European Journal of Pharmacology 736 (2014) 86–94

Contents lists available at ScienceDirect

European Journal of Pharmacology journal homepage: www.elsevier.com/locate/ejphar

Pulmonary, gastrointestinal and urogenital pharmacology

Astragaloside IV ameliorates diabetic nephropathy involving protection of podocytes in streptozotocin induced diabetic rats Jianguo Chen a,n,1, Yifang Chen b,1, Yunling Luo a, Dingkun Gui b, Jianhua Huang c, Dongyuan He a,n a

Department of Nephrology, ZheJiang Hospital, HangZhou, PR China Department of Nephrology, Shanghai Sixth People's Hospital, Shanghai, PR China c Institute of Integrated Chinese and Western Medicine, Huashan Hospital, Fudan University, Shanghai, PR China b

art ic l e i nf o

a b s t r a c t

Article history: Received 2 February 2014 Received in revised form 23 April 2014 Accepted 24 April 2014 Available online 6 May 2014

Podocyte loss and dysfunction play key role during the development of diabetic nephropathy (DN). The aim of this study was to observe the protective effects of astragaloside IV on podocyte in diabetic rats and explore its mechanisms preliminary. Healthy male Sprague-Dawley (SD) rats were randomized into normal control group, diabetic nephropathy group and diabetic nephropathy with AS-IV treatment group. DN was induced by intraperitoneal injection of streptozotocin (STZ). AS-IV treatment started 2 weeks before STZ injection and lasted 14 weeks. 24 h Urinary proteins were measured 4, 8 and 12 weeks after STZ injection. Body weight, blood glucose, blood urea nitrogen (BUN), creatinine (Cr), alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were measured 12 weeks after STZ injection. Renal pathology, podocyte morphological changes, podocyte density, protein and mRNA expression of integrin α3, integrin β1 and integrin-linked kinase (ILK) were detected by histopathology, electron microscopy, immunohistochemistry, western blot and real-time PCR, respectively. Hyperglycemia, proteinuria, mesangial expansion and podocyte loss, increased protein expression of ILK and decreased protein expression of integrin α3 and integrin β1 were detected in diabetic rats. AS-IV treatment ameliorated podocyte loss, renal histopathology and podocyte foot process effacement, decreased proteinuria, partially restored protein expression of integrin α3, integrin β1 and ILK. These findings suggested that AS-IV may protect podocyte and ameliorate diabetic nephropathy by inhibiting the expression of ILK and restoring the expression of integrin α3β1 in diabetic rats. & 2014 Elsevier B.V. All rights reserved.

Keywords: Astragaloside IV Diabetic nephropathy Podocyte Integrin-linked kinase Integrin α3β1

1. Introduction Chronic kidney disease (CKD) has been recognized as a major public health problem of the world which develops to end stage renal disease (ESRD) irrespective of underlying causes (Khwaja et al., 2007; Zhang et al., 2008). Diabetic nephropathy is a serious complication of diabetes. The prevalence of diabetic nephropathy increased strikingly in recent decades and currently diabetic nephropathy has become the leading cause of the ESRD (Andersen et al., 1983; Stephens et al., 1990). During the progression of diabetic nephropathy podocytes injuries play the central role in the deterioration of renal function (Marshall, 2007). In normal conditions podocytes anchor at the outer side of the glomerular basement membrane (GBM) by integrin and establish the glomerular filtration barrier together with GBM and glomerular

n

Corresponding authors. E-mail addresses: [email protected] (J. Chen), [email protected] (D. He). 1 These authors contributed equally to this work.

http://dx.doi.org/10.1016/j.ejphar.2014.04.037 0014-2999/& 2014 Elsevier B.V. All rights reserved.

capillary endothelial cells (Drumond and Deen, 1994). During the process of glomerular injury, the foot processes of podocyte retract and broaden and then podocyte may detach from the GBM, because podocytes are highly differentiated cells with almost no capability to undergo cell division (Pagtalunan et al., 1997). The consequence of podocyte detachment is the irreversible reduction of podocyte number and the failure to cover the outer side of the GBM completely by remaining podocytes. Glomerular parietal epithelial cells may adhere to the naked areas of GBM and lead to segmental glomerular sclerosis (Kriz et al., 1995, 1998). Integrin-linked kinase is an intracellular serine/threonine kinase that interacts with many integrins (Hannigan et al., 1996). ILK has been reported to be involved in the regulation of cellular activities and signaling pathways including cell adhesion (Dedhar et al., 1999; Wu, 1999). Previous studies showed that ILK dysregulation was involved in podocyte injury of DN (Guo et al., 2001). Astragalus membranaceus (Fisch) Bge is a widely used herb for the treatment of cardiovascular diseases, kidney diseases and diabetes in Chinese traditional medicine for centuries (Ai et al., 2008; Rios and Waterman, 1997). AS-IV is one of the main active ingredients

J. Chen et al. / European Journal of Pharmacology 736 (2014) 86–94

of Astragalus membranaceus (Fisch) Bge and has been reported to have many pharmacological activities. 3-0-Beta-D-xylopyranosyl6-0-beta-D-glucopyranosylcycloastra-genol is the chemical name of AS-IV. AS-IV could synergize with ferulic acid to inhibit renal tubulointerstitial fibrosis in rats with obstructive nephropathy (Meng et al., 2011) and reduce ischemic acute kidney injury in rats (Tan et al., 2013). Our previous study showed that AS-IV could improve high glucose-induced cell adhesion dysfunction in cultured mouse podocytes (Chen et al., 2008). In this study we will observe the effect of AS-IV on expression of α3β1 integrin and ILK and investigate their correlations with diabetic podocyte injury in vivo.

