J Mol Neurosci DOI 10.1007/s12031-013-0184-4
Astroglial Redistribution of Aquaporin 4 During Spongy Degeneration in a Canavan Disease Mouse Model Tim Clarner & Nicola Wieczorek & Barbara Krauspe & Katharina Jansen & Cordian Beyer & Markus Kipp
Received: 24 October 2013 / Accepted: 13 November 2013 # Springer Science+Business Media New York 2013
Abstract Canavan disease is a spongiform leukodystrophy caused by an autosomal recessive mutation in the aspartoacylase gene. Deficiency of oligodendroglial aspartoacylase activity and a subsequent increase of its substrate N -acetylaspartate are the etiologic factors for the disease. N -acetylaspartate acts as a molecular water pump. Therefore, an osmotic–hydrostatic mechanism is thought to be involved in the development of the Canavan disease phenotype. Astrocytes express water transporters and are critically involved in regulating and maintaining water homeostasis in the brain. We used the ASPANur7/Nur7 mouse model of Canavan disease to investigate whether a disturbance of water homeostasis might be involved in the disease's progression. Animals showed an age-dependent impairment of motor performance and spongy degeneration in various brain regions, among the basal ganglia, brain stem, and cerebellar white matter. Astrocyte activation was prominent in regions which displayed less tissue damage, such as the corpus callosum, cortex, mesencephalon, and stratum Purkinje of cerebellar lobe IV. Immunohistochemistry revealed alterations in the cellular distribution of the water channel aquaporin 4 in astrocytes of ASPANur7/Nur7 mice. In control animals, aquaporin 4 was located exclusively in the astrocytic end feet. In contrast, in ASPANur7/Nur7 mice, aquaporin 4 was located throughout
Tim Clarner and Nicola Wieczorek contributed equally to this work. Electronic supplementary material The online version of this article (doi:10.1007/s12031-013-0184-4) contains supplementary material, which is available to authorized users. T. Clarner (*) : N. Wieczorek : B. Krauspe : K. Jansen : C. Beyer : M. Kipp Institute of Neuroanatomy, RWTH Aachen University, Wendlingweg 2, 52074 Aachen, Germany e-mail: [email protected]
the cytoplasm. These results indicate that astroglial regulation of water homeostasis might be involved in the partial prevention of spongy degeneration. These observations highlight aquaporin 4 as a potential therapeutic target for Canavan disease. Keywords Aspartoacylase . Canavan Disease . Aquaporin 4 . Astrocyte
Introduction Canavan disease (CD) is a hereditary disorder of the central nervous system (CNS) that is caused by autosomal recessive mutations in the gene encoding for the enzyme aspartoacylase (ASPA). CD is characterized by spongy degeneration of CNS white matter, dysmyelination, edema formation, and astrocyte swelling, leading to severe early onset of neurological disability. The life expectancy of children suffering from the most common infantile/neonatal CD form is variable. While some children die early, others survive into their teenager age or even longer (Matalon and Michals-Matalon 1993–2013). In the CNS, ASPA is expressed by the oligodendrocytes, microglial cells, endothelial cells, ependymal cells, epiplexus cells, and leptomeningeal cells (Moffett et al. 2011). Its substrate N-acetylaspartate (NAA) is believed to be synthesized in the neuronal mitochondria (Baslow and Guilfoyle 2009; Baslow et al. 1999; Moffett et al. 1991). It has been proposed that NAA and its glutamate adduct NAAG are released from the neurons into the extracellular space, where NAAG is further processed by astrocytic membrane-bound peptidase producing NAA and glutamate. NAA can be taken up from the extracellular space by oligodendrocytes, which hydrolize it to acetate and aspartate (Baslow and Guilfoyle 2009).
