CED
Clinical dermatology • Original article
Clinical and Experimental Dermatology
Association of interleukin-23 receptor gene polymorphism with Behcßet disease B. Yalcßin,1,2 N. Atakan3 and S. Dogan2,3 1 Department of Dermatology, Yildirim Beyazit University, Ankara, Turkey; 2Department of Dermatology, Ankara Numune Training and Research Hospital, Ankara, Turkey; and 3Department of Dermatology, Hacettepe University, Ankara, Turkey
doi:10.1111/ced.12400
Summary
Background. Behcßet disease (BD) is a chronic, multisystemic disease characterized by relapsing episodes of a wide spectrum of clinical symptoms. Several genetic and immunological factors have been suggested to be involved in the aetiopathogenesis of BD. Aim. To investigate the association between BD and five single nucleotide polymorphisms (SNP) in the gene for interleukin (IL)-23 receptor (IL-23R). Methods. We recruited 123 patients with BD and 168 controls. A detailed phenotypic investigation of BD was made for each patient. Five SNPs in the IL-23R gene (rs11209026, rs7517847, rs11805303, rs1004819, rs17375018) were investigated. Results. We found that patients with BD had a lower frequency of the rs17375018 GA and AA genotypes, and a higher frequency of the rs17375018 G allele, and these were statistically significant. The rs11209026 G allele frequency was higher in male patients with BD than in male controls, and the rs7517847 G allele was higher in patients with genital ulcers. The rs11805303 G and rs1004819 G alleles were more frequent in patients with papulopustular lesions. Conclusions. The rs17375018 variant in the IL-23R gene seems likely to be a strong susceptibility factor for BD in the Turkish population. As this variant was also shown to have a higher frequency in BD patients from different ethnic backgrounds in two previous studies, it may be specific for BD.
Introduction Behcßet disease (BD) is a chronic, multisystemic disease characterized by relapsing episodes of a wide spectrum of clinical symptoms, including mucocutaneous, ocular, vascular, musculoskeletal, gastrointestinal (GI) and central nervous system (CNS) features.1 Although the aetiopathogenesis of BD has not been completely clarified, dysregulation of the innate and adaptive immune system due to unknown infectious or environmental factors in genetically predisposed individuals has been Correspondence: Dr Basßak Yalcßin, Ikizdere sok C19/1 GOP, C ß ankaya, Ankara, 06670, Turkey E-mail: [email protected] Conflict of interest: the authors declare that they have no conflicts of interest. Accepted for publication 12 February 2014
ª 2014 British Association of Dermatologists
suggested.2 The high prevalence of BD in a specific geographic region (historically known as the Old Silk Road) and the high sibling risk ratio of the disease support the existence of genetic predisposition as well as the influence of enviromental factors in BD.3 A complex interaction between T cells, neutrophils and antigen-presenting cells (APCs) plays an important role in the immunopathogenesis of BD. In BD, T helper (Th)1 polarization occurs in the adaptive immune system. APCs fortify this Th1 polarization, inducing neutrophil hyperactivity that results in increased chemotaxis, phagocytosis, superoxide production amd myeloperoxidase expression.4 Production of interleukin (IL)-1, IL-4, IL-6, IL-8, IL-10, IL-13, IL-18 and tumour necrosis factor (TNF)-a increases, and an abnormal immune response develops.5 Recent studies have revealed that in addition to Th1 polarization, there is involvement of
Clinical and Experimental Dermatology (2014) 39, pp881–887
881
IL-23R polymorphism in Behcet disease B. Yalcßin et al.
Th17 cells and their main product, IL-17, in the pathogenesis of BD.6 Regarding genetic factors, presence of the HLA-B51 allele seems to be the most strongly associated risk factor.7 Cross-presentation of particular self antigens that have molecular homology with some infectious molecules may lead to an autoreactive immune response in BD.2–8 Additionally, several other genes located outside the major histocompatibility locus have been proposed to be involved in the pathogenesis of BD, including the genes for TNF, IL-1, nuclear factor kappa B (NFkB), coagulation factor V, intercellular adhesion molecule-1, endothelial nitric oxide synthetase, Mediterranean Fever and heat shock proteins.9–14 The products of these genes have been reported to play crucial roles in the immunoinflammatory pathogenesis of BD. In this study, we investigated five single nucleotide polymorphisms (SNPs) in the gene for the IL-23 receptor (IL-23R). IL-23R is a candidate gene in the development of autoimmune and inflammatory diseases according to National Human Genome Research Institute catalogue of genome-wide association studies (GWAS).15 These SNPs have been revealed in recent studies as being susceptibility factors in some autoimmune and inflammatory diseases such as inflammatory bowel disease, ankylosing spondylitis, psoriasis, psoriatic arthritis and rheumatoid arthritis; however, their roles in the pathogenesis of BD still need to be clarified.16–18
included. Clinical characteristics of the patients are shown in Table 1. Mean age at disease onset was 28.8 8.2 years and the mean duration of disease was 8.8 6.3 years. Information was collected from all participants, including their sex and age, disease history including age at the beginning of the disease, duration of the disease, and family history of BD. Clinical findings, including mucocutaneous (oral aphtous lesions, genital ulcers, papulopustular skin lesions, erythema nodosumlike lesions, pathergy positivity), ocular (anterior or posterior uveitis, hypopyon, retinal vasculitis, cystoid macular degeneration), joint (arthritis), gastrointestinal (visualization of ulceration of oesophagus and intestinal sections during endoscopy and colonoscopy), cardiovascular [venous involvement, (usually in the form of superficial thrombophlebitis), arterial disease, aneurysms in the pulmonary arterial tree, right-sided cardiac thrombosis, vasculitis of the small and large vessels] and central nervous system (behavioural changes such as apathy or disinhibition, seizures and bulbar signs, ophthalmoplegia, meningoencephalitis, lymphocytic meningeal infiltration, or demyelinization, or infarctions due to vasculitis or thrombosis) symptoms were noted for each patient.1,2,7,19 Single nucleotide polymorphism selection
The study was approved by our institutional ethics committee, and carried out in concordance with the Declaration of Helsinki. Written informed consent was obtained from all participants.
We selected five SNPs in the IL-23R gene: rs11209026, rs7517847, rs11805303, rs1004819 and rs17375018. Of these, rs11209026, rs7517847, rs11805303 and rs1004819 have previously been described as susceptibility factors for several autoimmune inflammatory diseases in the National Human Genome Research Institute catalogue of GWAS. The rs17375018 variant has not been reported to be
Patients
Table 1 Clinical features of patients with Behcßet disease.