2. Materials and methods 2.1. Drug preparation Astragaloside IV (C41H68O14, molecular weight ¼784, CAS no. 84687-43-4) purchased from Xi'an Sobeo Pharmaceutical Technology Company, Limited (Xi'an, China) was suspended in 1% carboxymethyl cellulose (CMC) solution and was given to the diabetic rats by oral gavage with 3 different dosages as described before (Gui et al., 2012).

2.2. Animal study and experimental design Healthy male Sprague-Dawley (SD) rats weighing 180–200 g were purchased from Experimental Animal Center, Zhejiang University, Zhejiang province, China. They were housed in a room with air-conditioned temperature at 237 1C and alternating 12 h cycles of light and dark. Animals were fed with standard diet and free to water. The rats were randomly divided into five groups (n ¼8/each group): (1) normal control rats (NC), (2) diabetic rats (DN), (3) diabetic rats treated with low dose of AS-IV at 2.5 mg/kg/d (DNþ AL), (4) diabetic rats treated with moderate dose of AS-IV at 5 mg/kg/d (DNþ AM) and (5) diabetic rats treated with high dose of AS-IV at 10 mg/kg/d (DNþAH). Diabetes mellitus was induced by single intraperitoneal injection of streptozotocin (STZ) diluted with 0.1 M citrate buffer (pH 4.5). The STZ dosage was 65 mg/kg. Normal control rats were intraperitoneal injected with equal volume of vehicle. Forty eight hours after STZ injection, tail vein blood glucose was measured. Rats with blood glucose beyond 300 mg/dl were considered as diabetic rats. AS-IV treatment started 2 weeks before STZ injection and lasted 14 weeks. Rats of AS-IV treatment groups were given AS-IV suspended in 1% CMC by oral gavage once daily. Normal control rats were given the same volume of CMC. At the end of 4, 8 and 12 weeks after STZ injection, 24 h urine of each group were collected, centrifuged at 800g for 10 min at 25 1C and stored at  80 1C. Urinary protein was assayed by pyrogallol red colorimetric assay kit according to the instructions of the manufacturer (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). At the end of 12th week after STZ injection rats were weighed and then sacrificed. Blood samples were collected from the abdominal aorta. Blood glucose, blood urea nitrogen (BUN), creatinine (Cr), alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were measured by automatic biochemistry analyzer (Hitachi Model 7600, Japan). The kidneys were collected and cut into pieces for histopathology, electron microscopy, immunohistochemistry, western blot and real-time PCR analysis. All the work was performed according to the “Guide for the Care and Use of Laboratory Animals” published by the Zhejiang University and was approved by the Animal Ethics Committee of Zhejiang University, Zhejiang province, China.

87

2.3. Histology The kidneys were fixed with 10% neutral buffered formalin and embedded in paraffin, cut into 4 μm sections for hematoxylin and eosin, Periodic Acid-Schiff and Masson staining. Mesangial matrix expansion in the glomeruli was evaluated in PAS-stained sections using Image-Pro Plus 4.5 (So et al., 2013). The mean percent area of PAS-stained glomeruli was calculated for 20 randomly selected fields of each kidney section. The glomerulosclerosis in each glomerulus was scored semi-quantitatively as follows: 0, no sclerosis; 1, sclerosis in o25% of glomerulus; 2, sclerosis in 25–50% of glomerulus; and 3, sclerosis in 4 50% of glomerulus (Fujihara et al., 2000). To evaluate interstitial fibrosis, 20 fields for each section were assessed on Masson-stained sections. Semiquantitative analysis in each field was assessed as follows: 0, no fibrosis; 1, fibrosis less than 10% of areas; 2, fibrosis 10% to approximately 25% of areas; 3, fibrosis 25% to approximately 50% of areas; and 4, fibrosis more than 50% of areas. The averages of interstitial fibrosis scores were calculated from the total evaluated interstitial lesions in each section. The pathologic changes were assessed by a renal pathologist who was blinded to this study. 2.4. Immunohistochemistry Wilm's Tumor 1 protein (WT1) is a characteristic protein of podocyte and is necessary for podocyte maturation. In scientific researches WT1 is commonly used as molecular marker of podocyte (Michaud and Kennedy, 2007; Su et al., 2010). In this study we used WT1 for the analysis of podocytes density (podocyte numbers per glomerulus) by immunohistochemistry under 4 μm paraffin-embedded sections. Rabbit anti-WT1 antibody (Santa Cruz, USA) was used as the first antibody. The color was visualized by diaminobenzidine and counterstained with hematoxylin. The WT1 signal was quantified by light microscope with image analyzer. Podocyte density was expressed as a percentage of WT1 immunostained area occupied by total glomerular area. Twenty consecutive glomerular sections and an average of 20 glomeruli per rat were observed. 2.5. Electron microscopy studies Electron microscopic sections were performed by routine procedures. Renal cortex was cut into pieces on ice, fixed with 2.5% glutaraldehyde dissolved in 0.1 M sodium cacodylate (pH 7.4) at 4 1C overnight and washed in the same buffer. The tissue fragments were postfixed in 1% cacodylate-buffered OsO4 for 2 h, dehydrated, and embedded in Epon. Ultrathin sections were stained with uranyl acetate and lead citrate and examined by electron microscopy. The number of podocyte foot processes present in each micrograph was divided by the total length of GBM regions in each image to determine the average density of podocyte foot processes. The electron microscope photos were evaluated in a blind fashion. 2.6. Western blotting Kidney cortex was homogenized in lysis buffer on ice with a homogenizer. The supernatants were collected after centrifuging at 10,000 rpm for 5 min at 4 1C. Protein concentration of the supernatants was measured by the bicinchoninic acid (BCA) protein assay (Pierce, Rockford, IL, USA). The whole tissue lysates were mixed with equal amount of 2  SDS loading buffer (125 mmol/l Tris–HCl, 4% SDS, 20% glycerol, 100 mmol/l dithiothreitol, and 0.2% bromphenol blue). Samples were separated by 10% sodium dodecyl sulfate (SDS)/polyacrylamide gel electrophoresis and electro-transferred to a polyvinylidene difluoride (PVDF)

