Genetics

Association of TLR2 Gene Polymorphisms With Ocular Beh¸cet’s Disease in a Chinese Han Population Jing Fang,1,2 Ranran Hu,1 Shengping Hou,1 Zi Ye,1 Qin Xiang,1 Jian Qi,1 Yan Zhou,1 Aize Kijlstra,3 and Peizeng Yang1 1

The First Affiliated Hospital of Chongqing Medical University, Chongqing Key Laboratory of Ophthalmology and Chongqing Eye Institute, Chongqing, People’s Republic of China 2Department of Ophthalmology, Children’s Hospital, Chongqing Medical University, Chongqing, People’s Republic of China 3 University Eye Clinic Maastricht, Maastricht, The Netherlands

Correspondence: Peizeng Yang, The First Affiliated Hospital of Chongqing Medical University, Chongqing Key Laboratory of Ophthalmology and Chongqing Eye Institute, Chongqing, People’s Republic of China, 400016; [email protected]. JF and RH contributed equally to the work presented here and should therefore be regarded as equivalent authors. Submitted: July 20, 2013 Accepted: November 9, 2013 Citation: Fang J, Hu R, Hou S, et al. Association of TLR2 gene polymorphisms with ocular Beh¸cet’s disease in a Chinese Han population. Invest Ophthalmol Vis Sci. 2013;54:8384– 8392. DOI:10.1167/iovs.13-12878

PURPOSE. TLR2, TLR4, TLR8, and TLR9 have been reported to be associated with several autoimmune diseases. The current study aimed to explore whether singe nucleotide polymorphisms (SNPs) of these four genes were associated with ocular Beh¸cet’s disease (BD), Vogt-Koyanagi-Harada (VKH) syndrome, acute anterior uveitis (AAU) with or without ankylosing spondylitis (AS), or pediatric uveitis in Han Chinese. METHODS. Genotyping was performed by PCR–restriction fragment length polymorphism. The first stage study comprised 400 ocular BD patients, 400 VKH syndrome patients, 400 AAU 6 AS patients, 400 pediatric uveitis patients and 600 healthy subjects. The second stage included 438 ocular BD patients and 1000 healthy subjects. Allele and genotype frequencies were compared between patients and controls using the v2 test. Real-time PCR was used to detect mRNA expression from PBMCs obtained from healthy controls. Levels of TNF-a, IL-6, IL-10, and IL-1beta in culture supernatants were measured by ELISA. RESULTS. In the first stage study, only the frequencies of the rs2289318/TLR2 genotype A and C allele and rs3804099/TLR2 genotype CT were significantly higher in ocular BD patients (Pc ¼ 0.048; Pc ¼ 0.008; Pc ¼ 0.005, respectively) compared with controls. The second stage and combined studies confirmed the association (Pc ¼ 0.001; Pc ¼ 6.89E-06, Pc ¼ 2.426E-06, respectively). TLR2 mRNA expression in PBMCs was increased in healthy carriers of the CC genotype of rs2289318/TLR2 and TT genotype of rs3804099/TLR2 following stimulation with peptidoglycan (PGN; P ¼ 0.028; P ¼ 0.004, respectively). No effect of the various TLR2 rs2289318 and rs3804099 genotypes on the release of TNF-a, IL-6, IL-10, and IL-1beta could be detected. CONCLUSIONS. This study provides evidence that the TLR2 gene is involved in the susceptibility to ocular BD. Keywords: TLRs, TLR2, TLR4, TLR8, TLR9, Beh¸cet’s disease, VKH syndrome, acute anterior uveitis, ankylosing spondylitis, pediatric uveitis

veitis is a serious intraocular inflammation that can lead to visual impairment. It can be caused by infectious or noninfectious mechanisms.1 Noninfectious uveitis entities can be mediated by autoinflammatory or autoimmune mechanisms,2 whereby infectious triggers may also play a role.3 Toll-like receptors (TLRs) are thought to be one of the links between infection and autoinflammatory or autoimmune disease. TLRs, together with retinoic acid-inducible gene 1–like receptors (RLRs) and nucleotide oligomerization domain–like receptors (NLRs), are members of the family of pattern recognition receptors (PRRs), which represent the main innate immune sensors. So far, 13 distinct mammalian TLRs have been identified, 10 of which are functional in humans (TLR1–10).4 TLRs have been shown to play a role in the pathogenesis of various inflammatory diseases including uveitis.5,6 One of the approaches to study the role of TLRs is aimed at identifying disease associations with certain TLR gene polymorphisms. Abundant evidence is now available to show that several autoimmune diseases including rheumatoid arthritis (RA),

systemic sclerosis (SS), Beh¸cet’s disease (BD), and systemic lupus erythematosus (SLE) are associated with certain TLR gene polymorphisms. 7–10 The role of TLR genotypes in the pathogenesis of noninfectious uveitis has been studied in patients with anterior uveitis, Vogt-Koyanagi-Harada (VKH) syndrome, and sarcoid uveitis, but to date no significant associations have been reported.11–13 A positive association with TLR variants and Beh¸cet’s disease has been reported in some studies,9,14 but could not be seen in others.14–17 This may have been due to the small sample size used in these studies or to the fact that not all TLRs were studied. We repeated these studies and tested four different TLRs; and to obtain a sufficient sample size, we chose a number of frequently occurring noninfectious uveitis entities in a population of Chinese Han. We found a significant association with a polymorphism for the gene encoding TLR-2 in ocular BD patients, but not in the other uveitis entities studied such as VKH syndrome, acute anterior uveitis (AAU), AAU associated ankylosing spondylitis (AAUþASþ) or pediatric uveitis (PU). No association was found

Copyright 2013 The Association for Research in Vision and Ophthalmology, Inc. www.iovs.org j ISSN: 1552-5783

8384

U

IOVS j December 2013 j Vol. 54 j No. 13 j 8385

Association of TLR2 Gene Polymorphisms TABLE 1. Clinical Features of the Investigated Ocular BD Patients

TABLE 3. Clinical Features of the Investigated AAU 6 AS Patients

Patients With BD

Patients With AAU Disease

Clinical Features

N ¼ 838

%

Age at onset, y 6 SD Uveitis Oral ulcer Genital ulcer Skin lesions Pathergy reaction Hypopyon Arthritis

31.1 6 9.8 838 838 435 552 216 191 140

100 100 51.9 65.9 25.8 22.8 16.7

with polymorphisms for the genes encoding TLR4, TLR8, or TLR9.

