International Journal of Neuroscience, 2014; Early Online: 1–4 Copyright © 2014 Informa Healthcare USA, Inc. ISSN: 0020-7454 print / 1543-5245 online DOI: 10.3109/00207454.2014.894044
ORIGINAL ARTICLE
Association of IL-23 and its receptor gene single-nucleotide polymorphisms with multiple sclerosis in Chinese southern population Int J Neurosci Downloaded from informahealthcare.com by Kungliga Tekniska Hogskolan on 10/09/14 For personal use only.
Meng Liu,1 Xueqiang Hu,2 Yuge Wang,2 Xiaohong Chen,2 and Jian Wu1 1
Department of Neurology, The Third Affiliated Hospital of Soochow University, Changzhou, China; and 2 Department of Neurology, The Third Affiliated Hospital of Sun Yat-sen University, Guangzhou, China The subunit of IL-23 (IL12B) and its receptor (IL23R) gene single-nucleotide polymorphisms (SNPs) have been shown to be associated with several autoimmune diseases such as inflammatory bowel disease, psoriasis and ankylosing spondylitis. However, the association studies between multiple sclerosis (MS) and SNPs of IL12B or IL23R gene have been reported with inconsistent results in Caucasian population. These discrepancies prompted us to investigate whether IL12B and IL23R variants are associated with susceptibility to MS in Chinese southern population. In this study, we investigated four SNPs (rs2201841, rs10889677, rs7517847 in IL23R and rs3212227 in IL12B) in 178 MS patients and 221 health controls in southern China using the polymerase chain reactionrestriction fragment length polymorphism (PCR-RFLP) method. There was no difference of genotype or allele distribution of these SNPs between MS patients and controls. No association was found between gene polymorphisms and clinical characteristics in MS patients. Furthermore, haplotypes analysis showed similar distribution of haplotype frequencies in MS patients and controls. Our study showed that the IL12B and IL23R gene SNPs does not seem to be associated with MS susceptibility in Chinese southern population. KEYWORDS: multiple sclerosis, IL23R, single-nucleotide polymorphisms, gene
Introduction Multiple sclerosis (MS) is an inflammatory demyelinating disease of the central nervous system. Although the precise etiology of MS remains to be elucidated, it is widely accepted that MS is an autoimmune process modulated by both genetic and environmental factors, and T-cell-mediated immunity plays a central role in the pathogenesis of MS [1]. Cytokines and their receptors play a pivotal role in shaping the autoimmune response by inducing the differentiation of na¨ıve CD4+ T cells into helper T (Th) cells. IL-23 is an essential inflammatory cytokine in the regulation of a newly defined T-cell subset, Th17 cells, which express high levels of the pro-inflammatory cytokine IL-17 in response to inflammation stimulation [2]. The IL-23/Th17 axis has been shown to be crucially Received 24 November 2013; accepted 10 February 2014 Correspondence: Xueqiang Hu, Department of Neurology, The Third Affiliated Hospital of Sun Yat-sen University, Guangzhou, China. E-mail: [email protected]
involved in the pathogenesis of various human immunemediated diseases including MS [3]. Via the involvement of IL-23 and its receptor, Th17 cells have been implicated in the pathology of a number of autoimmune diseases in murine models, including the experimental autoimmune encephalomyelitis model of MS. On the genetic level, IL-23 shares a common p40 subunit (IL12B) with IL-12, while IL-23 binds with a complex receptor that consists of IL23R and IL12Rβ1 [4]. Recently, the single-nucleotide polymorphisms (SNPs) within the IL12B and IL23R gene have been reported to be associated with autoimmune diseases such as IBD [5,6], psoriasis [7,8] and ankylosing spondylitis [9,10]. Given the hypothesis that autoimmune diseases may share a common background of genetic risk, a lot of studies have already been launched aiming at the association between IL12B/IL23R gene variants and MS [11–18]. However, the results for the association between IL12B/IL23R SNPs and MS of published articles were contradictive. These data mainly come from Caucasian population of European descent. To date, the association of IL12B and IL23R gene SNPs with 1
2
M. Liu et al.
Table 1. Characteristics of patients with MS and healthy controls.
Int J Neurosci Downloaded from informahealthcare.com by Kungliga Tekniska Hogskolan on 10/09/14 For personal use only.
Gender (female/male) Age (years) Age at onset (years) Disease duration (years) EDSS
MS patients (n = 178)
Controls (n = 221)
62/116 36.68 ± 8.02 30.59 ± 7.74 6.30 ± 3.96 4.25 ± 1.81
76/145 35.09 ± 10.53 – – –
MS risk in Chinese population remains unclear. In this study, we selected four representative variants of IL12B and IL23R gene to investigate whether these SNPs were related to MS susceptibility in the southern of China.