88

J. Chen et al. / European Journal of Pharmacology 736 (2014) 86–94

membrane (ImmobilonP, Millipore, Bedford, Mass, USA). Nonspecific binding sites were blocked with 2% non-fat milk Trisbuffered saline Tween (TBS and 0.1% Tween 20) at room temperature for 1 h. Then membranes were incubated with various primary antibodies overnight at 4 1C. After washing 3 times with TBST, membranes were incubated with horseradish peroxidaseconjugated secondary antibodies for 1 h at room temperature. Protein bands were visualized by ECL Plus (Amersham, Arlington Heights, IL, USA). Optical density of the bands was measured by a Bio-Rad gel imaging system. 2.7. Real-time quantitative PCR Total RNA of kidney cortex was extracted by the Trizol procedure according to the instructions of the manufacturer (Invitrogen, Carlsbad, CA, USA). RNA was reverse transcribed using the SuperScript RT kit (Invitrogen Carlsbad, USA). Real-time quantitative PCR was performed by the ABI PRISM7900 Sequence Detection System (Applied Biosystems). The primer concentrations were determined by analyzing the optimal concentrations of each primer. The sequences of primer pairs used for PCRs were as follows: ILK sense 50 ATTTCGTTGTGGACCAGAGC30 and anti-sense 50 TGCGTGCCGAGGTATGAG30 ; integrin α3, sense 50 CCCCTCGCTTTGTACGGTTA30 and anti-sense 50 TGTCCCTGTCAGCCTCCACT30 ; integrin β1 sense 50 GTTCCATGCGTAGCGACAA30 and anti-sense 50 TTCTCCCTGCTTTCCACTTTAG30 . To confirm the amplification specificity, PCR products of each primer pair were subjected to a melting curve analysis. Each reaction was repeated 3 times and ratio results were calculated by the 2  ΔΔCT method described previously (Livak and Schmittgen, 2001). The mRNA levels were normalized to GAPDH. 2.8. Statistical analysis Statistics were conducted by sigmaplot 12.5 software. All data were expressed as mean 7standard deviation (S.D.) and analyzed by one-way or two-way ANOVA. Multiple comparison between the groups was performed using the S–N–K method. P o0.05 was considered statistically significant.

3. Results 3.1. AS-IV significantly ameliorated proteinuria, podocyte foot process effacement and renal histopathology in STZ-induced diabetic rats Compared with normal control group severe proteinuria was observed in STZ-induced diabetic rats (P o0.05). AS-IV treatment

ameliorated proteinuria of diabetic rats significantly in a dose dependent way (Fig. 1). As shown in Fig. 2, the diabetic rats exhibited focal mesangial matrix expansion, partial glomerulosclerosis and interstitial fibrosis at 12 weeks after STZ injection. AS-IV treatment ameliorated mesangial expansion, glomerulosclerosis and interstitial fibrosis compared with the untreated diabetic rats. Marked podocyte foot process effacement was observed by electron microscopy in diabetic rats 12 weeks after STZ injection, whereas the rats pretreated with AS-IV showed improvement in podocyte foot process effacement. AS-IV ameliorated podocyte foot process effacement of diabetic rats in a dosedependent way (Fig. 3). 3.2. AS-IV decreased podocyte loss in STZ-induced diabetic rats The podocyte density was obtained by counting the number of WT-1-positive cells of each glomerular. In normal control group WT-1 positive cells are broadly located along the glomerular structure. In DN kidneys, the density of WT-1 positive cells decreased, which meant that the podocyte number per glomerular decreased. AS-IV treatment can dose dependently increase the podocyte density in STZ-induced diabetic rats (Fig. 4). 3.3. AS-IV regulated the protein and mRNA expression of integrin α3 and β1 subunits and integrin-linked kinase in STZ-induced diabetic rats Integrin is an important adhesion protein which plays a key role in cell adhesion to extracellular matrix (ECM) and signal transduction (Albelda and Buck, 1990; Hynes, 1992; Juliano and Haskill, 1993). Podocyte is attached to GBM by integrin α3β1 (Chen et al., 2000). As shown in Fig. 5, the protein expression of integrin α3 and integrin β1 subunits decreased in STZ induced diabetic rats, while the ILK protein expression increased. AS-IV treatment dosedependently increased the integrin α3 and integrin β1 subunits protein expression and decreased ILK protein expression. These findings suggested that the therapeutic effect of AS-IV was associated with regulation of the integrin α3β1 and ILK protein expression. We also observed the mRNA changes in ILK, integrin α3 and integrin β1 subunits of each group. The mRNA expression of ILK, integrin α3 and integrin β1 was not consistent with their protein expression (Fig. 6). The ILK mRNA expression had no significant difference between normal control, DN and DN with AS-IV treatment groups. Compared with normal control group integrin α3 mRNA expression decreased significantly in DN group at the end of 12 weeks and AS-IV treatment did not increase the integrin α3 mRNA expression significantly. Integrin β1 mRNA expression down-regulated significantly in DN rats compared with

Fig. 1. AS-IV dose-dependently ameliorated proteinuria of diabetic rats. Effects of AS-IV on proteinuria in diabetic rats at 4 weeks (A), 8 weeks (B) and 12 weeks (C) after STZ injection. NC, normal control rats; DN, STZ-induced diabetic rats; DN þAL, DN rats treated with low dose AS-IV (2.5 mg/kg/d); DNþ AM, DN rats treated with medium dose AS-IV (5 mg/kg/d); and DN þAH, DN rats treated with high dose AS-IV (10 mg/kg/d). Results were expressed as the means 7S.D. nP o 0.05 vs. NC. ♯P o0.05 vs. DN.