MATERIALS

AND

METHODS

Clinical Features

N ¼ 400

%

Age at onset, y 6 SD Age of AAU þ AS at onset, y 6 SD Age of AAU  AS at onset, y 6 SD AAU þ AS AAU  AS HLA-B27(þ) HLA-B27()

39.2 6 10.0 38.9 6 9.6 39.5 6 10.3 209 191 147 253

52.3 47.7 36.8 63.2

from Chinese Han descendents. The study protocol was approved by the Ethics Committee of the First Affiliated Hospital of Chongqing Medical University, Chongqing, China (Permit Number: 2009-201008). All procedures followed the tenets of the Declaration of Helsinki. The patients and controls gave their written informed consent for this study.

Patients and Healthy Controls Study Population A two-stage case-control association study was performed. The first stage studied group comprised 400 ocular BD patients, 400 VKH syndrome patients, 400 AAU with or without AS patients, 400 PU patients and 600 healthy subjects who were referred to the Zhongshan Ophthalmic Center, Sun Yat-sen University, and the First Affiliated Hospital of Chongqing Medical University, Chongqing, China. The second stage included a total of 438 BD patients and 1000 healthy controls. All control subjects, which were collected from April 2005 to March 2013, were matched ethnically Han Chinese and geographically with the patients. The patients with ocular BD fulfilled the criteria of the International Study Group.18 The clinical features were recorded during follow-up and summarized in Table 1. The diagnosis of VKH syndrome was based on the First International Workshop criteria for VKH syndrome.19 The clinical characteristics of the patients are presented in Table 2. AAU patients were diagnosed principally according to clinical manifestations20,21 and the patients with AS fulfilled the modified New York criteria.22 The clinical characteristics of the AAU patients with or without AS are presented in Table 3. Pediatric uveitis was defined as uveitis (including anterior uveitis, intermediate uveitis, posterior uveitis and panuveitis) first presenting at an age below 16 years. The clinical characteristics of this patient group are shown in Table 4. Pediatric patients with BD, VKH syndrome, or with definite infectious uveitis were excluded. To obtain a comparable genetic background, we strictly chose the cases

TABLE 2. Clinical Features of the Investigated VKH Syndrome Patients Patients With VKH Syndrome Clinical Features

N ¼ 400

%

Age at onset, y 6 SD Uveitis Nuchal rigidity Headache Scalp allergy Tinnitus Alopecia Gray hair Vitiligo

33.5 6 8.9 400 52 204 40 156 84 104 100

100 13.0 51.0 10.0 39.0 21.0 26.0 25.0

SNP Selection and Genotyping In view of previously reported TLR gene associations, 9,10,23–26 we selected three SNPs (rs2289318, rs3804099, rs13150331) of TLR2; one SNP (rs7037117) of TLR4; one SNP (rs3764880) of TLR8; and three SNPs (rs187084, rs352139, rs352140) of TLR9 as our candidate SNPs to explore the possible association with BD, VKH syndrome, AAU with or without AS, and PU. Heparinized blood samples were taken from patients and controls and genomic DNA was isolated with a DNA purification kit (QIAamp DNA Blood Mini Kit; Qiagen, Valencia, CA). The extracted DNA was stored at 208C until used. Samples were genotyped by PCR–restriction fragment length polymorphism (PCR-RFLP) for rs2289318, rs3804099, rs13150331, rs7037117, rs187084, rs352139, rs352140, or by PCR assay (TaqMan SNP Genotyping Assay; Applied Biosystems, Foster City, CA) for rs3764880. The genotyping success rate ranged between 97.9% to 98.4% for the various groups. We randomly selected 5% of the samples to undergo direct sequencing to validate the results of genotyping by PCRRFLP and PCR assay (Life Technologies, Beijing, China). The primers of rs2289318, rs3804099, rs13150331, rs7037117, rs187084, rs352139, and rs352140 used to amplify target DNA sequences by PCR are shown in Supplementary Table S1. Digestion products were visualized on a 5% agarose gel (rs7037117, rs352139) or 4% agarose gel (rs2289318, rs3804099, rs13150331, rs187084, rs352140) and stained with a nucleic acid stain (GoldView; SBS Genetech, Beijing, China). Restriction enzymes were purchased from Thermo Fisher Scientific. Direct sequencing was performed by Majorbio Biotechnology Company (Shanghai, China) using randomly selected subjects (5% of all samples) to validate

TABLE 4. Clinical Features of the Investigated PU Patients Patients With PU Clinical Features

N ¼ 400

%

Age at onset, y 6 SD Uveitis Juvenile idiopathic arthritis Retinal vasculitis

14.4 6 8.9 400 29 28

100 7.3 7.0

IOVS j December 2013 j Vol. 54 j No. 13 j 8386

Association of TLR2 Gene Polymorphisms TABLE 5. Polymorphisms of TLR2, TLR4, TLR8, and TLR9 Genes in Ocular Beh¸cet’s Disease SNPs TLR2 (rs2289318)

Stage First

Replication

Combined

TLR2 (rs3804099) (TLR2/þ596)

First

Replication

Combined

TLR2 (rs13150331) (TLR2/-24438)

First

TLR4 (rs7037117)

First

TLR9 (rs187084)

First

TLR9 (rs352139)

First

TLR9 (rs352140)

First

TLR8 (rs3764880) male

First

TLR8 (rs3764880) female

First

Genotype Allele CC CG GG C G CC CG GG C G CC CG GG C G CC CT TT C T CC CT TT C T CC CT TT C T AA AG GG A G AA AG GG A G CC CT TT C T AA AG GG A G CC CT TT C T 0A 0G AA AG GG A G

Case, n (freq) 279 113 8 671 129 304 123 11 731 145 583 236 19 1402 274 32 135 233 199 601 38 154 246 230 646 70 289 479 429 1247 102 267 31 471 329 256 128 16 640 160 61 196 143 318 482 145 193 62 483 317 140 211 49 491 309 40 185 8 46 121 62 288

(0.698) (0.283) (0.020) (0.839) (0.161) (0.694) (0.281) (0.025) (0.834) (0.166) (0.696) (0.282) (0.023) (0.837) (0.163) (0.080) (0.338) (0.582) (0.249) (0.751) (0.087) (0.352) (0.561) (0.263) (0.737) (0.084) (0.345) (0.571) (0.256) (0.744) (0.255) (0.668) (0.078) (0.589) (0.411) (0.64) (0.32) (0.04) (0.8) (0.2) (0.153) (0.49) (0.358) (0.398) (0.603) (0.363) (0.483) (0.155) (0.604) (0.396) (0.350) (0.528) (0.123) (0.614) (0.386) (0.178) (0.822) (0.046) (0.263) (0.691) (0.177) (0.823)