Methods and subjects Subjects A total of 178 unrelated patients aged from 18 to 62 years old, with clinically defined MS diagnosed according to the McDonald criteria [19], were enrolled in this study. Patients were recruited from the Department of Neurology, the Third Affiliated Hospital of Sun Yat-sen University (Guangzhou, Guangdong Province, China) and the Third Affiliated Hospital of Soochow University (Changzhou, Jiangsu Province, China). Disability was assessed using Expanded Disability Status Scale (EDSS) [20]. The age of onset and disease duration from clinical onset to last clinical assessment was also recorded. The control group consisted of 221 healthy controls (20–65 years old) with no personal history of inflammatory or autoimmune diseases. All the subjects were Han Chinese, coming from the same region of southern China. There was no significant difference in the age and the sex distributions between the two groups. The study was approved by the local ethic committee of both hospitals, and informed consents from all participants were obtained before sample collection. The demographics and clinical characteristics of study population were presented in Table 1. Table 2.
SNP genotyping of IL23R Genomic DNA was isolated from peripheral blood leukocytes using a standard phenol–chloroform protocol. SNPs of the IL23R gene (rs10889677, rs2201841 and rs7517847) and IL12B gene (rs3212227) were genotyped by the previously described RFLP-PCR method with minor modifications [16,21]. Details on PCR conditions, primers and restriction enzymes are given in Table 2. The digested products were then bands visualized on 3% ethidium bromide-stained agarose gels.
Statistical analysis Results are expressed as mean ± SD or percentage. Statistical analysis was performed using SPSS version 15.0 for Windows. The Hardy–Weinberg equilibrium (HWE) was tested for both SNPs in the cases and the controls. For calculation of the significance of differences in genotype and allele frequencies, χ 2 test or Fisher’s exact test was used, and for comparisons of the differences between mean values of two groups, unpaired Student’s t-test was used. The linkage disequilibrium and haplotype analysis was performed using online software SHEsis (http://analysis2.biox.cn/myAnalysis.php). For all statistical tests, p values were two-sided, and p < 0.05 was considered statistically significant.
Results For genotyping, 175 samples from patients and 217 healthy controls for rs2201841 SNPs were determined, 171 samples from patients and 213 samples from controls for rs10889677 were performed, while 172 samples and 215 samples from controls for rs7517847 were determined. 177 samples from patients and 218 samples from controls for rs3212227 were performed. The distribution of genotypes and alleles of all above polymorphic variants was presented in Table 3. There was no significant deviation from the HWE (p > 0.05) in all cases. There were no statistically significant
Primer sequences, product lengths, restriction enzymes and genotype for IL12B and IL23R gene polymorphisms.
SNP ID rs3212227 rs2201841 rs10889677 rs7517847
Primers sequence TTCTATCTGATTTGCTTTA TGAAACATTCCATACATCC GGCAAAAGGGAATTGAGAGG GGCCTATGATTATGCTTTTTCCTG ATCGTGAATGAGGAGTTGCC TGTGCCTGTATGTGTGACCA ACCTTGGCAGTCTTCATCC CTCCAGTTTCTAGCCTACATACA
Annealing temperature
Products
Restriction enzymes
43
233bp
TaqI
AA AC CC
55
188bp
HpyF3I
TT TC TC
56
216bp
MnlI
AA AC CC
57
272bp
HpyF3I
GG GT TT
Genotype
International Journal of Neuroscience
IL-23 and its receptor polymorphisms with multiple sclerosis Table 3.
Genotype and allele frequencies in MS patients and healthy subjects. Genotypes
Int J Neurosci Downloaded from informahealthcare.com by Kungliga Tekniska Hogskolan on 10/09/14 For personal use only.
rs2201841 MS (175) Controls (217) rs10889677 MS (171) Controls (213) rs7517847 MS (172) Controls (215) rs3212227 MS (177) Controls (218)
Alleles
CC
TC
TT
85(48.6%) 112(51.6%) AA 89(52%) 123(57.7%) GG 29(16.9%) 31(14.4%) AA 63(35.6%) 70(32.1%)
80(45.7%) 89(41%) AC 73(42.7%) 77(36.2%) GT 89(51.7%) 106(49.3%) AC 82(46.3%) 101(41.3%)
10(5.7%) 16(7.4%) CC 9(5.3%) 13(6.1%) TT 54(31.4%) 78(36.3%) CC 32(18.1%) 47(21.6%)
differences in the distributions of the genotype and allele frequencies between patients and controls (p > 0.05). Similarly, there were no differences within allele or genotype distribution between MS men and women, the same as between the same sex comparing MS patients and controls (data not shown). In addition, available clinical features of MS patients were analyzed for possible association with the different genotypes of IL23R or IL12B polymorphisms. No significant differences were observed between these genetic variants and the following variables: age at onset, duration and EDSS (data not shown). Linkage disequilibrium was observed between rs2201841 and rs10889677 [−D |=0.614, r2 = 0.327]. Haplotype analyses were performed and the possible haplotype frequencies are shown in Table 4. Haplotype frequencies of the IL23R gene in MS patients were not significantly different from that in healthy controls (p > 0.05).