J. Chen et al. / European Journal of Pharmacology 736 (2014) 86–94

89

Fig. 2. Representative histological changes in kidneys of each group of rats. (A–E) Stained with hematoxylin and eosin. (F,G) Stained with PAS. (K–O) Stained with Masson. (P) Mesangial matrix expansion analysis of each group of rats. (Q) Semiquantitative analysis of glomerulosclerosis of each group of rats. (R) Semiquantitative analysis of interstitial fibrosis of each group of rats. AS-IV ameliorated focal mesangial matrix expansion, glomerulosclerosis and interstitial fibrosis in STZ induced diabetic rats in dose dependent way. AS-IV treatment was started 2 weeks before STZ injection and lasted 14 weeks. NC, normal control rats; DN, STZ-induced diabetic rats; DNþ AL, DN rats treated with low dose AS-IV (2.5 mg/kg/d); DNþ AM, DN rats treated with medium dose AS-IV (5 mg/kg/d); and DNþ AH, DN rats treated with high dose AS-IV (10 mg/kg/d). Results were expressed as the means 7 S.D. nPo 0.05 vs. NC. ♯P o 0.05 vs. DN.

normal control rats. After AS-IV treatment integrin β1 mRNA expression did have some changes, but the changes were not dose dependent and no significant differences were obtained compared with DN group. No significant differences were obtained among three different dose treatment groups either.

3.4. Effects of AS-IV on body weight and metabolic parameters in blood Body weight, blood glucose (BG), blood urea nitrogen (BUN), serum creatinine (SCr), alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were measured and compared between each group at the end of 12 weeks after STZ injection (Table 1). Compared with normal control rats body weight of diabetic rats decreased while the blood glucose increased. The differences were statistically significant (Po 0.05). But no differences of BG and body weight were detected between AS-IV treated and untreated diabetic rats. And there were no difference of blood urea nitrogen, serum creatinine (SCr) and aminotransferase (AST and ALT) between AS-IV treated and untreated diabetic rats, probably indicating that the protective effects of AS-IV had nothing to do with glucose regulation and AS-IV may have no renal and hepatic toxicity.

4. Discussion Diabetic nephropathy (DN) is an important complication of type 1 or type 2 diabetes, which is characterized by continuous albuminuria, decreased glomerular filtration rate and enhanced cardiovascular morbidity and mortality (Mauer et al., 1981). From 1980 to 2006, the percentage of diabetic nephropathy in patients starting dialysis has increased from near 0% to 45%. Although compared with the preceding year the incidence of ESRD caused by diabetes declined in 2008; diabetic nephropathy remains the leading cause of ESRD in the United States and other developed countries (Collins et al., 2012; Ritz et al., 1999). The pathological characteristics of diabetic nephropathy are glomerular and tubular basement membrane thickening, mesangial and interstitial expansion with increased extracellular matrix (Mauer et al., 1981). In our study, diabetic rats developed apparent proteinuria. The 24 h urinary protein increased significantly 4 weeks after STZ injection compared with normal control rats. At the end of 8 weeks and 12 weeks after STZ injection, 24 h urinary protein increased further. AS-IV treatment ameliorated urinary 24 h urinary protein in a dose dependent way. The proteinuria level paralleled with renal pathological changes. At 12 weeks after STZ injection, the diabetic rats showed focal mesangial matrix expansion, partial glomerulosclerosis and interstitial fibrosis compared with normal control

90

J. Chen et al. / European Journal of Pharmacology 736 (2014) 86–94

Fig. 3. Representative electron photomicrographs from each group of rats. Kidney of normal control rats (A), DN rats (B) and DN rats treated with three doses AS-IV (C–E). (F) Quantitative analysis of density of podocyte foot processes. AS-IV ameliorated podocyte foot process effacement dose-dependently. NC, normal control rats; DN, STZinduced diabetic rats; DN þAL, DN rats treated with low dose AS-IV (2.5 mg/kg/d); DNþ AM, DN rats treated with medium dose AS-IV (5 mg/kg/d); and DN þAH, DN rats treated with high dose AS-IV (10 mg/kg/d). Results were expressed as the means 7 S.D. nPo 0.05 vs. NC. ♯Po 0.05 vs. DN.

rats and pretreatment with AS-IV ameliorated these pathological changes compared with the untreated diabetic rats. Podocyte, also called glomerular visceral epithelial cell, consists of three major components: the main cell body, cytoplasmic processes and foot processes that directly contact with the GBM. Podocyte is the most important part of the glomerular filtration barrier and the target cell in the glomerulus diseases (Drumond and Deen, 1994). Podocyte injuries play the central role in almost all the proteinuria diseases including diabetic nephropathy (Greka and Mundel, 2012). In diseases associated with proteinuria, the foot processes of podocyte effaced. As shown in Fig. 3, podocyte foot process effacement developed in diabetic rats and AS-IV treatment reduced podocyte foot process effacement in diabetic rats. If injuries continue or strengthen, detachment from GBM or

podocyte apoptosis may occur (Hara et al., 1995, 1998; Kerjaschki et al., 1986). Apoptosis was once considered to be the key mechanism of podocyte loss during proteinuria nephropathy (Riedl et al., 2011; Sohn et al., 2010; Xu et al., 2012). But studies showed that detachment of podocyte from GBM may be more important. Lemley et al. found that the podocytes excreted into the urine are alive (Lemley, 2008). Petermann et al. confirmed that the podocytes excreted into the urine have the adherent capacity (Petermann et al., 2003). Podocyte is the terminal differentiated cells with little capability to undergo cell division. Podocyte detachment from GBM and apoptosis lead to irreversible podocyte decrease, filtration barrier injuries and proteinuria. After podocytes loss parietal epithelial cells could adhere with the naked area of GBM, which eventually lead to glomerulosclerosis (Komai-Koma