Methods
Consecutive patients meeting International Study Group criteria for BD were enrolled. The control group consisted of healthy individuals or patients with acne vulgaris, skin infections, melasma, hyperhidrosis or hand eczema, who did not have a medical history of autoimmune or autoinflammatory rheumatological disorders.19 Both groups were matched for age and sex. Individuals who were younger than 18 years or who had any chronic inflammatory skin disorder or any systemic disease were excluded. In total, 123 patients with BD (47 men, 75 women; mean age 37.7 10.1 years) and 168 controls (56 men, 112 women; mean age 39.9 13.1 years) were
882
Clinical and Experimental Dermatology (2014) 39, pp881–887
Patients
Family history Oral aphtous lesion Genital ulcer Papulopustular skin lesion Erythema nodosum-like lesion Pathergy Eye involvement Joint involvement Vascular involvement Gastrointestinal involvement Neurological involvement
n
%
32 123 113 80 78 60 34 35 24 13 9
26 100 91.8 65.0 63.4 48.7 27.6 28.4 19.5 10.5 7.3
ª 2014 British Association of Dermatologists
IL-23R polymorphism in Behcet disease B. Yalcßin et al.
associated with any autoimmune or systemic disease other than BD. Genotyping
SNaPshot assays were carried out according to the manufacturer’s recommendations. Capillary electrophoresis of the SNaPshot reactions were also carried out according to the manufacturer’s recommendations, using a capillary electrophoresis instrument (ABI 3130; Applied Biosystems Inc.). Genotyping of polymorphisms was performed by analysing the electrophoregrams obtained during capillary electrophoresis, using GeneMapper v.4.0 software (Applied Biosystems Inc.).
Peripheral blood samples from each participant were collected into 10 mL EDTA tubes. DNA was isolated (QIAamp DNA Blood Mini Kit; Qiagen Inc., Valencia, CA, USA) from 200 lL peripheral blood samples, and stored at 20 °C until the PCR step. The PCR mixture consisted of 17.8 lL distilled H2O, 2.5 lL 10 9 complete buffer (Bioron Inc., Ludwigshafen, Germany), 0.5 lL dNTP mix (10 mmol/L each), 1 lL forward primer (5 lmol/L), 1 lL reverse primer (5 lmol/L), 0.2 lL SuperHotTaq (Bioron Inc.) and 2 lL DNA template (20–50 ng/lL). The mixture was incubated for 10 min at 95 °C, followed by 35 cycles at 95 °C for 45 s, 60 °C for 45 s and 72 °C for 45 s, with a final extension at 72 °C for 10 min. Of these samples, 10% were tested twice to validate the genotyping results, and gave 100% reproducibility. PCR samples were separated in 2% agarose gels by electrophoresis. All eight reactions for each sample were combined and purified (NucleoFast 96 PCR Kit; Macherey-Nagel GmbH, D€ uren, Germany).
All tests were performed using SPSS v.13.0 (SPSS Inc., Chicago, IL, USA). The frequencies of alleles in the patient and control groups were compared by the Fisher exact test and genotypes of polymorphisms in the patient and control groups were compared by the v² test. For each test P < 0.05 was considered statistically significant. Odds ratios (OR) and 95% confidence interval (CI) were also calculated whenever v2 test or Fisher exact v2 test was significant. The associations between genotypes of the polymorphisms and BD, and clinical features of BD were estimated by computing the OR and 95% CI from logistic regression analyses.
Polymorphism detection
Results
Screening of polymorphisms was carried out using the SNaPshot multiplex system (Applied Biosystems Inc., Foster City, CA, USA). For this purpose, three primers were designed for each of the eight polymorphisms; two primers for PCR and one for the SNaPshot reaction. Primer sequences are shown in Table 2.
Genotype and allele frequencies of the five IL-23R polymorphisms (rs11209026, rs7517847, rs17375018, rs11805303 and rs1004819) in the patient and control groups are shown in Table 3. Genotypically, rs17375018 GA (P = 0.01; RR = 0.53, 95% CI 0.3– 0.8) and rs17375018 AA (P = 0.02; RR = 0.26, 95%
Statistical analyses
Table 2 Primers used for polymorphism detection. Primer name
Sequence 50 ?30
Pr#29_1F Pr#29_1R Pr#29_2F Pr#29_2R Pr#29_3F Pr#29_3R Pr#29_4F Pr#29_4R Pr#29_5F Pr#29_5R Pr#29_rs 11209026 Pr#29_rs 7517847 Pr#29_rs 17375018 Pr#29_rs 11805303 Pr#29_rs 1004819
GAATGATCGTCTTTGCTGTTATGTTGTC CATTTGTAGAGAGTTTGGCATGGGTAAG CTCTTTCTTACTCCTTTCACCTATTCCCA TTTTGACATGAATTTGAGGGGCCTA CATTGCTATGTTGATTGAATCTAGAATGG GGTGTTTGTTTCCTTTTCTGACCTGTC ATTATTGTATGCTTGCAAACAGAGAACTG ATTTTTGTTTCCCTGGATGCCTGTC ATCTGGTGGAAATATGTGAAACCTAATCAG CTGTTATAGCAGCACAAGCATTCTAGGAC ACTGACTGACTGACTGCAGAAATTCTGCAAAAACCTACCCAGTT ACTGACTGACTGACTGACTGACTGACAGTTTCTAGCCTACATACAGGTGTAGCTG TGACTGAAAACCTAACCAAGTTCTGAATTGATGGA GACTGACTGACTGACTGACTGACAACTAATAAAAGGCAAGTGGATCGTTT ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACCTGACCTGCTTTATGCTGTGATTCTTACT
ª 2014 British Association of Dermatologists
Clinical and Experimental Dermatology (2014) 39, pp881–887
883
IL-23R polymorphism in Behcet disease B. Yalcßin et al.
Table 3 Genotype and allele frequencies of rs11209026, rs7517847, rs17375018, rs11805303 and rs100481 polymorphisms in the gene for interleukin-23 receptor in Behcßet disease and controls. Frequency, n (%) Polymorphism
Genotype/allele
Patients
Controls
P
OR
rs11209026
GG GA AA G A TT TG GG T G GG GA AA G A CC CT TT C T GG GA AA G A
– 9 114 237 9 60 52 11 172 74 80 39 4 199 47 37 61 25 135 111 38 61 24 137 109
– 15 153 321 15 75 74 19 224 112 79 73 15 233 103 54 87 27 195 141 56 86 26 198 138
– > 0.05
– –
0.01 – 0.02 > 0.05
0.53 0.26 1.16 –
rs7517847
rs17375018
rs11805303
rs1004819
(7.3) (92.7) (96.3) (3.6) (48.8) (42.3) (8.9) (69.9) (30.1) (65.0) (31.7) (3.3) (80.9) (19.1) (30.1) (49.6) (20.3) (54.9) (45.2) (30.9) (49.6) (19.5) (55.7) (44.3)
(8.9) (91.1) (95.5) (4.4) (44.6) (44.0) (11.3) (66.6) (33.4) (47) (43.5) (8.9) (69.4) (30.6) (32.1) (51.8) (16.1) (58.0) (42.0) (33.3) (51.2) (15.5) (58.9) (41.1)
95% CI – –
0.3–0.8 0.08–0.8 1.06–1.28 –
For single nucleotide polymorphisms, (wild-type/mutant) alleles are as follows: rs11209026 (G/A), rs7517847 (T/G), rs17375018 (G/ A), rs11805303 (C/T), rs1004819 (G/A).