Discussion The fact that non-major-histocompatibility-complex (non-MHC) genes contributing a large part besides HLA-DRB1∗1501 to the susceptibility to MS [22] has prompted numerous efforts to identify new susceptibility genes in recent years. Because of its proinflammatory and immunoregulatory activities, IL-23 and its receptor might be major susceptibility genes for Table 4. Haplotypes of IL23R gene in the MS patients and controls. Combination of haplotypes CA CC TA TC C
3
Frequency MS patients
Control
p
216.8(64%) 24.72(7.3%) 30.72(9.1%) 66.28(19.6%)
277.79(66.1%) 28.21(6.7%) 43.21(10.3%) 70.79(16.9%)
0.382 0.102 0.306 0.96
2014 Informa Healthcare USA, Inc.
p 0.58
0.425
0.563
0.624
C
T
p
250(78.4%) 313(72.9%) A 251(73.4%) 323(75.8%) G 147(42.7%) 168(39.1%) A 208(58.8%) 241(55.3%)
100(28.6%) 121(27.9%) C 91(26.6%) 103(24.2%) T 197(57.3%) 262(60.9%) C 146(41.2%) 195(44.7%)
0.83
0.441
0.303
0.326
T-cell-mediated autoimmune diseases. Actually, numerous studies have identified a set of SNPs in IL23R and IL12B gene that are associated with susceptibility to autoimmune disorders such as IBD, ankylosing spondylitis and psoriasis in different ethnic population. These discoveries highlight the genetic relevance of IL-23 and its receptor in human autoimmune diseases. Based on the hypothesis that autoimmune diseases may share a common background of genetic risk, IL12B and IL23R appeared to be also probably associated with MS. Although SNPs in IL12B [11,12] and IL23R [13,14] gene have been reported the presence of association with the susceptibility to MS, the other studies [15–18] did not confirm these findings. Recent genome-wide association study (GWAS) also found no association between IL23R variants and MS in Caucasian population from North America and the United Kingdom [23]. It has been confirmed no SNPs of IL23R gene were associated with MS in Caucasian population, but a distinct ethnic background may play a role in the differences of genetic studies. Therefore, it is necessary to investigate the possible role of IL23R gene to MS in population with a different ethnicity. For this purpose, we undertook this case–control study to investigate the association between MS and polymorphisms in IL12B and IL23R in a Han Chinese population. In this study, four SNPs (rs10889677, rs2201841 and rs7517841 of IL23R and rs3212227 of IL12B gene) mentioned with susceptibility to MS in previous studies were selected for association analysis in Chinese population. To the best of our knowledge, this is the first report about the association between IL12B and IL23R gene SNPs and MS susceptibility in Chinese population. However, our study did not find any differences of these SNPs tested between MS patients and controls in southern China. Furthermore, no association was observed between these polymorphisms and duration, EDSS and age of disease onset. Our study showed that these SNPs were not associated with MS in Chinese southern population.
Int J Neurosci Downloaded from informahealthcare.com by Kungliga Tekniska Hogskolan on 10/09/14 For personal use only.
4
M. Liu et al.
However, the size of patient samples in our study was relatively small and the patients were only recruited from the Chinese southern region. The results observed in this study need to be confirmed in large samples and in population from other regions of China. Furthermore, we cannot exclude the possibility that other variants of IL23R or IL12B gene might play a role in MS susceptibility in Chinese population. Finally, with the development of GWAS, two SNPs related to IL-12 gene have been identified to be associated with MS susceptibility recently [24,25]. These findings implied that there is still association between the IL-23/Th17 pathway and the susceptibility to MS. Additional research is necessary to explore the relationship between MS and other genes belonged to IL-23/Th17 pathway.
Conclusion Within the limitations of ethnicity, variants selection and sample number in this study, our study did not demonstrate any association between the tested SNPs in IL23R and IL12B gene with MS in Chinese southern population. Further genetic studies including more SNPs and a larger Chinese population samples are required to elucidate the association between IL23R/IL12B gene and MS.
Declaration of Interest The authors report no conflicts of interest. The authors alone are responsible for the content and writing of this paper.
Acknowledgements The authors thank Dr. Ning Wei for kind advice and Dr. Bin Zhang and Wenxia You for their assistance with sample supply and DNA extraction.