Control, n (freq) 360 210 30 933 267 616 324 60 1556 444 976 534 90 2486 714 31 273 296 335 865 50 458 492 558 1442 81 731 788 893 2307 157 397 46 711 489 368 206 26 942 258 86 306 208 478 722 211 314 75 736 464 216 312 72 744 456 50 250 20 77 203 117 483

(0.600) (0.350) (0.050) (0.778) (0.223) (0.616) (0.324) (0.060) (0.778) (0.222) (0.610) (0.334) (0.056) (0.777) (0.223) (0.052) (0.455) (0.493) (0.279) (0.721) (0.050) (0.458) (0.492) (0.279) (0.721) (0.051) (0.457) (0.492) (0.279) (0.721) (0.262) (0.662) (0.077) (0.593) (0.407) (0.613) (0.343) (0.043) (0.785) (0.215) (0.143) (0.51) (0.347) (0.398) (0.602) (0.352) (0.523) (0.125) (0.613) (0.387) (0.360) (0.520) (0.120) (0.620) (0.380) (0.167) (0.833) (0.067) (0.257) (0.677) (0.195) (0.805)

P Value

Pc Value

0.002 0.025 0.015 0.001 0.001 0.005 0.103 0.005 0.001 0.001 2.84E-05 0.009 4.04E-05 8.62E-07 8.62E-07 0.071 2.12E-04 0.006 0.132 0.132 0.007 1.73E-04 0.015 0.363 0.363 0.001 1.01E-07 2.05E-04 0.085 0.085 0.814 0.848 0.961 0.867 0.867 0.394 0.443 0.797 0.419 0.419 0.688 0.535 0.725 0.97 0.97 0.726 0.206 0.176 0.667 0.667 0.746 0.816 0.905 0.778 0.778 0.738 0.738 0.35 0.882 0.739 0.497 0.497

0.048 0.6 0.36 0.008 0.008 0.03 0.618 0.03 0.002 0.002 0.001 0.216 0.001 6.89E-06 6.89E-06 1.704 0.005 0.144 1.056 1.056 0.042 0.001 0.090 0.726 0.726 0.024 2.426E-06 0.005 0.68 0.68 19.536 20.352 23.064 5.202 5.202 9.456 10.632 19.128 3.352 3.352 16.512 12.84 17.4 7.76 7.76 17.424 4.944 4.224 5.336 5.336 17.904 19.584 21.72 6.224 6.224 17.712 17.712 8.4 21.168 17.736 3.976 3.976

OR (95% CI) 1.537 0.731 0.388 1.489 0.672 1.414 0.815 0.404 1.439 0.695 1.462 0.783 0.363 1.470 0.680 1.596 0.696 1.433 0.855 1.170 1.805 0.642 1.323 0.920 1.087 1.709 0.626 1.375 0.889 1.125 0.966 1.027 1.012 0.985 1.016 1.121 0.900 0.920 1.096 0.913 1.075 0.923 1.049 0.997 1.003 1.048 0.849 1.284 0.961 1.041 0.957 1.031 1.024 0.974 1.027 1.081 0.925 0.671 1.033 1.071 0.889 1.125

(1.175–2.011) (0.556–0.962) (0.176–0.855) (1.180–1.878) (0.532–0.848) (1.113–1.798) (0.636–1.043) (0.210–0.775) (1.170–1.769) (0.565–0.855) (1.223–1.747) (0.652–0.940) (0.220–0.601) (1.260–1.714) (0.583–0.794) (0.957–2.661) (0.537–0.902) (1.110–1.849) (0.697–1.048) (0.954–1.434) (1.165–2.796) (0.509–0.809) (1.056–1.658) (0.769–1.101) (0.908–1.300) (1.227–2.381) (0.526–0.744) (1.162–1.627) (0.777–1.016) (0.984–1.287) (0.723–1.290) (0.785–1.342) (0.630–1.626) (0.821–1.181) (0.847–1.218) (0.862–1.457) (0.688–1.178) (0.487–1.738) (0.878–1.367) (0.732–1.139) (0.754–1.535) (0.717–1.189) (0.805–1.366) (0.830–1.196) (0.836–1.205) (0.805–1.365) (0.659–1.094) (0.893–1.846) (0.800–1.154) (0.867–1.250) (0.735–1.247) (0.800–1.328) (0.695–1.508) (0.810–1.171) (0.854–1.234) (0.684–1.708) (0.586–1.461) (0.289–1.557) (0.675–1.579) (0.716–1.600) (0.632–1.249) (0.800–1.582)

Association of TLR2 Gene Polymorphisms the result of the PCR-RFLP method used in our study. For rs3764880 (TaqMan assay ID: C_2183830_10), the genotype was determined by PCR assay (Applied Biosystems) on realtime PCR equipment (7500 Fast Real-Time PCR System; Applied Biosystems), according to the supplier manual. Negative controls were included in each plate. Genotype analysis was performed using a genotyping data analysis tool (TaqMan Genotyper Software; Life Technologies).

mRNA Expression PCR Peripheral blood mononuclear cells (PBMCs) obtained from healthy individuals were prepared from heparinized blood by Ficoll-Hypaque density-gradient centrifugation. Total RNA was extracted from PBMCs with or without stimulation by peptidoglycan (PGN, 5 lg/mL, Fluka, Buchs, Switzerland) for 72 hours at a density of 1 3 106 cells/mL, using a commercial reagent (TRIzol; Life Technologies), followed by reverse transcription using a transcriptase kit (Takara Biosystems). Real-time Quantitative PCR was performed to compare the mRNA expression of the TLR2 gene (sense primer: 5 0 GGAGGCTGCATATTCCAAGG 3 0 , antisense primer: 5 0 GCCAGGCATCCTCACAGG 3 0 ), using real-time PCR equipment with a commercial dye kit (SYBR Green I Assay kit; Applied Biosystems). Data were normalized to mRNA b-actin as reported by previous studies.21,22 The assays were performed on real-time PCR equipment (Applied Biosystems). Relative expression levels were calculated using the 2DDCt method.