J Mol Neurosci
Although NAA functions in the brain appear manifold (Moffett et al. 2007), acetate supply via hydrolysis of NAA in oligodendrocytes is thought to be critically involved in myelin lipid synthesis (Benarroch 2008). A lack of acetate in oligodendrocytes due to ASPA dysfunction might be one of the pathomechanisms involved in the development of CD (Arun et al. 2010; Chakraborty et al. 2001; Madhavarao et al. 2005). However, not all of the histopathological hallmarks of CD can be explained by impaired myelin synthesis and maintenance. For example, a lack of acetate fails to explain the cellular and extracellular edema as well as myelin splitting and spongiform vacuolization which are also characteristics for CD (Baslow and Guilfoyle 2009). Baslow in 2002 proposed an important role for NAA in the regulation of water homeostasis in the brain. According to his hypothesis, elevated NAA levels might lead to an increase in CNS osmotic pressure and disturbances in the removal of metabolic water from neurons, mechanisms that likely contribute to the formation of both edema and vacuolization (Baslow and Guilfoyle 2009; Baslow 2002; Baslow 2003). Lithium has been successfully used to reduce overall NAA levels in the brain and urine of CD patients. These patients displayed an improvement in myelination, alertness, social interaction, and visual tracking. A proposed mechanism of action by which lithium reduces NAA levels is the prevention of neuronal NAA efflux to the extracellular fluid, thereby possibly ameliorating changes in osmotic pressure (Assadi et al. 2010; Baslow et al. 2002; Janson et al. 2005; Solsona et al. 2012). Astrocytes are important for the regulation of CNS water homeostasis and formation of cytotoxic brain edema, since they express the water transporters aquaporin 4 (AQP4) (Baslow 2003). Each AQP4 monomer forms a narrow aqueous pore, facilitating the bidirectional water movement across the membranes in response to osmotic gradients (Papadopoulos and Verkman 2013). AQP4 is the principal member of the AQP protein family in the CNS and implicated in cell migration and excitation of neurons. Water channels are not evenly distributed throughout the astrocytic cell compartments. AQP4 is predominantly expressed under normal physiological conditions in the astrocytic end feet which form the glial barrier along small brain vessels and the pia mater (Nagelhus et al. 2004; Masaki et al. 2010). In contrast, AQP9 is mainly found on astrocyte cell bodies and processes (Badaut et al. 2002). Dynamics of AQP4 levels are best documented under ischemia and traumatic injury in the brain where both AQPs are up-regulated (Badaut et al. 2002). In the present study, we used ASPANur7/Nur7 mice as model organisms mimicking certain aspects of CD to investigate the development of motor deficits and tissue vacuolization in mice at different ages. Furthermore, we correlated behavioral and histopathologic changes with astrocyte reactivity and AQP4 expression and subcellular distribution.
Materials and Methods Animals Heterozygote AspaNur7/J mice, (stock number 008607, C57BL/6 J background) were provided by Jackson Laboratory (USA) and used for breeding. ASPANur7 mice carry a point mutation from cytosine to thymidine on position 577 in the ASPA gene on chromosome 11. This mutation leads to the production of a truncated and dysfunctional ASPA enzyme (Traka et al. 2008). Whereas heterozygote carriers of the mutation develop normally and show no signs of impaired motor functions or histopathological alterations, homozygote carriers develop an age-dependent impairment of motor skills, increasing edema, accumulation of NAA within the CNS, and spongy degeneration (Traka et al. 2008). The animals underwent routine cage maintenance once a week and microbiological monitoring according to the Federation of European Laboratory Animal Science Associations recommendations. Food (Sniff Spezialdiäten, Germany) and water were available ad libitum. Research and animal care procedures were approved by the Review Board for the Care of Animal Subjects of the district government (North RhineWestfalia, Germany) and were performed according to international guidelines on the use of laboratory animals. To study age-dependent