References 1. Noseworthy JH, Lucchinetti C, Rodriguez M, et al. Multiple sclerosis. N Engl J Med 2000;343:938–52. 2. Tan ZY, Bealgey KW, Fang Y, et al. Interleukin-23: immunological roles and clinical implications. Int J Biochem Cell Biol 2009;41:733–5. 3. Iwakura Y, Ishigame H. The IL-23/IL-17 axis in inflammation. J Clin Invest 2006;116:1218–22. 4. Parham C, Chirica M, Timans J, et al. A receptor for the heterodimeric cytokine IL-23 is composed of IL-12Rbeta1 and a novel cytokine receptor subunit, IL-23R. J Immunol 2002; 168:5699–708. 5. Duerr RH, Taylor KD, Brant SR, et al. A genome-wide association study identifies IL23R as an inflammatory bowel disease gene. Science 2006;314:1461–3.
6. Glas J, Seiderer J, Wagner J, et al. Analysis of IL12B gene variants in inflammatory bowel disease. PLoS One 2012;7:e34349. 7. Cargill M, Schrodi SJ, Chang M, et al. A large-scale genetic association study confirms IL12B and leads to the identification of IL23R as psoriasis-risk genes. Am J Hum Genet 2007; 80:273–90. 8. Capon F, Di Meglio P, Szaub J, et al. Sequence variants in the genes for the interleukin-23 receptor (IL23R) and its ligand (IL12B) confer protection against psoriasis. Hum Genet 2007;122:201–206. 9. Karaderi T, Harvey D, Farrar C, et al. Association between the interleukin 23 receptor and ankylosing spondylitis is confirmed by a new UK case-control study and meta-analysis of published series. Rheumatology (Oxford) 2009;48:386–9. 10. Wong RH, Wei JC, Huang CH, et al. Association of IL-12B genetic polymorphism with the susceptibility and disease severity of ankylosing spondylitis. J Rheumatol 2012;39:135–40. 11. van Veen T, Crusius JBA, Schrijver HM, et al. Interleukin12p40 genotype plays a role in the susceptibility to multiple sclerosis. Ann Neurol 2001;50:275. 12. Alloza I, Heggarty S, Goris A, et al. Interleukin-12 p40 polymorphism and susceptibility to multiple sclerosis. Ann Neurol 2002;52:524–5. 13. Illes Z, Safrany E, Peterfalvi A, et al. 3’UTR C2370A allele of the IL-23 receptor gene is associated with relapsing-remitting multiple sclerosis. Neurosci Lett 2008;431:36–8. ˜ C, Dema B, C´enit MC, et al. IL23R: a susceptibility 14. Nu´ nez locus for celiac disease and multiple sclerosis? Genes Immun. 2008; 9:289–93. 15. Roos IM, Kockum I, Hillert J. The interleukin 23 receptor gene in multiple sclerosis: a case-control study. J Neuroimmunol 2008;194:173–80. 16. Hall MA, McGlinn E, Coakley G, et al. Genetic polymorphism of IL-12 p40 gene in immune-mediated disease. Genes Immun 2000;1:219–24. 17. Begovich AB, Chang M, Caillier SJ, et al. The autoimmune disease-associated IL12B and IL23R polymorphisms in multiple sclerosis. Hum Immunol 2007;68:934–7. 18. Forte GI, Ragonese P, Salemi G, et al. Search for genetic factors associated with susceptibility to multiple sclerosis. Ann N Y Acad Sci 2006;1067:264–9. 19. McDonald WI, Compston A, Edan G, et al. Recommended diagnostic criteria for multiple sclerosis: guidelines from the International Panel on the diagnosis of multiple sclerosis. Ann Neurol 2001;50:121–7. 20. Kurtzke JF. Rating neurologic impairment in multiple sclerosis: an expanded disability status scale (EDSS). Neurology 1983;33:1444–52. 21. Huber AK, Jacobson EM, Jazdzewski K, et al. Interleukin(IL)-23 receptor is a major susceptibility gene for Graves’ophthalmopathy: the IL-23/T-helper 17 axis extends to thyroid autoimmunity. J Clin Endocrinol Metab 2008;93:1077–81. 22. Lincoln MR, Montpetit A, Cader MZ, et al. A predominant role for the HLA class II region in the association of the MHC region with multiple sclerosis. Nat Genet 2005;37:1108–12. 23. Burton PR, Clayton DG, Cardon LR, et al. Association scan of 14,500 nonsynonymous SNPs in four diseases identifies autoimmunity variants. Nat Genet 2007;39:1329–37. 24. International Multiple Sclerosis Genetics Conssortium (IMSGC). IL12A, PHOSPH9/CDK2AP1 and RGS1 are novel multiple sclerosis susceptibility loci. Genes Immun 2010;11:397–405. 25. Sawcer S, Hellenthal G, Pirinen M, et al. Genetic risk and a primary role for cell-mediated immune mechanisms in multiple sclerosis. Nature 2011;476:214–9.