Cytokine Measurements PBMCs obtained from healthy individuals were stimulated with PGN (5 lg/mL,) or anti-CD3 (5 lg/mL; eBioscience, San Diego, CA) plus anti-CD28 (5 lg/mL; eBioscience) plus PGN (5 lg/ mL) for 72 hours at a density of 1 3 106 cells/mL. The concentration of TNF-a, IL-6, IL-10, and IL-1b in cell culture supernatants was measured with a commercial ELISA kit (DuoSet ELISA Development Systems; R&D Systems, Minneapolis, MN).

Statistical Analysis Hardy-Weinberg equilibrium was tested using the v2 test. The patterns of linkage disequilibrium (LD) of the SNPs (rs2289318, rs3804099, rs13150331) of TLR2 (rs187084, rs352139, rs352140) and of TLR9 were compared using haplotype analysis software (Haploview 4.0; Broad Institute, Cambridge, MA), respectively. Genotype frequencies of all SNPs were estimated by direct counting except one SNP (rs3764880) of TLR8. Allele and genotype frequencies were compared between patients and controls by the v2 test using statistical software (SPSS, version 17.0; SPSS, Inc., Chicago, IL). As TLR8 is located on the X chromosome, the allele and genotype frequency of the SNP (rs3764880) of TLR8 was divided into two alleles and the frequencies were calculated according to sex. P values were corrected (Pc) for multiple comparisons with the Bonferroni correction by multiplying with the number of analyses performed. The number of independent comparisons is 24.

RESULTS Association of the Eight Gene Polymorphisms With Susceptibility to Ocular Beh¸cet’s Disease A total of 400 BD patients and 600 healthy controls were genotyped for seven TLR SNPs: three SNPs (rs2289318,

IOVS j December 2013 j Vol. 54 j No. 13 j 8387 rs3804099, rs13150331) of TLR2; one SNP (rs7037117) of TLR4; and three SNPs (rs187084, rs352139, rs352140) of TLR9. A total of 400 BD patients (male/female ¼ 225:175) and 600 (male/female ¼ 300:300) healthy controls were genotyped for one SNP (rs3764880) of TLR8. These eight SNPs were successfully genotyped and conformed to HardyWeinberg expectation in controls. Frequencies of the rs2289318/TLR2 genotype CC and C allele and rs3804099/ TLR2 genotype CT were significantly higher in BD patients (Pc ¼ 0.048, OR ¼ 1.537, 95% confidence interval [CI] 1.175–2.011; Pc ¼ 0.008, OR ¼ 1.489, 95% CI 1.180–1.878; Pc ¼ 0.005, OR ¼ 0.696, 95% CI 0.537–0.902, respectively) compared with controls. The P values of the rs2289318/ TLR2 genotype GG or CG and rs3804099/TLR2 genotype TT lost significance following Bonferroni correction. After extending the number of BD cases (n ¼ 838) and healthy controls (n ¼ 1600), we confirmed the association with the rs2289318/TLR2 genotype CC and C allele and rs3804099/ TLR2 genotype CT (Pc ¼ 0.001, OR ¼ 1.462, 95% CI 1.223– 1.747; Pc ¼ 6.89E-06, OR ¼ 1.470, 95% CI 1.260–1.714; Pc ¼ 2.426E-06, OR ¼ 0.626, 95% CI 0.526–0.744, respectively) and found that the corrected P value for rs2289318 genotype GG and rs3804099 genotype CC and TT were significant (Pc ¼ 0.001, OR ¼ 0.363, 95% CI 0.220–0.601; Pc ¼ 0.024, OR ¼ 1.709, 95% CI 1.227–2.381; Pc ¼ 0.005, OR ¼ 1.375, 95% CI 1.162–1.627, respectively; Table 5). No significant differences were found between BD patients and controls concerning the frequencies of the other six SNPs (Table 5). We also studied the association of polymorphisms of the four genes with the clinical features of the BD patients, using stratified analysis. A significantly higher frequencies of CC genotype and C allele of rs2289318 and rs3804099 were noticed in BD patients with genital ulcers (Table 6). A significantly higher frequency of CT, TT genotypes, and C allele of rs3804099 was also noticed in BD patients with pathergy reaction (Table 6). No significant statistical association was found for the other six SNP genotypes and clinical manifestations in BD.

Association of the Eight Gene Polymorphisms With Susceptibility to VKH Syndrome, AAU With or Without Ankylosing Spondylitis or Pediatric Uveitis A total of 400 VKH patients, 400 AAU with or without AS patients, 400 PU patients, and 600 healthy controls were genotyped for seven SNPs: three SNPs (rs2289318, rs3804099, rs13150331) of TLR2; one SNP (rs7037117) of TLR4; and three SNPs (rs187084, rs352139, rs352140) of TLR9. A total of 400 VKH patients (male/female ¼ 214:186), 400 AAU 6 AS patients (male/female ¼ 193:207), 400 PU patients (male/female ¼ 199:201), and 600 (male/female ¼ 300:300) healthy controls were genotyped for one SNP (rs3764880) of TLR8. The eight SNPs were successfully genotyped and conformed to HardyWeinberg expectation in controls. The genotype and allele frequencies of the eight SNPs examined in VKH syndrome, AAU with or without AS, or PU patients and healthy controls are summarized in Supplementary Tables S2, S3, and S4, respectively. There were no statistically significant differences concerning the genotype or allele frequencies of the eight SNPs between VKH syndrome, AAU with or without AS, PU, and healthy controls following Bonferroni correction.

IOVS j December 2013 j Vol. 54 j No. 13 j 8388

Association of TLR2 Gene Polymorphisms

TABLE 6. Polymorphisms of the TLR2 Gene in Patients With Extraocular Features of BD Versus Healthy Controls SNP rs2289318

Clinical Features Genital ulcer

Skin lesions

Pathergy reaction

Hypopyon

Arthritis

rs3804099

Genital ulcer

Skin lesions

Pathergy reaction

Hypopyon

Arthritis

Genotype CC CG GG C G CC CG GG C G CC CG GG C G CC CG GG C G CC CG GG C G CC CT TT C T CC CT TT C T CC CT TT C T CC CT TT C T CC CT TT C T

BD Patients, n (%) 299 121 15 719 151 355 181 16 891 213 141 65 10 347 85 122 58 11 302 80 84 48 8 216 64 40 215 180 295 575 41 270 241 352 752 15 123 78 153 279 11 91 89 113 269 8 61 71 77 203