differences of AspaNur7/Nur7 mice in motor skill performance, animals were divided into three groups. Group 1 “young” (n =3) consisted of animals from 11 to 14 weeks of age, group 2 “middle aged” (n =4) was 18 to 21 weeks old, and group 3 “old” (n =5) was 24–27 weeks of age. Agematched controls (n =5) were obtained from genotyped healthy littermates. Genotyping ASPANur7/Nur7 mice carry a homozygote transition of cytosine to thymidine on position 577 in the gene encoding for ASPA, causing the nonsense mutation Q193X (Traka et al. 2008). Mice were genotyped by sequencing the areas of interest on chromosome 11. Therefore, the DNA was isolated from mouse tail using the NucleoSpin® tissue kit (MachereyNagel, Germany; 740952.50) according to the manufacturer's instructions. The DNA region of interest was amplified by polymerase chain reaction (PCR) using the following primer pair: ASPA sense TGACATTGTCTCTGTTATTTTCCA and ASPA antisense CCCCCAAGTTAAGCCATGTA, resulting in a PCR product of 289 bp in length. The PCR product was purified with the NucleoSpin® Extract II kit (MachereyNagel, Germany; 740609.50) and subsequently sequenced by Seqlab (Göttingen, Germany). The sequence of interest was as follows: CACGGTGTCCTTAGAGCTGATATTTT AGAC(C/T)AAATGAGAAAAATGATAAAACATGCTCA typical result of the sequence analysis of WT, heterozygote
J Mol Neurosci
ASPANur7, and homozygote ASPANur7/Nur7 animals is shown in supplementary Fig. 1. Motor Skill Tests To investigate age-dependent impairment of motor skills, we performed two distinct test paradigms. A four-paw “hanging wire” approach was performed to assess paw strength as indicator of neuromuscular functions (Crawley 1999). Therefore, a wire cage lid was bordered with tape to form a 10 cm×15.5 cm field in which the animals were placed. Mice were allowed to strongly grip the wires and the lid was gently turned upside down, which were held approximately 20 cm above cushioned ground and the latency to fall was measured. Healthy mice can avoid falling off for at least 60 s and a cutoff was set at this time point. Neuromuscular disabilities result in preterm falloffs. To test motor coordination and balance, rotarod treadmill tests were performed using the IITC Rotarod (Series 8, Life Science). Linear acceleration from 4 to 40 rpm over a 5-min test session was applied. Two trials per day were performed with each animal on four consecutive days and the latency to fall was measured for each animal. Before initiation of the experiments, mice were allowed to acclimatize to the testing environment for at least 1 h. Consecutive trials were timematched (starting at 4 p.m.) to exclude a possible impact of circadian rhythm on motor performance. Tissue Preparation For gene expression studies, mice were deeply anesthetized and transcardially perfused with 20 ml of ice-cold saline. Brains were removed and the regions of interest were dissected by a stereomicroscopic approach as published previously by our group (Schmidt et al. 2013). Tissue was subsequently homogenized in PeqGold RNA Pure (PeqLab, Germany; cat. no. 30-1010) or snap frozen in liquid nitrogen and stored at −80 °C until use. The isolation procedures were performed according to the manufacturer's protocol. RNA concentration and purity were photometrically measured on a NanoDrop 1000 (Thermo Fisher Scientific, USA).
Reverse transcription was performed using 1 μg of total RNA and a MMLV reverse transcriptase kit (Invitrogen, Germany, 28025-013) as published previously (Brisevac et al. 2012). For immunohistochemical analysis, mice were immediately perfused with 20 ml ice-cold saline and subsequently with 20 ml PFA (2 %) containing picric acid as published previously (Acs et al. 2009). After overnight post-fixation at 4 °C in the same fixative, tissue was processed for paraffin embedding. Brains were divided in a medio-sagittal orientation, embedded and sliced into 5-μm sections. Real-Time Polymerase Chain Reaction Gene expression was evaluated by real-time polymerase chain reaction (RT-PCR) utilizing SYBR Green SensiMixTM (Bioline, Germany, QT615-05) and carried out on the MyIQ RT-PCR detection system (Biorad, Germany) applying a standardized protocol as published previously (Clarner et al. 2011). Relative