International Journal of Neuroscience
ORIGINAL ARTICLE
Association of IL-23 and its receptor gene single-nucleotide polymorphisms with multiple sclerosis in Chinese southern population Int J Neurosci Downloaded from informahealthcare.com by Kungliga Tekniska Hogskolan on 10/09/14 For personal use only.
Meng Liu,1 Xueqiang Hu,2 Yuge Wang,2 Xiaohong Chen,2 and Jian Wu1 1
Department of Neurology, The Third Affiliated Hospital of Soochow University, Changzhou, China; and 2 Department of Neurology, The Third Affiliated Hospital of Sun Yat-sen University, Guangzhou, China The subunit of IL-23 (IL12B) and its receptor (IL23R) gene single-nucleotide polymorphisms (SNPs) have been shown to be associated with several autoimmune diseases such as inflammatory bowel disease, psoriasis and ankylosing spondylitis. However, the association studies between multiple sclerosis (MS) and SNPs of IL12B or IL23R gene have been reported with inconsistent results in Caucasian population. These discrepancies prompted us to investigate whether IL12B and IL23R variants are associated with susceptibility to MS in Chinese southern population. In this study, we investigated four SNPs (rs2201841, rs10889677, rs7517847 in IL23R and rs3212227 in IL12B) in 178 MS patients and 221 health controls in southern China using the polymerase chain reactionrestriction fragment length polymorphism (PCR-RFLP) method. There was no difference of genotype or allele distribution of these SNPs between MS patients and controls. No association was found between gene polymorphisms and clinical characteristics in MS patients. Furthermore, haplotypes analysis showed similar distribution of haplotype frequencies in MS patients and controls. Our study showed that the IL12B and IL23R gene SNPs does not seem to be associated with MS susceptibility in Chinese southern population. KEYWORDS: multiple sclerosis, IL23R, single-nucleotide polymorphisms, gene
Introduction Multiple sclerosis (MS) is an inflammatory demyelinating disease of the central nervous system. Although the precise etiology of MS remains to be elucidated, it is widely accepted that MS is an autoimmune process modulated by both genetic and environmental factors, and T-cell-mediated immunity plays a central role in the pathogenesis of MS [1]. Cytokines and their receptors play a pivotal role in shaping the autoimmune response by inducing the differentiation of na¨ıve CD4+ T cells into helper T (Th) cells. IL-23 is an essential inflammatory cytokine in the regulation of a newly defined T-cell subset, Th17 cells, which express high levels of the pro-inflammatory cytokine IL-17 in response to inflammation stimulation [2]. The IL-23/Th17 axis has been shown to be crucially Received 24 November 2013; accepted 10 February 2014 Correspondence: Xueqiang Hu, Department of Neurology, The Third Affiliated Hospital of Sun Yat-sen University, Guangzhou, China. E-mail: [email protected]
involved in the pathogenesis of various human immunemediated diseases including MS [3]. Via the involvement of IL-23 and its receptor, Th17 cells have been implicated in the pathology of a number of autoimmune diseases in murine models, including the experimental autoimmune encephalomyelitis model of MS. On the genetic level, IL-23 shares a common p40 subunit (IL12B) with IL-12, while IL-23 binds with a complex receptor that consists of IL23R and IL12Rβ1 [4]. Recently, the single-nucleotide polymorphisms (SNPs) within the IL12B and IL23R gene have been reported to be associated with autoimmune diseases such as IBD [5,6], psoriasis [7,8] and ankylosing spondylitis [9,10]. Given the hypothesis that autoimmune diseases may share a common background of genetic risk, a lot of studies have already been launched aiming at the association between IL12B/IL23R gene variants and MS [11–18]. However, the results for the association between IL12B/IL23R SNPs and MS of published articles were contradictive. These data mainly come from Caucasian population of European descent. To date, the association of IL12B and IL23R gene SNPs with 1
2
M. Liu et al.
Table 1. Characteristics of patients with MS and healthy controls.
Int J Neurosci Downloaded from informahealthcare.com by Kungliga Tekniska Hogskolan on 10/09/14 For personal use only.
Gender (female/male) Age (years) Age at onset (years) Disease duration (years) EDSS
MS patients (n = 178)
Controls (n = 221)
62/116 36.68 ± 8.02 30.59 ± 7.74 6.30 ± 3.96 4.25 ± 1.81
76/145 35.09 ± 10.53 – – –
MS risk in Chinese population remains unclear. In this study, we selected four representative variants of IL12B and IL23R gene to investigate whether these SNPs were related to MS susceptibility in the southern of China.