(0.687) (0.278) (0.034) (0.826) (0.174) (0.643) (0.328) (0.029) (0.807) (0.193) (0.653) (0.301) (0.046) (0.803) (0.197) (0.639) (0.304) (0.058) (0.791) (0.209) (0.600) (0.343) (0.057) (0.771) (0.229) (0.092) (0.494) (0.414) (0.339) (0.661) (0.074) (0.489) (0.437) (0.319) (0.681) (0.069) (0.569) (0.362) (0.354) (0.646) (0.079) (0.476) (0.466) (0.296) (0.704) (0.057) (0.436) (0.507) (0.275) (0.725)

Relationship Between Two SNPs (rs2289318, rs3804009) of TLR2 Genotypes and the Corresponding Gene Expression at the mRNA Level Since we found that polymorphisms of TLR2 showed an association with susceptibility to ocular BD, we investigated whether the different genotypes studied affect the expression of TLR2 under normal or inflammatory conditions. Real-time PCR was performed to detect mRNA expression from PBMCs obtained from healthy controls. We genotyped healthy

Controls, n (%) 976 534 90 2486 714 976 534 90 2486 714 976 534 90 2486 714 976 534 90 2486 714 976 534 90 2486 714 81 731 788 893 2307 81 731 788 893 2307 81 731 788 893 2307 81 731 788 893 2307 81 731 788 893 2307

(0.610) (0.334) (0.056) (0.777) (0.223) (0.610) (0.334) (0.056) (0.777) (0.223) (0.610) (0.334) (0.056) (0.777) (0.223) (0.610) (0.334) (0.056) (0.777) (0.223) (0.610) (0.334) (0.056) (0.777) (0.223) (0.051) (0.457) (0.492) (0.279) (0.721) (0.051) (0.457) (0.492) (0.279) (0.721) (0.051) (0.457) (0.492) (0.279) (0.721) (0.051) (0.457) (0.492) (0.279) (0.721) (0.051) (0.457) (0.492) (0.279) (0.721)

P Value

Pc

0.003 0.028 0.399 0.002 0.002 0.167 0.801 0.011 0.035 0.035 0.225 0.335 0.547 0.214 0.214 0.441 0.403 0.939 0.542 0.542 0.816 0.827 0.965 0.834 0.834 1.00E-03 0.166 4.00E-03 1.00E-03 1.00E-03 0.038 0.190 0.023 0.012 0.012 0.246 2.00E-03 2.85E-04 1.00E-03 1.00E-03 0.680 0.608 0.488 0.491 0.491 0.737 0.630 0.740 0.884 0.884

0.045 0.140 1.995 0.030 0.030 0.835 4.005 0.055 0.175 0.175 1.125 1.675 2.735 1.070 1.070 2.205 2.015 4.695 2.710 2.710 4.080 4.135 4.825 4.170 4.170 0.015 2.490 0.060 0.01 0.01 0.570 2.850 0.345 0.06 0.06 3.690 0.030 0.004 0.01 0.01 10.200 9.120 7.320 2.46 2.46 11.055 9.450 11.100 4.42 4.42

OR (95% CI) 1.406 0.769 0.786 1.368 0.731 1.152 0.974 0.501 1.201 0.832 1.202 0.859 0.814 1.172 0.853 1.130 0.871 1.025 1.084 0.922 0.959 1.042 1.017 0.969 1.032 1.899 1.162 0.727 1.325 0.754 1.505 1.138 0.799 1.209 0.827 1.399 1.572 0.582 1.417 0.706 1.146 1.082 0.899 1.085 0.921 1.137 0.918 1.060 0.980 1.020

(1.121–1.762) (0.609–0.972) (0.449–1.376) (1.126–1.661) (0.602–0.888) (0.942–1.409) (0.793–1.197) (0.292–0.860) (1.012–1.426) (0.701–0.988) (0.893–1.619) (0.631–1.170) (0.417–1.591) (0.912–1.508) (0.663–1.097) (0.828–1.544) (0.629–1.205) (0.538–1.954) (0.836–1.406) (0.711–1.196) (0.674–1.365) (0.724–1.499) (0.483–2.141) (0.725–1.297) (0.771–1.380) (1.280–2.818) (0.940–1.436) (0.587–0.901) (1.129–1.556) (0.643–0.886) (1.020–2.220) (0.938–1.381) (0.657–0.970) (1.043–1.403) (0.713–0.959) (0.791–2.475) (1.180–2.094) (0.434–0.782) (1.146–1.751) (0.571–0.872) (0.599–2.192) (0.801–1.461) (0.666–1.215) (0.860–1.370) (0.730–1.163) (0.538–2.401) (0.648–1.300) (0.751–1.498) (0.745–1.288) (0.776–1.341)

individuals for the TLR2 SNPs (rs2289318, rs3804099) and then used real-time PCR to detect TLR2 mRNA expression by PBMCs with or without stimulation. No difference in gene expression could be detected between the various genotypes when PBMCs were not stimulated (Figs. 1, 2). Following stimulation by PGN, carriers with the CC genotype in SNP rs2289318 had a higher TLR2 mRNA expression compared with individuals carrying the CG genotype (P ¼ 0.028; Fig. 3) and carriers with the TT genotype in SNP rs3804099 had a higher TLR2 mRNA expression compared with individuals carrying the CC or CT genotype (P ¼ 0.004; P ¼ 0.02,

IOVS j December 2013 j Vol. 54 j No. 13 j 8389

Association of TLR2 Gene Polymorphisms

FIGURE 1. mRNA expression of different genotypes of rs2289318/ TLR2 by nonstimulated PBMCs. TLR2 expression was not significantly different between genotypes. Data are expressed as mean 6 SD.

respectively; Fig. 4). No significant difference was observed between CC and GG carriers of rs2289318 or CC and CT carriers of rs3804099, but this could be due to the fact that the numbers of individuals carrying the GG genotype of rs2289318 and the CC genotype of rs3804099 were very low (n ¼ 4; n ¼ 5, respectively).

Relationship Between the Two SNPs (rs2289318, rs3804099) of TLR2 Genotypes and Downstream Inflammatory Factors The aforementioned result showed that different genotypes of rs2289318 and rs3804099 could affect TLR2 expression and therefore a further study was designed to investigate if different genotypes of rs2289318 or rs3804099 could also affect the cytokine response of PBMCs following PGN stimulation. We measured the production of TNF-a, IL-6, IL10, and IL-1b, which are important TLR2 downstream factors27–29 in PBMC culture supernatants by ELISA. However,

FIGURE 2. mRNA expression of different genotypes of rs3804099/ TLR2 by nonstimulated PBMCs. TLR2 expression was not significantly different between genotypes. Data are expressed as mean 6 SD.