CI 0.08–0.8) were statistically lower in patients than controls. However, no significant difference was detected between patients and controls in terms of genotypic distribution of the other polymorphisms studied (P > 0.05). The presence of G alleles compared with A alleles for rs17375018 was statistically higher in patients than controls (P = 0.02, OR = 1.16, 95% CI 1.06–1.28). No significant differences in allele frequencies for the other studied polymorphisms were detected between patients and controls (P > 0.05). The rs11209026 G allele was significantly more common in male patients (97.8%) than in male controls (85.4%) (P = 0.02, OR = 1.14, 95% CI 1.05– 1.24) when comparisons were made according to gender between the patient and control groups. The genotypic and allelic distributions of rs11209026, rs7517847, rs17375018, rs11805303 and rs1004819 were also investigated according to the clinical features of BD and the family history. The rs7517847 GG genotype was statistically less common in patients with than in patients without genital ulcers (P = 0.12, RR = 0.08, 95% CI 0.01– 0.5). The rs11805303 TT genotype was significantly
884
Clinical and Experimental Dermatology (2014) 39, pp881–887
more common in patients with than in patients without papulopustular lesions (P = 0.01, RR = 5.8, 95% CI 1.4–23.4). The rs7517847 G allele (P = 0.03, OR = 4.7, 95% CI 1.4–15.6) allele (P = 0.01, OR = 22.2, 95% CI 2.2–224.0) was statistically more common in patients with than in patients without genital ulcer, and the rs11805303 C (P = 0.01, OR = 1.2, 95% CI 1.0–1.4) and rs1004819 G (P = 0.01, OR = 1.25, 95% CI 1.0–1.4) alleles were statistically more common in patients with than in patients without papulopustular lesions. The rs11209026 G allele was more common in patients with papulopustular lesions, and this was close to statistical significance (P = 0.06). The rs17375018 G and rs1004819 G alleles were more common in patients with vascular involvement, and these rates were also close to statistical significance (P = 0.09 and P = 0.07, respectively).
Discussion In this study, we evaluated selected inflammationrelated SNPs for associations with BD susceptibility
ª 2014 British Association of Dermatologists
IL-23R polymorphism in Behcet disease B. Yalcßin et al.
and its clinical characteristics. IL-23 is a critical cytokine that serves in defence against microbial agents. It has a crucial effect on the maintenance of Th17 cells, which are potent inducers of tissue inflammation. Aberrant Th17 response occurs in chronic inflammatory diseases with autoimmune aetiology.20 Recently, Th17 cells have been shown to have a significant role in BD. In addition to Th1 response, cytokines released from Th17 cells have been suggested to be involved in the pathogenesis of BD.6 Serum levels of IL-17, IL-23, IL-12/23p40 and interferon-c were found to be significantly increased in patients with BD.21 IL-23 acts via Janus kinase–signal transducer and activator of transcription (JAK-STAT) and NFjB after binding to IL-23R, which is expressed in activated/memory T cells, dendritic cells and natural killer cells.22 A recent study by Lew et al. showed increased IL-23 p19 mRNA expression in erythema nodosum-like lesions of patients with active BD, and the authors suggested that IL-23 has a pathogenetic effect on the development of BD skin lesions.23 The IL-23R gene is located on chromosome 1p31, which exhibits many SNPs in its gene locus. Some of these SNPs are associated with autoimmune and inflammatory diseases such as Crohn disease, ulcerative colitis, psoriasis, psoriatic arthritis, ankylosing spondylitis and rheumatoid arthritis.15–18 Protective SNPs that cause loss of function have also been defined in the IL23R gene.24 In the present study, we found that in our Turkish patients, the incidence of the rs17375018 G allele was significantly higher and the incidence of the rs17375018 AA/GA genotypes was significantly lower compared with controls. However, we did not find any associations between the rs11209026, rs7517847, rs11805303 or rs1004819 variants and BD. In the literature, there are two published articles related to SNPs in the IL-23R gene in BD. Xavier et al. investigated 40 different SNPs in the IL-23R gene in an Iranian populaiton, and found that the rs17375018 G allele and rs7517847 T allele frequencies were higher in patients with BD compared with controls.15 Jiang et al. similarly showed that the rs17375018 GG genotype and G allele frequencies were higher in BD in their Chinese Han population.25 In our study, we also found an increased frequency of the rs17375018 G allele, which may indicate a possible association of this allele with BD in the Turkish population. This finding is notable because although rs17375018 has not been associated with any autoimmune or inflammatory diseases, there seems to be a close association of this variant with
ª 2014 British Association of Dermatologists
BD. Considering the results of our study together with those of the two other studies, the rs17375018 variant of the IL-23R gene seems to be a strong susceptibility factor for BD, and may even be specific for BD. Additionally, as the rs17375018 variant has now been shown to be associated with BD in thee different populations (Iranian, Chinese Han and Turkish), we believe that the association of this variant with BD is not limited to a specific geographic region or a specific ethnic group. Other findings from the present study were the statistically higher incidences of the rs11209026 G allele in male patients with BD, of the rs7517847 G allele in patients with genital ulcer, and of the rs1004819 G and rs11805303 C alleles in patients with papulopustular lesions. Additionally, we found that the incidence of the rs1373692 G allele was relatively higher in patients with ocular involvement, and the incidences of the rs17375018 G and rs1004819 G alleles were relatively higher in patients with vascular involvement; these did not reach statistical significance, but it is possible that they might do so in a larger study group. In our study, we did not find any associations of the aforementioned variants with BD except for rs17375018. However, BD is a syndrome with a wide spectrum of clinical findings, and it is possible that related SNPs in the IL-23R gene could determine the presenting clinical findings in some patients. Another important finding in our study was the presence of a strong correlation between the rs11805303 and rs1004819 SNPs (P < 0.05; r = 0.95). Linkage disequilibrium (LD) between rs17375018/rs924080 and rs17375018/rs1495965 in IL-23R gene were reported in previous studies, but to our knowledge, the correlation between rs11805303 and rs1004819 has not been reported previously. We believe that the strong correlation we found between rs11805303 and rs1004819 may also be due to a strong LD, and propose interchangeable use of these variants in further studies. Identification of certain IL-23R genotypes conferring a predilection for BD not only elucidates the role of IL-23 in disease pathogenesis, but also indicates certain therapeutic managements as well. IL23 antagonists available as monoclonal antibodies target cytokines and effectively attenuate IL-23-mediated diseases such as Crohn disease, psoriasis and sarcoidosis.26 Thus, IL-23-targeting monoclonal antibodies might offer enhanced anti-inflammatory effects in BD management.
Clinical and Experimental Dermatology (2014) 39, pp881–887
885
IL-23R polymorphism in Behcet disease B. Yalcßin et al.