Methods and subjects Subjects A total of 178 unrelated patients aged from 18 to 62 years old, with clinically defined MS diagnosed according to the McDonald criteria [19], were enrolled in this study. Patients were recruited from the Department of Neurology, the Third Affiliated Hospital of Sun Yat-sen University (Guangzhou, Guangdong Province, China) and the Third Affiliated Hospital of Soochow University (Changzhou, Jiangsu Province, China). Disability was assessed using Expanded Disability Status Scale (EDSS) [20]. The age of onset and disease duration from clinical onset to last clinical assessment was also recorded. The control group consisted of 221 healthy controls (20–65 years old) with no personal history of inflammatory or autoimmune diseases. All the subjects were Han Chinese, coming from the same region of southern China. There was no significant difference in the age and the sex distributions between the two groups. The study was approved by the local ethic committee of both hospitals, and informed consents from all participants were obtained before sample collection. The demographics and clinical characteristics of study population were presented in Table 1. Table 2.
SNP genotyping of IL23R Genomic DNA was isolated from peripheral blood leukocytes using a standard phenol–chloroform protocol. SNPs of the IL23R gene (rs10889677, rs2201841 and rs7517847) and IL12B gene (rs3212227) were genotyped by the previously described RFLP-PCR method with minor modifications [16,21]. Details on PCR conditions, primers and restriction enzymes are given in Table 2. The digested products were then bands visualized on 3% ethidium bromide-stained agarose gels.
Statistical analysis Results are expressed as mean ± SD or percentage. Statistical analysis was performed using SPSS version 15.0 for Windows. The Hardy–Weinberg equilibrium (HWE) was tested for both SNPs in the cases and the controls. For calculation of the significance of differences in genotype and allele frequencies, χ 2 test or Fisher’s exact test was used, and for comparisons of the differences between mean values of two groups, unpaired Student’s t-test was used. The linkage disequilibrium and haplotype analysis was performed using online software SHEsis (http://analysis2.biox.cn/myAnalysis.php). For all statistical tests, p values were two-sided, and p < 0.05 was considered statistically significant.
Results For genotyping, 175 samples from patients and 217 healthy controls for rs2201841 SNPs were determined, 171 samples from patients and 213 samples from controls for rs10889677 were performed, while 172 samples and 215 samples from controls for rs7517847 were determined. 177 samples from patients and 218 samples from controls for rs3212227 were performed. The distribution of genotypes and alleles of all above polymorphic variants was presented in Table 3. There was no significant deviation from the HWE (p > 0.05) in all cases. There were no statistically significant
Primer sequences, product lengths, restriction enzymes and genotype for IL12B and IL23R gene polymorphisms.
SNP ID rs3212227 rs2201841 rs10889677 rs7517847
Primers sequence TTCTATCTGATTTGCTTTA TGAAACATTCCATACATCC GGCAAAAGGGAATTGAGAGG GGCCTATGATTATGCTTTTTCCTG ATCGTGAATGAGGAGTTGCC TGTGCCTGTATGTGTGACCA ACCTTGGCAGTCTTCATCC CTCCAGTTTCTAGCCTACATACA
Annealing temperature
Products
Restriction enzymes
43
233bp
TaqI
AA AC CC
55
188bp
HpyF3I
TT TC TC
56
216bp
MnlI
AA AC CC
57
272bp
HpyF3I
GG GT TT
Genotype
International Journal of Neuroscience
IL-23 and its receptor polymorphisms with multiple sclerosis Table 3.
Genotype and allele frequencies in MS patients and healthy subjects. Genotypes
Int J Neurosci Downloaded from informahealthcare.com by Kungliga Tekniska Hogskolan on 10/09/14 For personal use only.
rs2201841 MS (175) Controls (217) rs10889677 MS (171) Controls (213) rs7517847 MS (172) Controls (215) rs3212227 MS (177) Controls (218)
Alleles
CC
TC
TT
85(48.6%) 112(51.6%) AA 89(52%) 123(57.7%) GG 29(16.9%) 31(14.4%) AA 63(35.6%) 70(32.1%)
80(45.7%) 89(41%) AC 73(42.7%) 77(36.2%) GT 89(51.7%) 106(49.3%) AC 82(46.3%) 101(41.3%)
10(5.7%) 16(7.4%) CC 9(5.3%) 13(6.1%) TT 54(31.4%) 78(36.3%) CC 32(18.1%) 47(21.6%)
differences in the distributions of the genotype and allele frequencies between patients and controls (p > 0.05). Similarly, there were no differences within allele or genotype distribution between MS men and women, the same as between the same sex comparing MS patients and controls (data not shown). In addition, available clinical features of MS patients were analyzed for possible association with the different genotypes of IL23R or IL12B polymorphisms. No significant differences were observed between these genetic variants and the following variables: age at onset, duration and EDSS (data not shown). Linkage disequilibrium was observed between rs2201841 and rs10889677 [−D |=0.614, r2 = 0.327]. Haplotype analyses were performed and the possible haplotype frequencies are shown in Table 4. Haplotype frequencies of the IL23R gene in MS patients were not significantly different from that in healthy controls (p > 0.05).