FIGURE 3. mRNA expression of different genotypes of rs2289318/ TLR2 by PGN stimulated PBMCs. TLR2 expression in carriers of the CC genotype was significantly higher than in individuals carrying the CG genotype (P ¼ 0.028). Data are expressed as mean 6 SD.

no effect of the various TLR2 rs2289318 or rs3804099 genotypes on the release of these four cytokines could be detected (data not shown).

DISCUSSION In this study, we investigated the association of gene polymorphisms of TLRs 2, 4, 8, and 9 with the risk of developing ocular BD, VKH syndrome, AAU with or without AS, and PU in a Han Chinese population and found an association between the TLR2 genes rs2289318 and rs3804099 with susceptibility to ocular BD stratification analysis also

FIGURE 4. mRNA expression of different genotypes of rs3804099/ TLR2 by PGN stimulated PBMCs. TLR2 expression in carriers of the TT genotype was significantly higher than in individuals carrying the CC or CT genotypes (P ¼ 0.004; P ¼ 0.02, respectively). Data are expressed as mean 6 SD.

Association of TLR2 Gene Polymorphisms showed an association between certain clinical features of ocular BD with the tested SNPs of TLR2 (rs2289318, rs3804099). In view of the association with TLR2, we performed further investigations into a possible functional association. This approach revealed that healthy carriers of the CC genotype in SNP rs2289318 and TT genotype in rs3804099 had a higher TLR2 mRNA expression level following stimulation by PGN, compared with individuals carrying the other genotypes. Our study is the first to report a TLR2 gene association with ocular BD and supports the absence of an association in other noninfectious uveitis entities. Earlier studies by Wakefield’s group did not show a correlation between AAU and TLR2 and TLR4 genotypes.30 Another Japanese study whereby only the TLR4 gene was investigated did not find an association with sarcoid uveitis.12 A small study in Japanese VKH patients (n ¼ 94) that was restricted to the TLR9 gene also did not observe a significant association.13 BD is one of the most commonly seen uveitis entities in China.31 The exact etiology of ocular BD is still unknown. It is becoming clear, however, that both genetic32,33 as well as environmental factors play a role in the development of this disease.34 A potential relationship between bacterial infection (i.e., Streptococcus sanguinis) and BD is based on findings of bacterial components and antibodies in the oral flora and serum of patients with BD.35 More data is becoming available concerning the genetic background of BD. In the recent years, we have reported on the association of various immune response related genes and susceptibility to BD, including signal transducer and activator of transcription (STAT)-4, STAT3, Janus kinase 2, and CD40.36–39 An association between the TLR2 SNPs rs3804099 and rs2289318 as we observed in ocular BD was recently also reported in a French cohort of asthma patients. Though the significance of the rs2289318 SNP lost significance after adjusting for multiple comparisons,23 the association of rs3804099/TLR2 with asthma remained. We did not find an association of the two TLR2 SNPs with susceptibility to VKH, AAU with or without AS, and PU. The discrepancy between ocular BD and the other uveitis entities may be due to the fact that the pathogenetic mechanisms for BD are unique and differ from these other three intraocular inflammatory diseases. Evidence is mounting that BD is an autoinflammatory disease caused by an aberrant response against infectious agents, which might also explain a role for TLRs.40 We also studied the association of polymorphisms of rs2289318 and rs3804099 with the clinical features of BD patients, using stratified analysis. Significantly higher frequencies of the CC genotype and C allele of rs2289318 and rs3804099 were noticed in BD patients with genital ulcers (Table 6). A significantly higher frequency of the CT, TT genotypes, and C allele of rs3804099 was also noticed in BD patients with the pathergy reaction (Table 6). The reason for an association between the frequency of genotypes of rs2289318 or rs3804099 and BD patients with genital ulcers and (or) the pathergy reaction is not clear. Based on the above data, there is a possibility that the TLR2 associations with the BD cohorts we described are independent of uveitis. Our BD patients all have uveitis and future studies investigating the role of TLR2 in BD patients without uveitis may shed more light on this issue. During recent years, three other TLRs (TLR4, TLR8, and TLR9) have emerged as candidate susceptibility factors for a number of immune diseases. A role for TLR4 has been addressed in Japanese and Korean BD patients.9,41 Similarly, another study revealed an association between TLR9 and SLE in Chinese and Japanese patients.10,26 SNP (rs187084) of the TLR9 gene was shown to affect the risk of BD in Tunisian patients. We did not find an association between polymorphisms in TLR4, TLR8, and TLR9 genes in the uveitis entities

IOVS j December 2013 j Vol. 54 j No. 13 j 8390 included in our study. Similar to our results, no association with these three TLR related gene polymorphisms was reported in JIA (juvenile idiopathic arthritis) patients from the United Kingdom.42 Because the two TLR2 SNPs (rs2289318, rs3804099) were shown to be associated with ocular BD, we investigated whether the different genotypes could affect its expression. Our data showed that when we stimulated PBMCs from healthy individuals with PGN, there was an increased expression of TLR2 mRNA in individuals with the rs2289318CC genotype compared with those carrying the rs2289318CG genotype. An increased expression of TLR2 mRNA in individuals with the rs3804099 TT genotype compared with those carrying the rs3804099 CC or CT genotypes was also observed when we stimulated PBMCs with PGN. We did not yet test TLR2 expression in genotyped BD patients since the degree of inflammation as well as the immunosuppressive treatment may introduce a confounding effect on gene expression.43 We recently showed that active BD patients not receiving immunosuppression had a markedly higher expression at the mRNA and protein level of TLR2, TLR3, TLR4, and TLR8 compared with healthy controls.44 In the current study, we did not measure TLR expression in our patients and did not observe a significant difference of the various TLR2 rs2289318 or rs3804099 genotypes on the release of the TLR downstream cytokines such as TNF-a, IL-6, IL-10, and IL-1b. These findings suggest that the mechanism explaining the role of the TLR2 polymorphisms with BD is related to the quantitative TLR2 expression which will in turn lead to a higher cytokine response. More studies on the TLR2 and cytokine response in genotyped BD patients are needed to support this hypothesis. The fact that successful anti-TNFa treatment of BD patients leads to a lower TLR2 gene expression is further evidence for a role of TLR2 in mediating the ocular inflammatory response in this disease.43 Several authors investigated the association between polymorphisms of TLRs and their functional involvement in autoimmune or autoinflammatory diseases. Systemic sclerosis patients carrying a rare TLR2 Pro-631 His variant from a European population showed a marked increase in the production of IL-6 and TNF-a by DCs following stimulation with PGN.8 However, no association was reported between TLR4 expression on PBMCs and carriers of the TLR4 Asp299Gly or Thr399Ile genotypes in rheumatoid arthritis.45 Similarly, no association was found between autoantibody production and rs187084/TLR9 polymorphisms in Turkish rheumatoid arthritis patients.46 How TLR2 exactly affects the predisposition to ocular BD in our Chinese patients is not yet clear. It should be noted that activation of TLRs is dependent on the interaction with its ligands and that the control of the expression of these ligands in BD may depend on as yet unknown factors. Besides TLRs, many other immune related genes are also involved in the proinflammatory pathways that will finally result in the expression of clinical uveitis in BD and further studies are needed to evaluate the relative contribution of each of these factors. Our study was performed in Han Chinese and confirmatory studies are needed to show whether the same association can be reproduced in other ethnic populations and further functional and linkage studies are required to investigate the exact role of TLR2 gene polymorphisms in ocular BD pathogenesis. The fact that we failed to find an association with TLR4, 8, and 9 genes does not rule out the possibility that other SNPs in TLR genes can be associated with uveitis. We only studied a few uveitis entities and it is possible that TLR gene associations are present in other types of intraocular inflammation. Furthermore it is not clear whether our