Conclusion We suggest that the rs17375018 variant in IL-23R gene is a strong susceptibility factor for BD in the Turkish population. As this same variant was found as a susceptibility factor for patients with BD in Iranian and Chinese Han populations, it may be specific for BD. However, further studies in different ethnic groups are needed to confirm this possibility.
Acknowledgement This work was supported by the Dermatoimmunology Society, Turkey.
What’s already known about this topic? ● BD is a chronic, multisystemic disease, charac-
terized by relapsing episodes of a wide spectrum of clinical symptoms. ● Several genetic and immunological factors have been suggested to be involved in the aetiopathogenesis of BD.
What does this study add? ● The rs17375018 variant of the IL-23R gene
seems to be a strong susceptibility factor for BD in the Turkish population. ● As this variant was also shown to have an increased frequency in BD in two previous studies with subjects from different ethnic backgrounds, it may be specific for BD.
References € 1 Behcßet H. Uberrezidivierende aphthouse durchein virus verursachte Geschwuere am Mund, am Auge und an den Genitalien. Dermatol Monatsschr Wochenschr 1937; 105: 1152–7. 2 Kapsimali VD, Kanakis MA, Vaiopoulos GA, Kaklamanis PG. Etiopathogenesis of Behcßet’s disease with emphasis on the role of immunological aberrations. Clin Rheumatol 2010; 29: 1211–16. 3 James DG. ‘Silk route disease’ (Behcßet’s disease). West J Med 1988; 148: 433–7.
886
Clinical and Experimental Dermatology (2014) 39, pp881–887
4 Zhou ZY, Chen SL, Shen N, Lu Y. Cytokines and Behcet’s disease. Autoimmun Rev 2012; 11: 699–704. 5 Mendoza-Pinto C, Garcıa-Carrasco M, Jimenez-Hern andez M et al. Etiopathogenesis of Behcet’s disease. Autoimmun Rev 2010; 9: 241–5. 6 Hamzaoui K. Th17 cells in Behcßet’s disease: a new immunoregulatory axis. Clin Exp Rheumatol 2011; 29: S71–6. 7 Maldini C, Lavalley MP, Cheminant M et al. Relationships of HLA-B51 or B5 genotype with Behcet’s disease clinical characteristics: systematic review and meta-analyses of observational studies. Rheumatology (Oxford) 2012; 51: 887–900. 8 Direskeneli H. Behcßet’s disease: infectious aetiology, new autoantigens, and HLA-B51. Ann Rheum Dis 2001; 60: 996–1002. 9 Yalcin B, Atakan N, Alli N. The functional role of nuclear factor kappa-kappaB1-94 ins/del ATTG promotor gene polymorphism in Behcßet’s disease: an exploratory study. Clin Exp Dermatol 2008; 33: 629–33. 10 Marcos M, Hern andez-Garcıa I, Calvo A et al. Association of allelic variants of factor V Leiden, prothrombin and methylenetetrahydrofolate reductase with thrombosis or ocular involvement in Behcßet’s disease: a systematic review and meta-analysis. Autoimmun Rev 2013; 12: 607–16. 11 Ben Dhifallah I, Karray EF, Sassi F, Hamzaoui K. Intercellular adhesion molecule 1 K469E gene polymorphism is associated with presence of skin lesions in Tunisian Behcßet’s disease patients. Tissue Antigens 2010; 75: 74–8. 12 Lee YH, Song GG. Associations between eNOS polymorphisms and susceptibility to Behcet’s disease: a meta-analysis. J Eur Acad Dermatol Venereol 2012; 26: 1266–71. 13 Kirino Y, Zhou Q, Ishigatsubo Y et al. Targeted resequencing implicates the familial Mediterranean fever gene MEFV and the toll-like receptor 4 gene TLR4 in Behcßet disease. Proc Natl Acad Sci 2013; 110: 8134–9. 14 Kaneko F, Oyama N, Yanagihori H et al. The role of streptococcal hypersensitivity in the pathogenesis of Behcßet’s disease. Eur J Dermatol 2008; 18: 489–98. 15 Xavier JM, Shahram F, Davatchi F et al. Association study of IL10 and IL23R-IL12RB2 in Iranian patients with Behcßet’s disease. Arthritis Rheum 2012; 64: 2761– 72. 16 Duan Z, Pan F, Zeng Z et al. Interleukin-23 receptor genetic polymorphisms and ankylosing spondylitis susceptibility: a meta-analysis. Rheumatol Int 2012; 32: 1209–14. 17 Safrany E, Pazar B, Melegh BI et al. Marked diversity of IL23R gene haplotype variants in rheumatoid arthritis comparing with Crohn’s disease and ankylosing spondylitis. Mol Biol Rep 2013; 40: 359–63.
ª 2014 British Association of Dermatologists
IL-23R polymorphism in Behcet disease B. Yalcßin et al.
18 Bowes J, Barton A. The genetics of psoriatic arthritis: lessons from genome-wide association studies. Discov Med 2010; 10: 177–83. 19 International Study Group for Behcßet’s Disease. Criteria for diagnosis of Behcßet’s disease. International Study Group for Behcßet’s Disease. Lancet 1990; 335: 1078–80. 20 Toussirot E. The IL23/Th17 pathway as a therapeutic target in chronic inflammatory diseases. Inflamm Allergy Drug Targets 2012; 11: 159–68. 21 Na SY, Park MJ, Park S, Lee ES. Up-regulation of Th17 and related cytokines in Behcßet’s disease corresponding to disease activity. Clin Exp Rheumatol 2013; 31: 32–40. 22 Che Mat NF, Zhang X, Guzzo C, Gee K. Interleukin23-induced interleukin-23 receptor subunit expression is mediated by the Janus kinase/signal transducer and activation of transcription pathway in human CD4 T cells. J Interferon Cytokine Res 2011; 31: 363–71.
ª 2014 British Association of Dermatologists
23 Lew W, Chang JY, Jung JY, Bang D. Increased expression of interleukin-23 p19 mRNA in erythema nodosum-like lesions of Behcßet’s disease. Br J Dermatol 2008; 158: 505–11. 24 Sarin R, Wu X, Abraham C. Inflammatory disease protective R381Q IL23 receptor polymorphism results in decreased primary CD4+ and CD8+ human T-cell functional responses. Proc Natl Acad Sci 2011; 108: 9560–5. 25 Jiang Z, Yang P, Hou S et al. IL-23R gene confers susceptibility to Behcet’s disease in a Chinese Han population. Ann Rheum Dis 2010; 69: 1325–8. 26 Benson JM, Peritt D, Scallon BJ et al. Discovery and mechanism of ustekinumab: a human monoclonal antibody targeting interleukin-12 and interleukin-23 for treatment of immune-mediated disorders. MAbs 2011; 3: 535–45.
