N 0.05) in Hans, respectively. The results in Uyghurs were different from either Han population or American/African populations. To test the potential effect of VNTR in IS, we reassessed a stratified analysis. After stratifying on gender, BMI, and hypertension status, associations between the VNTR and IS risk are shown in Supplementary Table 2. Stratified by gender, it is of interest to note that the individuals with 4a/4b+4a/4a genotypes may have a stronger trend to increase risk on IS for male as compared to female, and the OR is 2.20 (95% CI 0.96–5.01). For 4a allele, the OR is 1.96 (95% CI 0.94–4.09) for male and 1.23 (95% CI 0.50–3.03) for female. In the stratified analysis by hypertension, the 4a/4a genotype displays a higher risk trend for IS in the individuals with hypertension than in those without hypertension. All these interesting findings suggest that there may be genetic variations among Hans and Uyghurs as well as other populations that may affect the risk of IS. Taken together, our data suggests that TC, FBG, WHR, hypertension, history of heart diseases, and negative events may increase the risk of IS in Uyghurs like European ancestry and East Asian population. In addition, we provide a sensitive tailed primer protocol to identify the VNTR polymorphism and found that VNTR polymorphism maybe not an independent risk of IS in Chinese Uyghurs, which was consistent with the meta-analysis in Asians rather than American/African population. However, our findings lend support to the notion of a strong risk tendency toward a higher prevalence of genotype eNOS*4a4a and eNOS*4a allele in male population with IS. Further explorations with larger, ethnically diverse population in the world are needed to better shed light on the association with VNTR and IS, as well as the complicated role of endothelial dysfunction in IS precisely.
Acknowledgments This study was supported by funds (No. 81302497) from National Natural Science Foundation of China and a grant (No. 2013CFB056) from Hubei.
Fig. 1. A. The comparisons of eNOS VNTR 4a/4b genotype frequency distributions between cases and controls, respectively, among Han and Uyghur population. B. Forest plot for the associations between eNOS VNTR polymorphism and IS in various ethnic populations. a: 4a/4b vs 4b4b, b:4a/4b+4a/4a vs 4b/4b.
Appendix A. Supplementary data Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.ijcard.2014.04.147.
Please cite this article as: Tong Y, et al, Association of endothelial nitric oxide synthase gene mini-satellite marker VNTR polymorphism with ischemic stroke in the Chinese Uyghur population, Int J Cardiol (2014), http://dx.doi.org/10.1016/j.ijcard.2014.04.147
Y. Tong et al. / International Journal of Cardiology xxx (2014) xxx–xxx
References [1] Wang XL, Mahaney MC, Sim AS, et al. Genetic contribution of the endothelial constitutive nitric oxide synthase gene to plasma nitric oxide levels. Arterioscler Thromb Vasc Biol 1997;17:3147–53. [2] Goette A, Hammwohner M, Bukowska A, et al. The impact of rapid atrial pacing on ADMA and endothelial NOS. Int J Cardiol 2012;154:141–6. [3] Fantinelli JC, Perez Nunez IA, Gonzalez Arbelaez LF, et al. Participation of mitochondrial permeability transition pore in the effects of ischemic preconditioning in hypertrophied hearts: role of NO and mitoKATP. Int J Cardiol 2013;166:173–80. [4] Pierrakos CN, Tsolakis EJ, Pozios IA, et al. Effects of L-name on coronary blood flow, infarct size and the extent of the no-reflow phenomenon. Int J Cardiol 2013;167:3000–5.
3
[5] Munshi A, Rajeshwar K, Kaul S, et al. VNTR polymorphism in intron 4 of the eNOS gene and the risk of ischemic stroke in a South Indian population. Brain Res Bull 2010;82:247–50. [6] Xu S, Huang W, Qian J, Jin L. Analysis of genomic admixture in Uyghur and its implication in mapping strategy. Am J Hum Genet 2008;82:883–94. [7] Jara-Prado A, Alonso ME, Martinez Ruano L, et al. MTHFR C677T, FII G20210A, FV Leiden G1691A, NOS3 intron 4 VNTR, and APOE epsilon4 gene polymorphisms are not associated with spontaneous cervical artery dissection. Int J Stroke 2010;5:80–5. [8] Majumdar V, Nagaraja D, Karthik N, Christopher R. Association of endothelial nitric oxide synthase gene polymorphisms with early-onset ischemic stroke in South Indians. J Atheroscler Thromb 2010;17:45–53. [9] Hou L, Osei-Hyiaman D, Yu H, et al. Association of a 27-bp repeat polymorphism in ecNOS gene with ischemic stroke in Chinese patients. Neurology 2001;56:490–6.