J. Chen et al. / European Journal of Pharmacology 736 (2014) 86–94

91

Fig. 4. Podocytes detected by immunohistochemistry staining of WT-1 expression in the glomeruli at the end of 12 weeks after STZ injection. WT-1 was stained brown. (A) NC, normal control rats; (B) DN, STZ-induced diabetic rats; (C) DNþ AL, DN rats treated with low dose AS-IV (2.5 mg/kg/d); (D) DNþ AM, DN rats treated with medium dose AS-IV (5 mg/kg/d); and (E) DNþ AH, DN rats treated with high dose AS-IV (10 mg/kg/d). (F) Semi-quantitative analysis of podocyte density of each group of rats. Semi quantitative results were expressed as the means 7 S.D. nPo 0.05 vs. NC. ♯Po 0.05 vs. DN.

Fig. 5. AS-IV regulated the protein expression of ILK, integrin α3 and integrin β1. (A) The protein expression of ILK, integrin α3 and integrin β1 examined by Western Blot. Semi-quantitative analysis of (B) integrin α3, (C) integrin β1, and (D) ILK. NC, normal control rats; DN, STZ induced diabetic rats; DN þAL, DN rats treated with low dose AS-IV (2.5 mg/kg/d); DNþ AM, DN rats treated with medium dose AS-IV (5 mg/kg/d); and DNþ AH, DN rats treated with high dose AS-IV (10 mg/kg/d). Results are expressed are the means7 S.D. nP o0.05 vs. NC. ♯Po 0.05 vs. DN.

et al., 2004). Previous studies showed that podocyte detachment could be detected 1 month after hyperglycemia, which suggest that podocyte loss may be an early phenomenon in diabetes

(Regoli and Bendayan, 1997). Podocyte density (number/volume) reduction has been reported in both types 1 and 2 diabetes (Pagtalunan et al., 1997; White and Bilous, 2004; White et al.,

92

J. Chen et al. / European Journal of Pharmacology 736 (2014) 86–94

Fig. 6. Effects of AS-IV on mRNA expression of ILK, integrin α3 and integrin β1 in diabetic rats at 12 weeks after STZ injection. The mRNA expression of (A) ILK, (B) integrin α3, and (C) integrin β1. NC, normal control rats; DN, STZ-induced diabetic rats; DNþ AL, DN rats treated with low dose AS-IV (2.5 mg/kg/d); DNþ AM, DN rats treated with medium dose AS-IV (5 mg/kg/d); and DNþ AH, DN rats treated with high dose AS-IV (10 mg/kg/d). Results are expressed as the means 7 S.D. nPo 0.05 vs. NC.

Table 1 Physical and plasma biochemical parameters. NC BW (g) BG (mmol/L) BUN (mmol/L) SCr (μmol/L) ALT (U/L) AST (U/L)

534.2 7 35.8 8.0 7 0.7 6.62 7 1.26 22.78 7 14.05 60.5 7 5.5 72.2 7 6.3

DN þAL

DN a

235.2722.7 36.3 78.7a 11.63 76.06 25.26 78.37 64.4 73.1 76.8 76.2

252.17 34.3 36.5 7 6.9a 10.9 7 4.3 24.557 2.62 67.8 7 5.9 73.17 4.8

DNþ AM a

243.07 29.6 37.17 4.8a 10.7 7 3.2 22.30 7 2.07 60.8 7 2.9 73.5 7 3.6

DNþ AH a

249.4 7 32.4a 32.4 7 4.1a 7.78 7 1.47 24.757 8.22 65.4 7 4.3 75.7 7 3.7

BW, body weight; BG, blood glucose; BUN, blood urea nitrogen; SCr, serum creatinine; ALT, alanine aminotransferase. AS-IV treatment was started 2 weeks before STZ injection and lasted 14 weeks. NC, normal control rats; DN, STZ-induced diabetic rats; DNþ AL, DN rats treated with low dose AS-IV (2.5 mg/kg/d); DNþ AM, DN rats treated with medium dose AS-IV (5 mg/kg/d); DNþ AH, DN rats treated with high dose AS-IV (10 mg/kg/d). Results are expressed as the means 7S.D. a

P o0.05 vs. NC group.