Clinical and Experimental Dermatology (2014) 39, pp881–887
887
Clinical dermatology • Original article
Clinical and Experimental Dermatology
Association of interleukin-23 receptor gene polymorphism with Behcßet disease B. Yalcßin,1,2 N. Atakan3 and S. Dogan2,3 1 Department of Dermatology, Yildirim Beyazit University, Ankara, Turkey; 2Department of Dermatology, Ankara Numune Training and Research Hospital, Ankara, Turkey; and 3Department of Dermatology, Hacettepe University, Ankara, Turkey
doi:10.1111/ced.12400
Summary
Background. Behcßet disease (BD) is a chronic, multisystemic disease characterized by relapsing episodes of a wide spectrum of clinical symptoms. Several genetic and immunological factors have been suggested to be involved in the aetiopathogenesis of BD. Aim. To investigate the association between BD and five single nucleotide polymorphisms (SNP) in the gene for interleukin (IL)-23 receptor (IL-23R). Methods. We recruited 123 patients with BD and 168 controls. A detailed phenotypic investigation of BD was made for each patient. Five SNPs in the IL-23R gene (rs11209026, rs7517847, rs11805303, rs1004819, rs17375018) were investigated. Results. We found that patients with BD had a lower frequency of the rs17375018 GA and AA genotypes, and a higher frequency of the rs17375018 G allele, and these were statistically significant. The rs11209026 G allele frequency was higher in male patients with BD than in male controls, and the rs7517847 G allele was higher in patients with genital ulcers. The rs11805303 G and rs1004819 G alleles were more frequent in patients with papulopustular lesions. Conclusions. The rs17375018 variant in the IL-23R gene seems likely to be a strong susceptibility factor for BD in the Turkish population. As this variant was also shown to have a higher frequency in BD patients from different ethnic backgrounds in two previous studies, it may be specific for BD.
Introduction Behcßet disease (BD) is a chronic, multisystemic disease characterized by relapsing episodes of a wide spectrum of clinical symptoms, including mucocutaneous, ocular, vascular, musculoskeletal, gastrointestinal (GI) and central nervous system (CNS) features.1 Although the aetiopathogenesis of BD has not been completely clarified, dysregulation of the innate and adaptive immune system due to unknown infectious or environmental factors in genetically predisposed individuals has been Correspondence: Dr Basßak Yalcßin, Ikizdere sok C19/1 GOP, C ß ankaya, Ankara, 06670, Turkey E-mail: [email protected] Conflict of interest: the authors declare that they have no conflicts of interest. Accepted for publication 12 February 2014
ª 2014 British Association of Dermatologists
suggested.2 The high prevalence of BD in a specific geographic region (historically known as the Old Silk Road) and the high sibling risk ratio of the disease support the existence of genetic predisposition as well as the influence of enviromental factors in BD.3 A complex interaction between T cells, neutrophils and antigen-presenting cells (APCs) plays an important role in the immunopathogenesis of BD. In BD, T helper (Th)1 polarization occurs in the adaptive immune system. APCs fortify this Th1 polarization, inducing neutrophil hyperactivity that results in increased chemotaxis, phagocytosis, superoxide production amd myeloperoxidase expression.4 Production of interleukin (IL)-1, IL-4, IL-6, IL-8, IL-10, IL-13, IL-18 and tumour necrosis factor (TNF)-a increases, and an abnormal immune response develops.5 Recent studies have revealed that in addition to Th1 polarization, there is involvement of
Clinical and Experimental Dermatology (2014) 39, pp881–887
881
IL-23R polymorphism in Behcet disease B. Yalcßin et al.
Th17 cells and their main product, IL-17, in the pathogenesis of BD.6 Regarding genetic factors, presence of the HLA-B51 allele seems to be the most strongly associated risk factor.7 Cross-presentation of particular self antigens that have molecular homology with some infectious molecules may lead to an autoreactive immune response in BD.2–8 Additionally, several other genes located outside the major histocompatibility locus have been proposed to be involved in the pathogenesis of BD, including the genes for TNF, IL-1, nuclear factor kappa B (NFkB), coagulation factor V, intercellular adhesion molecule-1, endothelial nitric oxide synthetase, Mediterranean Fever and heat shock proteins.9–14 The products of these genes have been reported to play crucial roles in the immunoinflammatory pathogenesis of BD. In this study, we investigated five single nucleotide polymorphisms (SNPs) in the gene for the IL-23 receptor (IL-23R). IL-23R is a candidate gene in the development of autoimmune and inflammatory diseases according to National Human Genome Research Institute catalogue of genome-wide association studies (GWAS).15 These SNPs have been revealed in recent studies as being susceptibility factors in some autoimmune and inflammatory diseases such as inflammatory bowel disease, ankylosing spondylitis, psoriasis, psoriatic arthritis and rheumatoid arthritis; however, their roles in the pathogenesis of BD still need to be clarified.16–18
included. Clinical characteristics of the patients are shown in Table 1. Mean age at disease onset was 28.8 8.2 years and the mean duration of disease was 8.8 6.3 years. Information was collected from all participants, including their sex and age, disease history including age at the beginning of the disease, duration of the disease, and family history of BD. Clinical findings, including mucocutaneous (oral aphtous lesions, genital ulcers, papulopustular skin lesions, erythema nodosumlike lesions, pathergy positivity), ocular (anterior or posterior uveitis, hypopyon, retinal vasculitis, cystoid macular degeneration), joint (arthritis), gastrointestinal (visualization of ulceration of oesophagus and intestinal sections during endoscopy and colonoscopy), cardiovascular [venous involvement, (usually in the form of superficial thrombophlebitis), arterial disease, aneurysms in the pulmonary arterial tree, right-sided cardiac thrombosis, vasculitis of the small and large vessels] and central nervous system (behavioural changes such as apathy or disinhibition, seizures and bulbar signs, ophthalmoplegia, meningoencephalitis, lymphocytic meningeal infiltration, or demyelinization, or infarctions due to vasculitis or thrombosis) symptoms were noted for each patient.1,2,7,19 Single nucleotide polymorphism selection
The study was approved by our institutional ethics committee, and carried out in concordance with the Declaration of Helsinki. Written informed consent was obtained from all participants.
We selected five SNPs in the IL-23R gene: rs11209026, rs7517847, rs11805303, rs1004819 and rs17375018. Of these, rs11209026, rs7517847, rs11805303 and rs1004819 have previously been described as susceptibility factors for several autoimmune inflammatory diseases in the National Human Genome Research Institute catalogue of GWAS. The rs17375018 variant has not been reported to be
Patients
Table 1 Clinical features of patients with Behcßet disease.