Please cite this article as: Tong Y, et al, Association of endothelial nitric oxide synthase gene mini-satellite marker VNTR polymorphism with ischemic stroke in the Chinese Uyghur population, Int J Cardiol (2014), http://dx.doi.org/10.1016/j.ijcard.2014.04.147
Contents lists available at ScienceDirect
International Journal of Cardiology journal homepage: www.elsevier.com/locate/ijcard
Letter to the Editor
Association of endothelial nitric oxide synthase gene mini-satellite marker VNTR polymorphism with ischemic stroke in the Chinese Uyghur population Yeqing Tong a,b,c,1, Yanwei Zhang c,1, Faxian Zhan b,1, Zhihong Wang a,1, Xu-hua Guan b, Jianping Liu c, Xiaoxv Yin a, Yijie Geng c, Jian-jun Ye b, Shuang-yi Hou b, Jiafa Liu b,⁎, Zuxun Lu a,⁎⁎, Jin-quan Cheng c,⁎⁎⁎ a b c
School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430030, PR China Hubei Center for Disease Control and Prevention, Wuhan 430079, PR China Key Laboratory of Molecular Biology of Guangdong Province, Shenzhen Center for Disease Control and Prevention, Shenzhen 518020, PR China
a r t i c l e
i n f o
Article history: Received 10 April 2014 Accepted 12 April 2014 Available online xxxx Keywords: High capillary electrophoresis eNOS Variable number of tandem repeat Ischemic stroke Uyghurs
The eNOS gene is located on 7q35–36 and comprises 26 exons spanning 21 kb. Toward 5-flanking region, the 27-bp variable number of tandem repeat (VNTR) polymorphism (4a/4b) within intron 4 [Supplementary Fig. 1] is associated with alterations in promoter activity and altered plasma NO concentrations and has been reported to be implicated in the development of ischemic stroke (IS) [1–4]. It was proposed that VNTR polymorphism was associated with IS in Americans [5]. However, the validity of the association remained controversial. The Uyghur population, a minority group confirmed from Turkish nomads with 60% European ancestry and 40% East Asian ancestry living in Xinjiang which has its own language, religious beliefs and lifestyles, may be very different from either Han population or American/ European populations [6]. Our aim was to determine whether the VNTRs have functional influence on IS in this unique population using a tailed primer protocol and to procure wider genetic inferences of
⁎ Corresponding author. Fax: + 86 27 87652049. ⁎⁎ Corresponding author. Fax: + 86 27 83693756. ⁎⁎⁎ Corresponding author. Fax: + 86 755 25626488. E-mail addresses: [email protected] (J. Liu), [email protected] (Z. Lu), [email protected] (J. Cheng). 1 These authors have equally contributed to this work.
locus effects across Caucasians and Blacks with different geographic origins and lifestyles. The study patients were enrolled among the inpatients attending the Stroke Unit of two Xinjiang hospitals consecutively. Due to religious belief and harsh medical environment as well as the living environment in which this ethnic group is clustered, the collection of blood sample was extremely difficult. All subjects were provided written informed consents as IJC. A total of 100 typical Uyghur IS subjects were enrolled into the case–control study. The diagnosis of IS was established according to TOAST classification. All stroke cases were first-ever IS determined by CT or MRI. Concurrently, 100 age, gender and ethnically-matched normal healthy controls were randomly collected. Subjects with history of stroke, Alzheimer's disease, brain aneurysm, and Parkinson's disease were excluded from controls. An epidemiological investigation was performed with a standardized questionnaire to record epidemiological features. The VNTR amplification was performed with three primers: Forward primer CACGACGTTGTAAAACGACAGGCCCTATGGTAGTGCCTTT (F) with a M13 universal tail, Reverse primer TCTCTTAGTGCTGTGGTCAC (R), and the third primer labeled with cy5 dye (Cy5-CACGACGTTGTAAAACGAC). The final products contained the fluorescence dye that can be detected by the Beckman-Coulter Genetic Analysis System. Alleles were identified by high performance capillary electrophoresis with GenomeLab Separation Gel and a DNA size kit-600 (Beckman Coulter, USA) on CEQ 8800 Genetic Analysis System. OR at 95% CI was determined to describe the strength of association by multivariate logistic regression model. The characteristics of patients and controls were summarized in Supplementary Table 1. TC, FBG, WHR, hypertension, history of heart diseases, and negative events may increase the risk of IS, with a trend for HDL to be a protective factor for IS. There were three genotypes of eNOS (4b/4b-wild type, 4a/4bmutant, 4a/4a-homozygous) in cases and controls (Supplementary Fig. 2). The genotypes in controls were in Hardy–Weinberg equilibrium (P N 0.05). With regard to genotype frequency, there was no significant association among patients and controls (P N 0.05), however the risk allele (4a) appeared to be at a risk threshold for IS (OR = 1.63, 95% CI: 0.93–2.88, P = 0.09). After adjustment for confounders, there was still no significant difference in carriage rate of VNTR among patients and controls (P N 0.05) [Table 1].