Association of TLR2 Gene Polymorphisms observed TLR2 association with ocular BD is also present in BD patients seen at other medical departments. Taken together, our study, for the first time, reported an association between the polymorphism of two SNPs (rs2289318 and rs3804099) of TLR2 with susceptibility to ocular BD in a Chinese Han population.

Acknowledgments The authors thank all donors enrolled in the present study. Supported by National Basic Research Program of China (973 Program; 2011CB510200); Key Project of Natural Science Foundation (81130019); Research Fund for the Doctoral Program of Higher Education of China (20115503110002); Clinic Key Project of Ministry of Health, Basic Research Program of Chongqing, Chongqing Key Laborator y of Ophthalmology (CSTC, 2008CA5003); Basic Research Program of Chongqing (CSTC, 2013JCYJC10001); Key Project of Health Bureau of Chongqing (2012-1-003); and Fund for PAR-EU Scholars Program. The authors alone are responsible for the content and writing of the paper. Disclosure: J. Fang, None; R. Hu, None; S. Hou, None; Z. Ye, None; Q. Xiang, None; J. Qi, None; Y. Zhou, None; A. Kijlstra, None; P. Yang, None

References 1. Srivastava A, Rajappa M, Kaur J. Uveitis: mechanisms and recent advances in therapy. Clin Chim Acta. 2010;411:1165– 1171. 2. Willermain F, Rosenbaum JT, Bodaghi B, et al. Interplay between innate and adaptive immunity in the development of non-infectious uveitis. Prog Retin Eye Res. 2011;31:182– 194. 3. Barisani-Asenbauer T, Maca SM, Mejdoubi L, Emminger W, Machold K, Auer H. Uveitis- a rare disease often associated with systemic diseases and infections- a systematic review of 2619 patients. Orphanet J Rare Dis. 2012;7:57. 4. Medzhitov R, Preston-Hurlburt P, Janeway CA Jr. A human homologue of the Drosophila toll protein signals activation of adaptive immunity. Nature. 1997;388:394–397. 5. Chang JH, McCluskey P, Wakefield D. Expression of toll-like receptor 4 and its associated lipopolysaccharide receptor complex by resident antigen-presenting cells in the human uvea. Invest Ophthalmol Vis Sci. 2004;45:1871–1878. 6. Chang JH, McCluskey PJ, Wakefield D. Toll-like receptors in ocular immunity and the immunopathogenesis of inflammatory eye disease. Br J Ophthalmol. 2006;90:103–108. 7. Etem EO, Elyas H, Ozgocmen S, Yildirim A, Godekmerdan A. The investigation of toll-like receptor 3, 9 and 10 gene polymorphisms in Turkish rheumatoid arthritis patients. Rheumatol Int. 2010;31:1369–1374. 8. Broen JC, Bossini-Castillo L, van Bon L, et al. A rare polymorphism in the gene for toll-like receptor 2 is associated with systemic sclerosis phenotype and increases the production of inflammatory mediators. Arthritis Rheum. 2012;64: 264–271. 9. Meguro A, Ota M, Katsuyama Y, et al. Association of the tolllike receptor 4 gene polymorphisms with Behcet’s disease. Ann Rheum Dis. 2008;67:725–727. 10. Tao K, Fujii M, Tsukumo S, et al. Genetic variations of toll-like receptor 9 predispose to systemic lupus erythematosus in Japanese population. Ann Rheum Dis. 2007;66:905–909. 11. Pratap DS, Lim LL, Wang JJ, et al. The role of toll-like receptor variants in acute anterior uveitis. Mol Vis. 2011;17:2970–2977. 12. Asukata Y, Ota M, Meguro A, et al. Lack of association between toll-like receptor 4 gene polymorphisms and sarcoidosisrelated uveitis in Japan. Mol Vis. 2009;15:2673–2682.