Methods
Consecutive patients meeting International Study Group criteria for BD were enrolled. The control group consisted of healthy individuals or patients with acne vulgaris, skin infections, melasma, hyperhidrosis or hand eczema, who did not have a medical history of autoimmune or autoinflammatory rheumatological disorders.19 Both groups were matched for age and sex. Individuals who were younger than 18 years or who had any chronic inflammatory skin disorder or any systemic disease were excluded. In total, 123 patients with BD (47 men, 75 women; mean age 37.7 10.1 years) and 168 controls (56 men, 112 women; mean age 39.9 13.1 years) were
882
Clinical and Experimental Dermatology (2014) 39, pp881–887
Patients
Family history Oral aphtous lesion Genital ulcer Papulopustular skin lesion Erythema nodosum-like lesion Pathergy Eye involvement Joint involvement Vascular involvement Gastrointestinal involvement Neurological involvement
n
%
32 123 113 80 78 60 34 35 24 13 9
26 100 91.8 65.0 63.4 48.7 27.6 28.4 19.5 10.5 7.3
ª 2014 British Association of Dermatologists
IL-23R polymorphism in Behcet disease B. Yalcßin et al.
associated with any autoimmune or systemic disease other than BD. Genotyping
SNaPshot assays were carried out according to the manufacturer’s recommendations. Capillary electrophoresis of the SNaPshot reactions were also carried out according to the manufacturer’s recommendations, using a capillary electrophoresis instrument (ABI 3130; Applied Biosystems Inc.). Genotyping of polymorphisms was performed by analysing the electrophoregrams obtained during capillary electrophoresis, using GeneMapper v.4.0 software (Applied Biosystems Inc.).
Peripheral blood samples from each participant were collected into 10 mL EDTA tubes. DNA was isolated (QIAamp DNA Blood Mini Kit; Qiagen Inc., Valencia, CA, USA) from 200 lL peripheral blood samples, and stored at 20 °C until the PCR step. The PCR mixture consisted of 17.8 lL distilled H2O, 2.5 lL 10 9 complete buffer (Bioron Inc., Ludwigshafen, Germany), 0.5 lL dNTP mix (10 mmol/L each), 1 lL forward primer (5 lmol/L), 1 lL reverse primer (5 lmol/L), 0.2 lL SuperHotTaq (Bioron Inc.) and 2 lL DNA template (20–50 ng/lL). The mixture was incubated for 10 min at 95 °C, followed by 35 cycles at 95 °C for 45 s, 60 °C for 45 s and 72 °C for 45 s, with a final extension at 72 °C for 10 min. Of these samples, 10% were tested twice to validate the genotyping results, and gave 100% reproducibility. PCR samples were separated in 2% agarose gels by electrophoresis. All eight reactions for each sample were combined and purified (NucleoFast 96 PCR Kit; Macherey-Nagel GmbH, D€ uren, Germany).
All tests were performed using SPSS v.13.0 (SPSS Inc., Chicago, IL, USA). The frequencies of alleles in the patient and control groups were compared by the Fisher exact test and genotypes of polymorphisms in the patient and control groups were compared by the v² test. For each test P < 0.05 was considered statistically significant. Odds ratios (OR) and 95% confidence interval (CI) were also calculated whenever v2 test or Fisher exact v2 test was significant. The associations between genotypes of the polymorphisms and BD, and clinical features of BD were estimated by computing the OR and 95% CI from logistic regression analyses.
Polymorphism detection
Results
Screening of polymorphisms was carried out using the SNaPshot multiplex system (Applied Biosystems Inc., Foster City, CA, USA). For this purpose, three primers were designed for each of the eight polymorphisms; two primers for PCR and one for the SNaPshot reaction. Primer sequences are shown in Table 2.
Genotype and allele frequencies of the five IL-23R polymorphisms (rs11209026, rs7517847, rs17375018, rs11805303 and rs1004819) in the patient and control groups are shown in Table 3. Genotypically, rs17375018 GA (P = 0.01; RR = 0.53, 95% CI 0.3– 0.8) and rs17375018 AA (P = 0.02; RR = 0.26, 95%
Statistical analyses
Table 2 Primers used for polymorphism detection. Primer name
Sequence 50 ?30
Pr#29_1F Pr#29_1R Pr#29_2F Pr#29_2R Pr#29_3F Pr#29_3R Pr#29_4F Pr#29_4R Pr#29_5F Pr#29_5R Pr#29_rs 11209026 Pr#29_rs 7517847 Pr#29_rs 17375018 Pr#29_rs 11805303 Pr#29_rs 1004819
GAATGATCGTCTTTGCTGTTATGTTGTC CATTTGTAGAGAGTTTGGCATGGGTAAG CTCTTTCTTACTCCTTTCACCTATTCCCA TTTTGACATGAATTTGAGGGGCCTA CATTGCTATGTTGATTGAATCTAGAATGG GGTGTTTGTTTCCTTTTCTGACCTGTC ATTATTGTATGCTTGCAAACAGAGAACTG ATTTTTGTTTCCCTGGATGCCTGTC ATCTGGTGGAAATATGTGAAACCTAATCAG CTGTTATAGCAGCACAAGCATTCTAGGAC ACTGACTGACTGACTGCAGAAATTCTGCAAAAACCTACCCAGTT ACTGACTGACTGACTGACTGACTGACAGTTTCTAGCCTACATACAGGTGTAGCTG TGACTGAAAACCTAACCAAGTTCTGAATTGATGGA GACTGACTGACTGACTGACTGACAACTAATAAAAGGCAAGTGGATCGTTT ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACCTGACCTGCTTTATGCTGTGATTCTTACT
ª 2014 British Association of Dermatologists
Clinical and Experimental Dermatology (2014) 39, pp881–887
883
IL-23R polymorphism in Behcet disease B. Yalcßin et al.
Table 3 Genotype and allele frequencies of rs11209026, rs7517847, rs17375018, rs11805303 and rs100481 polymorphisms in the gene for interleukin-23 receptor in Behcßet disease and controls. Frequency, n (%) Polymorphism
Genotype/allele
Patients
Controls
P
OR
rs11209026
GG GA AA G A TT TG GG T G GG GA AA G A CC CT TT C T GG GA AA G A
– 9 114 237 9 60 52 11 172 74 80 39 4 199 47 37 61 25 135 111 38 61 24 137 109
– 15 153 321 15 75 74 19 224 112 79 73 15 233 103 54 87 27 195 141 56 86 26 198 138
– > 0.05
– –
0.01 – 0.02 > 0.05
0.53 0.26 1.16 –
rs7517847
rs17375018
rs11805303
rs1004819
(7.3) (92.7) (96.3) (3.6) (48.8) (42.3) (8.9) (69.9) (30.1) (65.0) (31.7) (3.3) (80.9) (19.1) (30.1) (49.6) (20.3) (54.9) (45.2) (30.9) (49.6) (19.5) (55.7) (44.3)
(8.9) (91.1) (95.5) (4.4) (44.6) (44.0) (11.3) (66.6) (33.4) (47) (43.5) (8.9) (69.4) (30.6) (32.1) (51.8) (16.1) (58.0) (42.0) (33.3) (51.2) (15.5) (58.9) (41.1)
95% CI – –
0.3–0.8 0.08–0.8 1.06–1.28 –
For single nucleotide polymorphisms, (wild-type/mutant) alleles are as follows: rs11209026 (G/A), rs7517847 (T/G), rs17375018 (G/ A), rs11805303 (C/T), rs1004819 (G/A).