http://dx.doi.org/10.1016/j.ijcard.2014.04.147 0167-5273/© 2014 Elsevier Ireland Ltd. All rights reserved.
Please cite this article as: Tong Y, et al, Association of endothelial nitric oxide synthase gene mini-satellite marker VNTR polymorphism with ischemic stroke in the Chinese Uyghur population, Int J Cardiol (2014), http://dx.doi.org/10.1016/j.ijcard.2014.04.147
2
Y. Tong et al. / International Journal of Cardiology xxx (2014) xxx–xxx
Table 1 Association between eNOS 27 bp VNTR allele distribution and risk of IS between cases and controls for Chinese Uyghur population. Uyghur Cases (n = 100) eNOS 27 VNTR 4b/4b 4a/4b 4a/4a 4a/4b+4a/4a Alleles 4a 4b MAF
69 27 4 31
35 165 0.145
Controls (n = 100) 79 19 2 21
23 177 0.115
P value
Crude OR (95% CI)
P value
Adjusted ORa(95% CI)
0.15 0.34 0.11
1.00 1.63(0.83–3.18) 2.29(0.41–12.89) 1.69(0.89–3.21)
0.13 0.33 0.09
1.66(0.86–3.20) 2.30(0.41–12.90) 1.71(0.91–3.23)
0.09
1.63(0.93–2.88)
…
… …
MAF: Minor Allele Frequency. a Adjustment for hypertension, negative events, alcohol use, BMI and WHR.
Fig. 1A compares VNTR genotype frequency between patients and controls in Hans and Uyghurs. There were significant differences in VNTR heterozygous and 4b/4b homozygous frequency between patients in both ethnic groups. There were no significant differences in 4a/4a homozygous frequency (P = 0.22) between patients in both ethnic groups. Moreover, it is worth noting that the risk allele frequency for VNTR in Uyghurs was higher (0.15) than that observed previously in Hans (0.11) but in close proximity to American white populations (0.15). However, there were no significant differences in the carriagerate of three genotypes (P N 0.05) between controls in both ethnic groups.
An extended comparison among various populations was conducted, which may provide some insights into the relationship between VNTR and IS that is beyond what single population analysis can reveal. Based on the comparisons, there was a significant association between 4b/4b genotype and IS in Americans rather than Africans and Asians [5,7–9]. The pooling analyses yielded an overall ORs (4a/4b vs 4b4b) of 0.65 (95% CI, 0.46–0.92; P b 0.001) in Americans and an overall ORs of 0.88 (95% CI, 0.68–1.13; P N 0.05) in Africans as well as an overall ORs of 1.17 (95% CI, 0.85–1.68; P N 0.05) in Hans, respectively. The results in Uyghurs were different from either Han population or American/African populations. To test the potential effect of VNTR in IS, we reassessed a stratified analysis. After stratifying on gender, BMI, and hypertension status, associations between the VNTR and IS risk are shown in Supplementary Table 2. Stratified by gender, it is of interest to note that the individuals with 4a/4b+4a/4a genotypes may have a stronger trend to increase risk on IS for male as compared to female, and the OR is 2.20 (95% CI 0.96–5.01). For 4a allele, the OR is 1.96 (95% CI 0.94–4.09) for male and 1.23 (95% CI 0.50–3.03) for female. In the stratified analysis by hypertension, the 4a/4a genotype displays a higher risk trend for IS in the individuals with hypertension than in those without hypertension. All these interesting findings suggest that there may be genetic variations among Hans and Uyghurs as well as other populations that may affect the risk of IS. Taken together, our data suggests that TC, FBG, WHR, hypertension, history of heart diseases, and negative events may increase the risk of IS in Uyghurs like European ancestry and East Asian population. In addition, we provide a sensitive tailed primer protocol to identify the VNTR polymorphism and found that VNTR polymorphism maybe not an independent risk of IS in Chinese Uyghurs, which was consistent with the meta-analysis in Asians rather than American/African population. However, our findings lend support to the notion of a strong risk tendency toward a higher prevalence of genotype eNOS*4a4a and eNOS*4a allele in male population with IS. Further explorations with larger, ethnically diverse population in the world are needed to better shed light on the association with VNTR and IS, as well as the complicated role of endothelial dysfunction in IS precisely.