IOVS j December 2013 j Vol. 54 j No. 13 j 8391 13. Ito R, Ota M, Meguro A, et al. Investigation of association between TLR9 gene polymorphisms and VKH in Japanese patients. Ocul Immunol Inflamm. 2011;19:202–205. 14. Song GG, Choi SJ, Ji JD, Lee YH. Toll-like receptor polymorphisms and vasculitis susceptibility: meta-analysis and systematic review. Mol Biol Rep. 2013;40:1315–1323. 15. Tomiyama R, Meguro A, Ota M, et al. Investigation of the association between toll-like receptor 2 gene polymorphisms and Behcet’s disease in Japanese patients. Hum Immunol. 2009;70:41–44. 16. Ito A, Ota M, Katsuyama Y, Inoko H, Ohno S, Mizuki N. Lack of association of toll-like receptor 9 gene polymorphism with Behcet’s disease in Japanese patients. Tissue Antigens. 2007; 70:423–426. 17. Bacanli A, Sallakci N, Yavuzer U, Alpsoy E, Yegin O. Toll-like receptor 2 Arg753Gln gene polymorphism in Turkish patients with Behcet’s disease. Clin Exp Dermatol. 2006;31:699–701. 18. Criteria for diagnosis of Behcet’s disease. International Group for Behcet’s Disease. Lancet. 1990;335:1078–1080. 19. Read RW, Holland GN, Rao NA, et al. Revised diagnostic criteria for Vogt-Koyanagi-Harada disease: report of an international committee on nomenclature. Am J Ophthalmol. 2001;131:647–652. 20. Miettinen R, Saari M. Clinical characteristics of familial acute anterior uveitis. Can J Ophthalmol. 1977;12:1–3. 21. Rothova A, van Veenedaal WG, Linssen A, Glasius E, Kijlstra A, de Jong PT. Clinical features of acute anterior uveitis. Am J Ophthalmol. 1987;103:137–145. 22. van der Linden S, Valkenburg HA, Cats A. Evaluation of diagnostic criteria for ankylosing spondylitis. A proposal for modification of the New York criteria. Arthritis Rheum. 1984; 27:361–368. 23. Smit LA, Siroux V, Bouzigon E, et al. CD14 and toll-like receptor gene polymorphisms, country living, and asthma in adults. Am J Respir Crit Care Med. 2009;179:363–368. 24. Oh DY, Taube S, Hamouda O, et al. A functional toll-like receptor 8 variant is associated with HIV disease restriction. J Infect Dis. 2008;198:701–709. 25. Ben Dhifallah I, Lachheb J, Houman H, Hamzaoui K. Toll-likereceptor gene polymorphisms in a Tunisian population with Behcet’s disease. Clin Exp Rheumatol. 2009;27:S58–S62. 26. Xu CJ, Zhang WH, Pan HF, Li XP, Xu JH, Ye DQ. Association study of a single nucleotide polymorphism in the exon 2 region of toll-like receptor 9 (TLR9) gene with susceptibility to systemic lupus erythematosus among Chinese. Mol Biol Rep. 2009;36:2245–2248. 27. Jablonska E, Marcinczyk M. TLR2 expression in relation to IL-6 and IL-1beta and their natural regulators production by PMN and PBMC in patients with Lyme disease. Mediators Inflamm. 2006;2006:32071. 28. Re F, Strominger JL. IL-10 released by concomitant TLR2 stimulation blocks the induction of a subset of Th1 cytokines that are specifically induced by TLR4 or TLR3 in human dendritic cells. J Immunol. 2004;173:7548–7555. 29. Enstrom AM, Onore CE, Van de Water JA, Ashwood P. Differential monocyte responses to TLR ligands in children with autism spectrum disorders. Brain Behav Immun. 2010; 24:64–71. 30. Chang JH, Hampartzoumian T, Everett B, Lloyd A, McCluskey PJ, Wakefield D. Changes in toll-like receptor (TLR)-2 and TLR4 expression and function but not polymorphisms are associated with acute anterior uveitis. Invest Ophthalmol Vis Sci. 2007;48:1711–1717. 31. Yang P, Fang W, Meng Q, Ren Y, Xing L, Kijlstra A. Clinical features of Chinese patients with Behcet’s disease. Ophthalmology. 2008;115:312–318. e314.

Association of TLR2 Gene Polymorphisms 32. Hou S, Kijlstra A, Yang P. The genetics of Behcet’s disease in a Chinese population. Front Med. 2012;6:354–359. 33. Du L, Kijlstra A, Yang P. Immune response genes in uveitis. Ocul Immunol Inflamm. 2009;17:249–256. 34. Sakane T, Takeno M, Suzuki N, Inaba G. Behcet’s disease. N Engl J Med. 1999;341:1284–1291. 35. Lehner T. The role of heat shock protein, microbial and autoimmune agents in the aetiology of Behcet’s disease. Int Rev Immunol. 1997;14:21–32. 36. Hu K, Yang P, Jiang Z, Hou S, Du L, Li F. STAT4 polymorphism in a Chinese Han population with Vogt-Koyanagi-Harada syndrome and Behcet’s disease. Hum Immunol. 2010;71: 723–726. 37. Hu K, Hou S, Jiang Z, Kijlstra A, Yang P. JAK2 and STAT3 polymorphisms in a Han Chinese population with Behcet’s disease. Invest Ophthalmol Vis Sci. 2012;53:538–541. 38. Chen F, Hou S, Jiang Z, et al. CD40 gene polymorphisms confer risk of Behcet’s disease but not of Vogt-Koyanagi-Harada syndrome in a Han Chinese population. Rheumatology (Oxford). 2012;51:47–51. 39. Hou S, Yang Z, Du L, et al. Identification of a susceptibility locus in STAT4 for Behcet’s disease in Han Chinese in a genome-wide association study. Arthritis Rheum. 2012;64: 4104–4113.

IOVS j December 2013 j Vol. 54 j No. 13 j 8392 40. Zierhut M, Mizuki N, Ohno S, et al. Immunology and functional genomics of Behcet’s disease. Cell Mol Life Sci. 2003;60:1903–1922. 41. Horie Y, Meguro A, Ota M, et al. Association of TLR4 polymorphisms with Behcet’s disease in a Korean population. Rheumatology (Oxford). 2009;48:638–642. 42. Lamb R, Zeggini E, Thomson W, Donn R. Toll-like receptor 4 gene polymorphisms and susceptibility to juvenile idiopathic arthritis. Ann Rheum Dis. 2005;64:767–769. 43. Keino H, Watanabe T, Taki W, Okada AA. Effect of infliximab on gene expression profiling in Behcet’s disease. Invest Ophthalmol Vis Sci. 2011;52:7681–7686. 44. Liu X, Wang C, Ye Z, Kijlstra A, Yang P. Higher expression of toll-like receptors 2, 3, 4, and 8 in ocular Behcet’s disease. Invest Ophthalmol Vis Sci. 2013;54:6012–6017. 45. Alvarez-Rodriguez L, Lopez-Hoyos M, Beares I, et al. Toll-like receptor 4 gene polymorphisms in polymyalgia rheumatica and elderly-onset rheumatoid arthritis. Clin Exp Rheumatol. 2011;29:795–800. 46. Etem EO, Elyas H, Ozgocmen S, Yildirim A, Godekmerdan A. The investigation of toll-like receptor 3, 9 and 10 gene polymorphisms in Turkish rheumatoid arthritis patients. Rheumatol Int. 2011;31:1369–1374.