CI 0.08–0.8) were statistically lower in patients than controls. However, no significant difference was detected between patients and controls in terms of genotypic distribution of the other polymorphisms studied (P > 0.05). The presence of G alleles compared with A alleles for rs17375018 was statistically higher in patients than controls (P = 0.02, OR = 1.16, 95% CI 1.06–1.28). No significant differences in allele frequencies for the other studied polymorphisms were detected between patients and controls (P > 0.05). The rs11209026 G allele was significantly more common in male patients (97.8%) than in male controls (85.4%) (P = 0.02, OR = 1.14, 95% CI 1.05– 1.24) when comparisons were made according to gender between the patient and control groups. The genotypic and allelic distributions of rs11209026, rs7517847, rs17375018, rs11805303 and rs1004819 were also investigated according to the clinical features of BD and the family history. The rs7517847 GG genotype was statistically less common in patients with than in patients without genital ulcers (P = 0.12, RR = 0.08, 95% CI 0.01– 0.5). The rs11805303 TT genotype was significantly
884
Clinical and Experimental Dermatology (2014) 39, pp881–887
more common in patients with than in patients without papulopustular lesions (P = 0.01, RR = 5.8, 95% CI 1.4–23.4). The rs7517847 G allele (P = 0.03, OR = 4.7, 95% CI 1.4–15.6) allele (P = 0.01, OR = 22.2, 95% CI 2.2–224.0) was statistically more common in patients with than in patients without genital ulcer, and the rs11805303 C (P = 0.01, OR = 1.2, 95% CI 1.0–1.4) and rs1004819 G (P = 0.01, OR = 1.25, 95% CI 1.0–1.4) alleles were statistically more common in patients with than in patients without papulopustular lesions. The rs11209026 G allele was more common in patients with papulopustular lesions, and this was close to statistical significance (P = 0.06). The rs17375018 G and rs1004819 G alleles were more common in patients with vascular involvement, and these rates were also close to statistical significance (P = 0.09 and P = 0.07, respectively).
Discussion In this study, we evaluated selected inflammationrelated SNPs for associations with BD susceptibility
ª 2014 British Association of Dermatologists
IL-23R polymorphism in Behcet disease B. Yalcßin et al.
and its clinical characteristics. IL-23 is a critical cytokine that serves in defence against microbial agents. It has a crucial effect on the maintenance of Th17 cells, which are potent inducers of tissue inflammation. Aberrant Th17 response occurs in chronic inflammatory diseases with autoimmune aetiology.20 Recently, Th17 cells have been shown to have a significant role in BD. In addition to Th1 response, cytokines released from Th17 cells have been suggested to be involved in the pathogenesis of BD.6 Serum levels of IL-17, IL-23, IL-12/23p40 and interferon-c were found to be significantly increased in patients with BD.21 IL-23 acts via Janus kinase–signal transducer and activator of transcription (JAK-STAT) and NFjB after binding to IL-23R, which is expressed in activated/memory T cells, dendritic cells and natural killer cells.22 A recent study by Lew et al. showed increased IL-23 p19 mRNA expression in erythema nodosum-like lesions of patients with active BD, and the authors suggested that IL-23 has a pathogenetic effect on the development of BD skin lesions.23 The IL-23R gene is located on chromosome 1p31, which exhibits many SNPs in its gene locus. Some of these SNPs are associated with autoimmune and inflammatory diseases such as Crohn disease, ulcerative colitis, psoriasis, psoriatic arthritis, ankylosing spondylitis and rheumatoid arthritis.15–18 Protective SNPs that cause loss of function have also been defined in the IL23R gene.24 In the present study, we found that in our Turkish patients, the incidence of the rs17375018 G allele was significantly higher and the incidence of the rs17375018 AA/GA genotypes was significantly lower compared with controls. However, we did not find any associations between the rs11209026, rs7517847, rs11805303 or rs1004819 variants and BD. In the literature, there are two published articles related to SNPs in the IL-23R gene in BD. Xavier et al. investigated 40 different SNPs in the IL-23R gene in an Iranian populaiton, and found that the rs17375018 G allele and rs7517847 T allele frequencies were higher in patients with BD compared with controls.15 Jiang et al. similarly showed that the rs17375018 GG genotype and G allele frequencies were higher in BD in their Chinese Han population.25 In our study, we also found an increased frequency of the rs17375018 G allele, which may indicate a possible association of this allele with BD in the Turkish population. This finding is notable because although rs17375018 has not been associated with any autoimmune or inflammatory diseases, there seems to be a close association of this variant with
ª 2014 British Association of Dermatologists
BD. Considering the results of our study together with those of the two other studies, the rs17375018 variant of the IL-23R gene seems to be a strong susceptibility factor for BD, and may even be specific for BD. Additionally, as the rs17375018 variant has now been shown to be associated with BD in thee different populations (Iranian, Chinese Han and Turkish), we believe that the association of this variant with BD is not limited to a specific geographic region or a specific ethnic group. Other findings from the present study were the statistically higher incidences of the rs11209026 G allele in male patients with BD, of the rs7517847 G allele in patients with genital ulcer, and of the rs1004819 G and rs11805303 C alleles in patients with papulopustular lesions. Additionally, we found that the incidence of the rs1373692 G allele was relatively higher in patients with ocular involvement, and the incidences of the rs17375018 G and rs1004819 G alleles were relatively higher in patients with vascular involvement; these did not reach statistical significance, but it is possible that they might do so in a larger study group. In our study, we did not find any associations of the aforementioned variants with BD except for rs17375018. However, BD is a syndrome with a wide spectrum of clinical findings, and it is possible that related SNPs in the IL-23R gene could determine the presenting clinical findings in some patients. Another important finding in our study was the presence of a strong correlation between the rs11805303 and rs1004819 SNPs (P < 0.05; r = 0.95). Linkage disequilibrium (LD) between rs17375018/rs924080 and rs17375018/rs1495965 in IL-23R gene were reported in previous studies, but to our knowledge, the correlation between rs11805303 and rs1004819 has not been reported previously. We believe that the strong correlation we found between rs11805303 and rs1004819 may also be due to a strong LD, and propose interchangeable use of these variants in further studies. Identification of certain IL-23R genotypes conferring a predilection for BD not only elucidates the role of IL-23 in disease pathogenesis, but also indicates certain therapeutic managements as well. IL23 antagonists available as monoclonal antibodies target cytokines and effectively attenuate IL-23-mediated diseases such as Crohn disease, psoriasis and sarcoidosis.26 Thus, IL-23-targeting monoclonal antibodies might offer enhanced anti-inflammatory effects in BD management.
Clinical and Experimental Dermatology (2014) 39, pp881–887
885
IL-23R polymorphism in Behcet disease B. Yalcßin et al.