Discussion The fact that non-major-histocompatibility-complex (non-MHC) genes contributing a large part besides HLA-DRB1∗1501 to the susceptibility to MS [22] has prompted numerous efforts to identify new susceptibility genes in recent years. Because of its proinflammatory and immunoregulatory activities, IL-23 and its receptor might be major susceptibility genes for Table 4. Haplotypes of IL23R gene in the MS patients and controls. Combination of haplotypes CA CC TA TC C
3
Frequency MS patients
Control
p
216.8(64%) 24.72(7.3%) 30.72(9.1%) 66.28(19.6%)
277.79(66.1%) 28.21(6.7%) 43.21(10.3%) 70.79(16.9%)
0.382 0.102 0.306 0.96
2014 Informa Healthcare USA, Inc.
p 0.58
0.425
0.563
0.624
C
T
p
250(78.4%) 313(72.9%) A 251(73.4%) 323(75.8%) G 147(42.7%) 168(39.1%) A 208(58.8%) 241(55.3%)
100(28.6%) 121(27.9%) C 91(26.6%) 103(24.2%) T 197(57.3%) 262(60.9%) C 146(41.2%) 195(44.7%)
0.83
0.441
0.303
0.326
T-cell-mediated autoimmune diseases. Actually, numerous studies have identified a set of SNPs in IL23R and IL12B gene that are associated with susceptibility to autoimmune disorders such as IBD, ankylosing spondylitis and psoriasis in different ethnic population. These discoveries highlight the genetic relevance of IL-23 and its receptor in human autoimmune diseases. Based on the hypothesis that autoimmune diseases may share a common background of genetic risk, IL12B and IL23R appeared to be also probably associated with MS. Although SNPs in IL12B [11,12] and IL23R [13,14] gene have been reported the presence of association with the susceptibility to MS, the other studies [15–18] did not confirm these findings. Recent genome-wide association study (GWAS) also found no association between IL23R variants and MS in Caucasian population from North America and the United Kingdom [23]. It has been confirmed no SNPs of IL23R gene were associated with MS in Caucasian population, but a distinct ethnic background may play a role in the differences of genetic studies. Therefore, it is necessary to investigate the possible role of IL23R gene to MS in population with a different ethnicity. For this purpose, we undertook this case–control study to investigate the association between MS and polymorphisms in IL12B and IL23R in a Han Chinese population. In this study, four SNPs (rs10889677, rs2201841 and rs7517841 of IL23R and rs3212227 of IL12B gene) mentioned with susceptibility to MS in previous studies were selected for association analysis in Chinese population. To the best of our knowledge, this is the first report about the association between IL12B and IL23R gene SNPs and MS susceptibility in Chinese population. However, our study did not find any differences of these SNPs tested between MS patients and controls in southern China. Furthermore, no association was observed between these polymorphisms and duration, EDSS and age of disease onset. Our study showed that these SNPs were not associated with MS in Chinese southern population.
Int J Neurosci Downloaded from informahealthcare.com by Kungliga Tekniska Hogskolan on 10/09/14 For personal use only.
4
M. Liu et al.
However, the size of patient samples in our study was relatively small and the patients were only recruited from the Chinese southern region. The results observed in this study need to be confirmed in large samples and in population from other regions of China. Furthermore, we cannot exclude the possibility that other variants of IL23R or IL12B gene might play a role in MS susceptibility in Chinese population. Finally, with the development of GWAS, two SNPs related to IL-12 gene have been identified to be associated with MS susceptibility recently [24,25]. These findings implied that there is still association between the IL-23/Th17 pathway and the susceptibility to MS. Additional research is necessary to explore the relationship between MS and other genes belonged to IL-23/Th17 pathway.
Conclusion Within the limitations of ethnicity, variants selection and sample number in this study, our study did not demonstrate any association between the tested SNPs in IL23R and IL12B gene with MS in Chinese southern population. Further genetic studies including more SNPs and a larger Chinese population samples are required to elucidate the association between IL23R/IL12B gene and MS.
Declaration of Interest The authors report no conflicts of interest. The authors alone are responsible for the content and writing of this paper.
Acknowledgements The authors thank Dr. Ning Wei for kind advice and Dr. Bin Zhang and Wenxia You for their assistance with sample supply and DNA extraction.