Acknowledgments This study was supported by funds (No. 81302497) from National Natural Science Foundation of China and a grant (No. 2013CFB056) from Hubei.
Fig. 1. A. The comparisons of eNOS VNTR 4a/4b genotype frequency distributions between cases and controls, respectively, among Han and Uyghur population. B. Forest plot for the associations between eNOS VNTR polymorphism and IS in various ethnic populations. a: 4a/4b vs 4b4b, b:4a/4b+4a/4a vs 4b/4b.
Appendix A. Supplementary data Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.ijcard.2014.04.147.
Please cite this article as: Tong Y, et al, Association of endothelial nitric oxide synthase gene mini-satellite marker VNTR polymorphism with ischemic stroke in the Chinese Uyghur population, Int J Cardiol (2014), http://dx.doi.org/10.1016/j.ijcard.2014.04.147
Y. Tong et al. / International Journal of Cardiology xxx (2014) xxx–xxx
References [1] Wang XL, Mahaney MC, Sim AS, et al. Genetic contribution of the endothelial constitutive nitric oxide synthase gene to plasma nitric oxide levels. Arterioscler Thromb Vasc Biol 1997;17:3147–53. [2] Goette A, Hammwohner M, Bukowska A, et al. The impact of rapid atrial pacing on ADMA and endothelial NOS. Int J Cardiol 2012;154:141–6. [3] Fantinelli JC, Perez Nunez IA, Gonzalez Arbelaez LF, et al. Participation of mitochondrial permeability transition pore in the effects of ischemic preconditioning in hypertrophied hearts: role of NO and mitoKATP. Int J Cardiol 2013;166:173–80. [4] Pierrakos CN, Tsolakis EJ, Pozios IA, et al. Effects of L-name on coronary blood flow, infarct size and the extent of the no-reflow phenomenon. Int J Cardiol 2013;167:3000–5.
3
[5] Munshi A, Rajeshwar K, Kaul S, et al. VNTR polymorphism in intron 4 of the eNOS gene and the risk of ischemic stroke in a South Indian population. Brain Res Bull 2010;82:247–50. [6] Xu S, Huang W, Qian J, Jin L. Analysis of genomic admixture in Uyghur and its implication in mapping strategy. Am J Hum Genet 2008;82:883–94. [7] Jara-Prado A, Alonso ME, Martinez Ruano L, et al. MTHFR C677T, FII G20210A, FV Leiden G1691A, NOS3 intron 4 VNTR, and APOE epsilon4 gene polymorphisms are not associated with spontaneous cervical artery dissection. Int J Stroke 2010;5:80–5. [8] Majumdar V, Nagaraja D, Karthik N, Christopher R. Association of endothelial nitric oxide synthase gene polymorphisms with early-onset ischemic stroke in South Indians. J Atheroscler Thromb 2010;17:45–53. [9] Hou L, Osei-Hyiaman D, Yu H, et al. Association of a 27-bp repeat polymorphism in ecNOS gene with ischemic stroke in Chinese patients. Neurology 2001;56:490–6.
Please cite this article as: Tong Y, et al, Association of endothelial nitric oxide synthase gene mini-satellite marker VNTR polymorphism with ischemic stroke in the Chinese Uyghur population, Int J Cardiol (2014), http://dx.doi.org/10.1016/j.ijcard.2014.04.147