Conclusion We suggest that the rs17375018 variant in IL-23R gene is a strong susceptibility factor for BD in the Turkish population. As this same variant was found as a susceptibility factor for patients with BD in Iranian and Chinese Han populations, it may be specific for BD. However, further studies in different ethnic groups are needed to confirm this possibility.
Acknowledgement This work was supported by the Dermatoimmunology Society, Turkey.
What’s already known about this topic? ● BD is a chronic, multisystemic disease, charac-
terized by relapsing episodes of a wide spectrum of clinical symptoms. ● Several genetic and immunological factors have been suggested to be involved in the aetiopathogenesis of BD.
What does this study add? ● The rs17375018 variant of the IL-23R gene
seems to be a strong susceptibility factor for BD in the Turkish population. ● As this variant was also shown to have an increased frequency in BD in two previous studies with subjects from different ethnic backgrounds, it may be specific for BD.
References € 1 Behcßet H. Uberrezidivierende aphthouse durchein virus verursachte Geschwuere am Mund, am Auge und an den Genitalien. Dermatol Monatsschr Wochenschr 1937; 105: 1152–7. 2 Kapsimali VD, Kanakis MA, Vaiopoulos GA, Kaklamanis PG. Etiopathogenesis of Behcßet’s disease with emphasis on the role of immunological aberrations. Clin Rheumatol 2010; 29: 1211–16. 3 James DG. ‘Silk route disease’ (Behcßet’s disease). West J Med 1988; 148: 433–7.
886
Clinical and Experimental Dermatology (2014) 39, pp881–887
4 Zhou ZY, Chen SL, Shen N, Lu Y. Cytokines and Behcet’s disease. Autoimmun Rev 2012; 11: 699–704. 5 Mendoza-Pinto C, Garcıa-Carrasco M, Jimenez-Hern andez M et al. Etiopathogenesis of Behcet’s disease. Autoimmun Rev 2010; 9: 241–5. 6 Hamzaoui K. Th17 cells in Behcßet’s disease: a new immunoregulatory axis. Clin Exp Rheumatol 2011; 29: S71–6. 7 Maldini C, Lavalley MP, Cheminant M et al. Relationships of HLA-B51 or B5 genotype with Behcet’s disease clinical characteristics: systematic review and meta-analyses of observational studies. Rheumatology (Oxford) 2012; 51: 887–900. 8 Direskeneli H. Behcßet’s disease: infectious aetiology, new autoantigens, and HLA-B51. Ann Rheum Dis 2001; 60: 996–1002. 9 Yalcin B, Atakan N, Alli N. The functional role of nuclear factor kappa-kappaB1-94 ins/del ATTG promotor gene polymorphism in Behcßet’s disease: an exploratory study. Clin Exp Dermatol 2008; 33: 629–33. 10 Marcos M, Hern andez-Garcıa I, Calvo A et al. Association of allelic variants of factor V Leiden, prothrombin and methylenetetrahydrofolate reductase with thrombosis or ocular involvement in Behcßet’s disease: a systematic review and meta-analysis. Autoimmun Rev 2013; 12: 607–16. 11 Ben Dhifallah I, Karray EF, Sassi F, Hamzaoui K. Intercellular adhesion molecule 1 K469E gene polymorphism is associated with presence of skin lesions in Tunisian Behcßet’s disease patients. Tissue Antigens 2010; 75: 74–8. 12 Lee YH, Song GG. Associations between eNOS polymorphisms and susceptibility to Behcet’s disease: a meta-analysis. J Eur Acad Dermatol Venereol 2012; 26: 1266–71. 13 Kirino Y, Zhou Q, Ishigatsubo Y et al. Targeted resequencing implicates the familial Mediterranean fever gene MEFV and the toll-like receptor 4 gene TLR4 in Behcßet disease. Proc Natl Acad Sci 2013; 110: 8134–9. 14 Kaneko F, Oyama N, Yanagihori H et al. The role of streptococcal hypersensitivity in the pathogenesis of Behcßet’s disease. Eur J Dermatol 2008; 18: 489–98. 15 Xavier JM, Shahram F, Davatchi F et al. Association study of IL10 and IL23R-IL12RB2 in Iranian patients with Behcßet’s disease. Arthritis Rheum 2012; 64: 2761– 72. 16 Duan Z, Pan F, Zeng Z et al. Interleukin-23 receptor genetic polymorphisms and ankylosing spondylitis susceptibility: a meta-analysis. Rheumatol Int 2012; 32: 1209–14. 17 Safrany E, Pazar B, Melegh BI et al. Marked diversity of IL23R gene haplotype variants in rheumatoid arthritis comparing with Crohn’s disease and ankylosing spondylitis. Mol Biol Rep 2013; 40: 359–63.
ª 2014 British Association of Dermatologists
IL-23R polymorphism in Behcet disease B. Yalcßin et al.
18 Bowes J, Barton A. The genetics of psoriatic arthritis: lessons from genome-wide association studies. Discov Med 2010; 10: 177–83. 19 International Study Group for Behcßet’s Disease. Criteria for diagnosis of Behcßet’s disease. International Study Group for Behcßet’s Disease. Lancet 1990; 335: 1078–80. 20 Toussirot E. The IL23/Th17 pathway as a therapeutic target in chronic inflammatory diseases. Inflamm Allergy Drug Targets 2012; 11: 159–68. 21 Na SY, Park MJ, Park S, Lee ES. Up-regulation of Th17 and related cytokines in Behcßet’s disease corresponding to disease activity. Clin Exp Rheumatol 2013; 31: 32–40. 22 Che Mat NF, Zhang X, Guzzo C, Gee K. Interleukin23-induced interleukin-23 receptor subunit expression is mediated by the Janus kinase/signal transducer and activation of transcription pathway in human CD4 T cells. J Interferon Cytokine Res 2011; 31: 363–71.
ª 2014 British Association of Dermatologists
23 Lew W, Chang JY, Jung JY, Bang D. Increased expression of interleukin-23 p19 mRNA in erythema nodosum-like lesions of Behcßet’s disease. Br J Dermatol 2008; 158: 505–11. 24 Sarin R, Wu X, Abraham C. Inflammatory disease protective R381Q IL23 receptor polymorphism results in decreased primary CD4+ and CD8+ human T-cell functional responses. Proc Natl Acad Sci 2011; 108: 9560–5. 25 Jiang Z, Yang P, Hou S et al. IL-23R gene confers susceptibility to Behcet’s disease in a Chinese Han population. Ann Rheum Dis 2010; 69: 1325–8. 26 Benson JM, Peritt D, Scallon BJ et al. Discovery and mechanism of ustekinumab: a human monoclonal antibody targeting interleukin-12 and interleukin-23 for treatment of immune-mediated disorders. MAbs 2011; 3: 535–45.
Clinical and Experimental Dermatology (2014) 39, pp881–887
887