2002). Therefore preventing podocyte detachment from GBM may be a promising target for DN treatment. Currently there are no interventions specifically preventing podocyte detachment in DN. Our results were consistent with previous studies. By immunohistochemistry staining of podocyte specific bio-mark WT1, we found podocyte number decreased in diabetic rats compared with normal control rats. AS-IV treatment could reduce podocyte loss in diabetic rats induced by STZ injection. Decreasing of cell adhesion and cytoskeleton changes are necessary for the detachment of podocyte from GBM. Integrin and integrin-linked kinase (ILK) are reported to be involved in these processes (Wu and Dedhar, 2001). Integrins are a family of cell surface proteins which mediate cell to cell and cell to extracellular matrix (ECM) adhesion. Integrin heterodimers consisted of α and β subunits; each α subunit can associate with several β subunits and vice versa. Some integrin heterodimers also have more than one ligand. Till now 14 α and 8 β subunits have been identified (Hynes, 1992; Livak and Schmittgen, 2001). Integrin serves as cell anchor and signal transmitter (Ruoslahti, 1991). Integrin integrates cytoskeleton with ECM (Horwitz et al., 1986) and plays a key role in cell aggregation (Phillips et al., 1988), immune response (Springer, 1990), tissue repairing (Toda et al., 1987) and tumor invasion (Ruoslahti and Giancotti, 1989). Podocytes connect with GBM by integrin α3β1. Decreased expression of α3β1 integrin on podocytes has been reported in patients of primary FSGS, diabetes, and STZ-induced diabetic rats (Chen et al., 2000). Reduction of integrin α3β1 on podocyte could be induced by high glucose and was accompanied by the decreased adhesion of podocyte to GBM component (Kitsiou et al., 2003). These results suggest that integrin α3β1 reduction leads to the podocyte detachment and dysfunction of the glomerular filtration barrier in DN; restoration of integrin α3β1 expression may reduce the podocyte loss and proteinuria. This hypothesis is consistent with our results. The diabetic rats had decreased protein expression

of integrin α3 and integrin β1, low numerical density of podocyte and apparent proteinuria compared with normal control group. AS-IV treatment restored integrin α3 and integrin β1 expressions, increased numerical density of podocyte and finally decreased proteinuria. ILK is a serine/threonine kinase which can interact with integrin β1, integrin β3 (Hannigan et al., 1996) and cytoskeletonassociated proteins such as PINCH (Tu et al., 1999), CH-ILKBP (Tu et al., 2001) and paxillin (Nikolopoulos and Turner, 2001). ILK has been reported to be involved in the regulation of integrinmediated processes including cell adhesion, cell-shape changes and deposition of extracellular matrix (Dedhar et al., 1999; Wu, 1999). The protein expression of ILK increased strikingly in diabetic patients’ kidneys, especially in mesangial cells and epithelial cells of glomeruli (Guo et al., 2001). Increased ILK level has also been reported in diabetic rats (DAI et al., 2012). Under high glucose environment ILK activation and up-regulation lead to the reduced integrin α3β1 expression and impaired cell–matrix adhesion of podocyte (Chen et al., 2008). ILK inhibition could restore integrin α3β1 expression and cell–matrix adhesion of podocyte (Teixeira et al., 2005). In our study the protein expression of ILK increased in DN rats. AS-IV therapy inhibited the upregulation of ILK. We also observed the mRNA expression of ILK, integrin α3 and integrin β1 by real-time PCR. The mRNA expressions of ILK, integrin α3 and integrin β1were not correlated with their proteins. These results suggest that the mechanisms of AS-IV regulating the protein expression of integrin α3β1 and ILK in DN rats are not simply by up-regulating the expression of mRNA. It may involve some post-transcriptional regulation and more experiments are needed in the future. Finally we examined the blood metabolic parameters of each group rats. There were no statistical differences of blood glucose, BUN, Cr, AST and ALT between diabetic rats with or without AS-IV treatment. So the protective effects of AS-IV on podocyte were

J. Chen et al. / European Journal of Pharmacology 736 (2014) 86–94

probably independent of blood glucose level and AS-IV may have no renal and hepatic toxicity in rats.

5. Conclusions In summary, AS-IV improves cell–matrix adhesion of podocytes to GBM, ameliorates renal histopathology, podocyte foot process effacement and proteinuria. This effect may be involved in integrin α3β1 up-regulation and ILK inhibition.