References 1. Noseworthy JH, Lucchinetti C, Rodriguez M, et al. Multiple sclerosis. N Engl J Med 2000;343:938–52. 2. Tan ZY, Bealgey KW, Fang Y, et al. Interleukin-23: immunological roles and clinical implications. Int J Biochem Cell Biol 2009;41:733–5. 3. Iwakura Y, Ishigame H. The IL-23/IL-17 axis in inflammation. J Clin Invest 2006;116:1218–22. 4. Parham C, Chirica M, Timans J, et al. A receptor for the heterodimeric cytokine IL-23 is composed of IL-12Rbeta1 and a novel cytokine receptor subunit, IL-23R. J Immunol 2002; 168:5699–708. 5. Duerr RH, Taylor KD, Brant SR, et al. A genome-wide association study identifies IL23R as an inflammatory bowel disease gene. Science 2006;314:1461–3.
6. Glas J, Seiderer J, Wagner J, et al. Analysis of IL12B gene variants in inflammatory bowel disease. PLoS One 2012;7:e34349. 7. Cargill M, Schrodi SJ, Chang M, et al. A large-scale genetic association study confirms IL12B and leads to the identification of IL23R as psoriasis-risk genes. Am J Hum Genet 2007; 80:273–90. 8. Capon F, Di Meglio P, Szaub J, et al. Sequence variants in the genes for the interleukin-23 receptor (IL23R) and its ligand (IL12B) confer protection against psoriasis. Hum Genet 2007;122:201–206. 9. Karaderi T, Harvey D, Farrar C, et al. Association between the interleukin 23 receptor and ankylosing spondylitis is confirmed by a new UK case-control study and meta-analysis of published series. Rheumatology (Oxford) 2009;48:386–9. 10. Wong RH, Wei JC, Huang CH, et al. Association of IL-12B genetic polymorphism with the susceptibility and disease severity of ankylosing spondylitis. J Rheumatol 2012;39:135–40. 11. van Veen T, Crusius JBA, Schrijver HM, et al. Interleukin12p40 genotype plays a role in the susceptibility to multiple sclerosis. Ann Neurol 2001;50:275. 12. Alloza I, Heggarty S, Goris A, et al. Interleukin-12 p40 polymorphism and susceptibility to multiple sclerosis. Ann Neurol 2002;52:524–5. 13. Illes Z, Safrany E, Peterfalvi A, et al. 3’UTR C2370A allele of the IL-23 receptor gene is associated with relapsing-remitting multiple sclerosis. Neurosci Lett 2008;431:36–8. ˜ C, Dema B, C´enit MC, et al. IL23R: a susceptibility 14. Nu´ nez locus for celiac disease and multiple sclerosis? Genes Immun. 2008; 9:289–93. 15. Roos IM, Kockum I, Hillert J. The interleukin 23 receptor gene in multiple sclerosis: a case-control study. J Neuroimmunol 2008;194:173–80. 16. Hall MA, McGlinn E, Coakley G, et al. Genetic polymorphism of IL-12 p40 gene in immune-mediated disease. Genes Immun 2000;1:219–24. 17. Begovich AB, Chang M, Caillier SJ, et al. The autoimmune disease-associated IL12B and IL23R polymorphisms in multiple sclerosis. Hum Immunol 2007;68:934–7. 18. Forte GI, Ragonese P, Salemi G, et al. Search for genetic factors associated with susceptibility to multiple sclerosis. Ann N Y Acad Sci 2006;1067:264–9. 19. McDonald WI, Compston A, Edan G, et al. Recommended diagnostic criteria for multiple sclerosis: guidelines from the International Panel on the diagnosis of multiple sclerosis. Ann Neurol 2001;50:121–7. 20. Kurtzke JF. Rating neurologic impairment in multiple sclerosis: an expanded disability status scale (EDSS). Neurology 1983;33:1444–52. 21. Huber AK, Jacobson EM, Jazdzewski K, et al. Interleukin(IL)-23 receptor is a major susceptibility gene for Graves’ophthalmopathy: the IL-23/T-helper 17 axis extends to thyroid autoimmunity. J Clin Endocrinol Metab 2008;93:1077–81. 22. Lincoln MR, Montpetit A, Cader MZ, et al. A predominant role for the HLA class II region in the association of the MHC region with multiple sclerosis. Nat Genet 2005;37:1108–12. 23. Burton PR, Clayton DG, Cardon LR, et al. Association scan of 14,500 nonsynonymous SNPs in four diseases identifies autoimmunity variants. Nat Genet 2007;39:1329–37. 24. International Multiple Sclerosis Genetics Conssortium (IMSGC). IL12A, PHOSPH9/CDK2AP1 and RGS1 are novel multiple sclerosis susceptibility loci. Genes Immun 2010;11:397–405. 25. Sawcer S, Hellenthal G, Pirinen M, et al. Genetic risk and a primary role for cell-mediated immune mechanisms in multiple sclerosis. Nature 2011;476:214–9.
International Journal of Neuroscience