Sources of funding This study was supported by a grant from the Health Research Funds, Ministry of Health, PR China (WKJ2009-2-017) and a grant from the Natural Science Foundation of Zhejiang Province (Approval no. LY12H05001). References Ai, P., Yong, G., Dingkun, G., Qiuyu, Z., Kaiyuan, Z., Shanyan, L., 2008. Aqueous extract of Astragali Radix induces human natriuresis through enhancement of renal response to atrial natriuretic peptide. J. Ethnopharmacol. 116, 413–421. Albelda, S.M., Buck, C.A., 1990. Integrins and other cell adhesion molecules. FASEB J. 4, 2868–2880. Andersen, A., Christiansen, J.S., Andersen, J., Kreiner, S., Deckert, T., 1983. Diabetic nephropathy in type 1 (insulin-dependent) diabetes: an epidemiological study. Diabetologia 25, 496–501. Chen, H.-C., Chen, C.-A., Guh, J.-Y., Chang, J.-M., Shin, S.-J., Lai, Y.-H., 2000. Altering expression of α3β1 integrin on podocytes of human and rats with diabetes. Life Sci. 67, 2345–2353. Chen, J., Gui, D., Chen, Y., Mou, L., Liu, Y., Huang, J., 2008. Astragaloside IV improves high glucose-induced podocyte adhesion dysfunction via α3β1 integrin upregulation and integrin-linked kinase inhibition. Biochem. Pharmacol. 76, 796–804. Collins, A.J., Foley, R.N., Chavers, B., Gilbertson, D., Herzog, C., Johansen, K., Kasiske, B., Kutner, N., Liu, J., St. Peter, W., 2012. United States Renal Data System 2011 annual data report: atlas of chronic kidney disease & end-stage renal disease in the United States. Am. J. Kidney Dis.: Off. J. Natl. Kidney Found. 59 (A7), e1. Dai, H.-Y., Zheng, M., Tang, R.-N., Ma, K.-L., Ni, J., Liu, B.-C., 2012. Inhibition of integrin-linked kinase by angiotensin II receptor antagonist, irbesartan attenuates podocyte injury in diabetic rats. Chin. Med. J. 125, 888–893. Dedhar, S., Williams, B., Hannigan, G., 1999. Integrin-linked kinase (ILK): a regulator of integrin and growth-factor signalling. Trends Cell Biol.9, 319–323. Drumond, M.C., Deen, W.M., 1994. Structural determinants of glomerular hydraulic permeability. Am. J. Physiol.-Renal Physiol. 266, F1–F12. Fujihara, C.K., Noronha, I.D.L., Malheiros, D.M.A.C., Antunes, G.R., de Oliveira, I.B., Zatz, R., 2000. Combined mycophenolate mofetil and losartan therapy arrests established injury in the remnant kidney. J. Am. Soc. Nephrol. 11, 283–290. Greka, A., Mundel, P., 2012. Cell biology and pathology of podocytes. Annu. Rev. Physiol. 74, 299. Gui, D., Guo, Y., Wang, F., Liu, W., Chen, J., Chen, Y., Huang, J., Wang, N., 2012. Astragaloside IV, a novel antioxidant, prevents glucose-induced podocyte apoptosis in vitro and in vivo. PLoS One 7, e39824. Guo, L., Sanders, P.W., Woods, A., Wu, C., 2001. The distribution and regulation of integrin-linked kinase in normal and diabetic kidneys. Am. J. Pathol. 159, 1735–1742. Hannigan, G., Leung-Hagesteijn, C., Fitz-Gibbon, L., Coppolino, M., Dedhar, S., Hannigan, G., Dedhar, S., Hannigan, G., 1996. Regulation of cell adhesion and anchorage-dependent growth by a new. Nature 379, 91–96. Hara, M., Yamamoto, T., Yanagihara, T., Takada, T., Itoh, M., Adachi, Y., Yoshizumi, A., Kawasaki, K., Kihara, I., 1995. Urinary excretion of podocalyxin indicates glomerular epithelial cell injuries in glomerulonephritis. Nephron 69, 397–403. Hara, M., Yanagihara, T., Itoh, M., Matsuno, M., Kihara, I., 1998. Immunohistochemical and urinary markers of podocyte injury. Pediatr. Nephrol. 12, 43–48. Horwitz, A., Duggan, K., Buck, C., Beckerle, M.C., Burridge, K., 1986. Interaction of plasma membrane fibronectin receptor with talin—a transmembrane linkage. Nature 320, 531–533. Hynes, R.O., 1992. Integrins: versatility, modulation, and signaling in cell adhesion. Cell 69, 11–25. Juliano, R., Haskill, S., 1993. Signal transduction from the extracellular matrix. J. Cell Biol. 120, 577–585. Kerjaschki, D., Poczewski, H., Dekan, G., Horvat, R., Balzar, E., Kraft, N., Atkins, R., 1986. Identification of a major sialoprotein in the glycocalyx of human visceral glomerular epithelial cells. J. Clin. Investig. 78, 1142. Khwaja, A., El Kossi, M., Floege, J., El Nahas, M., 2007. The management of CKD: a look into the future. Kidney Int. 72, 1316–1323. Kitsiou, P.V., Tzinia, A.K., Stetler-Stevenson, W.G., Michael, A.F., Fan, W.-W., Zhou, B., Tsilibary, E.C., 2003. Glucose-induced changes in integrins and matrix-related

93

functions in cultured human glomerular epithelial cells. Am. J. Physiol.-Renal Physiol. 284, F671–F679. Komai-Koma, M., Jones, L., Ogg, G.S., Xu, D., Liew, F.Y., 2004. TLR2 is expressed on activated T cells as a costimulatory receptor. Proc. Natl. Acad. Sci. USA 101, 3029–3034. Kriz, W., Elger, M., Mundel, P., Lemley, K.V., 1995. Structure-stabilizing forces in the glomerular tuft. J. Am. Soc. Nephrol. 5, 1731–1739. Kriz, W., Gretz, N., Lemley, K.V., 1998. Progression of glomerular diseases: is the podocyte the culprit? Kidney Int. 54, 687–697. Lemley, K.V., 2008. Diabetes and chronic kidney disease: lessons from the Pima Indians. Pediatr. Nephrol. 23, 1933–1940. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2  ΔΔCT methodMethods 25, 402–408. Marshall, S.M., 2007. The podocyte: a potential therapeutic target in diabetic nephropathy? Curr. Pharm. Des. 13, 2713–2720. Mauer, S.M., Steffes, M.W., Brown, D.M., 1981. The kidney in diabetes. Am. J. Med. 70, 603–612. Meng, L., Tang, J., Wang, Y., Zhao, J., Shang, M., Zhang, M., Liu, S., Qu, L., Cai, S., Li, X., 2011. Astragaloside IV synergizes with ferulic acid to inhibit renal tubulointerstitial fibrosis in rats with obstructive nephropathy. Br. J. Pharmacol. 162, 1805–1818. Michaud, J., Kennedy, C., 2007. The podocyte in health and disease: insights from the mouse. Clin. Sci. 112, 325–335. Nikolopoulos, S.N., Turner, C.E., 2001. Integrin-linked kinase (ILK) binding to paxillin LD1 motif regulates ILK localization to focal adhesions. J. Biol. Chem. 276, 23499–23505. Pagtalunan, M.E., Miller, P.L., Jumping-Eagle, S., Nelson, R.G., Myers, B.D., Rennke, H. G., Coplon, N.S., Sun, L., Meyer, T.W., 1997. Podocyte loss and progressive glomerular injury in type II diabetes. J. Clin. Investig. 99, 342. Petermann, A.T., Krofft, R., Blonski, M., Hiromura, K., Vaughn, M., Pichler, R., Griffin, S., Wada, T., Pippin, J., Durvasula, R., 2003. Podocytes that detach in experimental membranous nephropathy are viable1. Kidney Int. 64, 1222–1231. Phillips, D.R., Charo, I.F., Parise, L.V., Fitzgerald, L., 1988. The platelet membrane glycoprotein lib–Ilia complex. Blood 71, 831–843. Regoli, M., Bendayan, M., 1997. Alterations in the expression of the α3β1 integrin in certain membrane domains of the glomerular epithelial cells (podocytes) in diabetes mellitus. Diabetologia 40, 15–22. Riedl, E., Pfister, F., Braunagel, M., Brinkkö tter, P., Sternik, P., Deinzer, M., Bakker, S.J., Henning, R.H., van den Born, J., Krämer, B.K., 2011. Carnosine prevents apoptosis of glomerular cells and podocyte loss in STZ diabetic rats. Cell. Physiol. Biochem. 28, 279–288. Rios, J., Waterman, P., 1997. A review of the pharmacology and toxicology of Astragalus. Phytother. Res. 11, 411–418. Ritz, E., Rychlík, I., Locatelli, F., Halimi, S., 1999. End-stage renal failure in type 2 diabetes: a medical catastrophe of worldwide dimensions. Am. J. Kidney Dis. 34, 795–808. Ruoslahti, E., 1991. Integrins. J. Clin. Investig. 87, 1. Ruoslahti, E., Giancotti, F., 1989. Integrins and tumor cell dissemination. Cancer Cells1. Cold Spring Harbor, NY, pp. 119–126 (1989). So, B.-I., Song, Y.-S., Fang, C.-H., Park, J.-Y., Lee, Y., Shin, J.H., Kim, H., Kim, K.-S., 2013. G-CSF prevents progression of diabetic nephropathy in rat. PLoS One 8, e77048. Sohn, E., Kim, J., Kim, C.-S., Kim, Y.S., Jang, D.S., Kim, J.S., 2010. Extract of the aerial parts of Aster koraiensis reduced development of diabetic nephropathy via antiapoptosis of podocytes in streptozotocin-induced diabetic rats. Biochem. Biophys. Res. Commun. 391, 733–738. Springer, T.A., 1990. Adhesion receptors of the immune system. Nature 346, 425–434. Stephens, G.W., Gillaspy, J.A., Clyne, D., Mejia, A., Pollak, V., 1990. Racial differences in the incidence of end-stage renal disease in types I and II diabetes mellitus. Am. J. Kidney Dis.: Off. J. Natl. Kidney Found. 15, 562. Su, J., Li, S.-J., Chen, Z.-H., Zeng, C.-H., Zhou, H., Li, L.-S., Liu, Z.-H., 2010. Evaluation of podocyte lesion in patients with diabetic nephropathy: Wilms' tumor-1 protein used as a podocyte marker. Diabetes Res. Clin Pract. 87, 167–175. Tan, S., Wang, G., Guo, Y., Gui, D., Wang, N., 2013. Preventive effects of a natural anti-inflammatory agent, astragaloside IV, on ischemic acute kidney injury in rats. Evid.-Based Complementary Altern. Med., 2013. Teixeira, V.D.P.C., Blattner, S.M., Li, M., Anders, H.-J., Cohen, C.D., Edenhofer, I., Calvaresi, N., Merkle, M., Rastaldi, M.P., Kretzler, M., 2005. Functional consequences of integrin-linked kinase activation in podocyte damage. Kidney Int. 67, 514–523. Toda, K., Tuan, T.-L., Brown, P.J., Grinnell, F., 1987. Fibronectin receptors of human keratinocytes and their expression during cell culture. J. Cell Biol. 105, 3097–3104. Tu, Y., Huang, Y., Zhang, Y., Hua, Y., Wu, C., 2001. A new focal adhesion protein that interacts with integrin-linked kinase and regulates cell adhesion and spreading. J. Cell Biol. 153, 585–598. Tu, Y., Li, F., Goicoechea, S., Wu, C., 1999. The LIM-only protein PINCH directly interacts with integrin-linked kinase and is recruited to integrin-rich sites in spreading cells. Mol. Cell. Biol. 19, 2425–2434. White, K.E., Bilous, R.W., 2004. Structural alterations to the podocyte are related to proteinuria in type 2 diabetic patients. Nephrol. Dial. Transplant. 19, 1437–1440. White, K.E., Bilous, R.W., Marshall, S.M., El Nahas, M., Remuzzi, G., Piras, G., De Cosmo, S., Viberti, G., 2002. Podocyte number in normotensive type 1 diabetic patients with albuminuria. Diabetes 51, 3083–3089.

94

J. Chen et al. / European Journal of Pharmacology 736 (2014) 86–94

Wu, C., 1999. Integrin-linked kinase and PINCH: partners in regulation of cell– extracellular matrix interaction and signal transduction. J. Cell Sci. 112, 4485–4489. Wu, C., Dedhar, S., 2001. Integrin-linked kinase (ILK) and its interactors a new paradigm for the coupling of extracellular matrix to actin cytoskeleton and signaling complexes. J. Cell Biol. 155, 505–510.

Xu, J., Li, Z., Xu, P., Yang, Z., 2012. Protective effects of leukemia inhibitory factor against oxidative stress during high glucose-induced apoptosis in podocytes. Cell Stress Chaperones 17, 485–493. Zhang, L., Zhang, P., Wang, F., Zuo, L., Zhou, Y., Shi, Y., Li, G., Jiao, S., Liu, Z., Liang, W., 2008. Prevalence and factors associated with CKD: a population study from Beijing. Am. J. Kidney Dis. 51, 373–384.