quantification of gene expression was performed with the ΔCt method. Hypoxanthin–guanin– phoshoribosyltransferase (HPRT) served as reference gene. Primer sequences and annealing temperatures are given in Table 1. Immunohistochemistry For immunohistochemistry (IHC), sections were rehydrated and heat-unmasked in citrate or Tris buffer where applicable (see Table 2), blocked with PBS containing 1 % normal horse or goat serum, and incubated overnight with the primary antibody diluted in blocking solution at 4 °C. Anti-glial fibrillary acidic protein antibody (anti-GFAP) was used to visualize astrocytes. Anti-adenomatous polyposis coli antibody (antiAPC) was used to detect mature oligodendrocyte cell bodies. To detect alterations in the distribution of AQP4 water channels in wild-type and AspaNur7/Nur7 mice, slices were stained with Anti-AQP4 antibodies. After washing, sections were incubated with biotinylated secondary antibodies (dilution 1:500; BA-1000 (anti-rabbit) or BA-2000 (anti-mouse); Vector Laboratories, Peterborough, UK) for 1 h, followed by
Table 1 Primer sequences and annealing temperatures Primer name
Sense
Antisense
Annealing temperature (°C)
Product length (bp)
Alpha1 syntrophin Aquaporin 4 (AQP4) Glial fibrillary acidic protein(GFAP) Hypoxanthin–guanin– phoshoribosyltransferase (HPRT)
GGGGCCGGGAAAACAAGAT CTTTCTGGAAGGCAGTCTCAG GAGATGATGGAGCTCAATGACC GCTGGTGAAAAGGACCTCT
ATCCCCAACAAAAAGGGCCTC CCACACCGACAAAACAAAGAT CTGGATCTCCTCCTCCAGCGA CACAGGACTAGAACACCTGC
61 61 60 60
88 62 380 248
J Mol Neurosci Table 2 Antibodies used in the experiments Antibody (primary)
Manufacturer
Host
Concentration and antigen retrieval
Adenomatous poliposis coli (APC) Aquaporin 4 (AQP4) Glial fibrillary acid protein (GFAP)
Milipore OP80 Abcam ab46182 Encore RPCA-GFAP
Mouse IgG Rabbit Rabbit
1:200 (citrate buffer) 1:500 (Tris–EDTA buffer) 1:1,000 (none)
peroxidase-coupled avidin–biotin complexes (ABC kit; Vector Laboratories). Anti-AQP4 stains were incubated with EnVision™ kit (Dako, Germany; K400711). Antibody reaction was visualized using 3,3′-diaminobenzidine (DAB; DAKO, Germany). Detailed information about the antibodies is given in Table 2. Statistics Intergroup differences were tested by ANOVA followed by Tukey's post hoc test (multiple groups) or Student's t test (two groups). All statistical tests were performed using GraphPad Prism 5 (GraphPad Software Inc.). All data are given as
Fig. 1 Age-dependent motor skill testing of ASPANur7/Nur7 mice. a Homozygote carriers of the Nur7 mutation showed significant loss of paw strength in a hanging wire approach. b Results of rotarod testing are shown. All investigated groups displayed a significantly decreased
arithmetic means±SEM. The p values are indicated as p ≤ 0.05, p ≤0.01, and p ≤0.001.
Results and Discussion In a first set of experiments, we aimed to analyzing how the phenotype of ASPANur7/Nur7 mice develops with age indicating an ongoing and progressing CNS damage due to ASPA deficiency. Two distinct experimental approaches were applied to assess both neuromuscular function (four-limb hanging wire approach) and motor performance (rotarod treadmill tests). For all experiments, age-matched healthy
latency to fall in comparison to healthy littermates. c Younger animals (11–14 weeks) showed significantly better motor performance compared to older animals. ***p
Astroglial Redistribution of Aquaporin 4 During Spongy Degeneration in a Canavan Disease Mouse Model Tim Clarner & Nicola Wieczorek & Barbara Krauspe & Katharina Jansen & Cordian Beyer & Markus Kipp
Received: 24 October 2013 / Accepted: 13 November 2013 # Springer Science+Business Media New York 2013
Abstract Canavan disease is a spongiform leukodystrophy caused by an autosomal recessive mutation in the aspartoacylase gene. Deficiency of oligodendroglial aspartoacylase activity and a subsequent increase of its substrate N -acetylaspartate are the etiologic factors for the disease. N -acetylaspartate acts as a molecular water pump. Therefore, an osmotic–hydrostatic mechanism is thought to be involved in the development of the Canavan disease phenotype. Astrocytes express water transporters and are critically involved in regulating and maintaining water homeostasis in the brain. We used the ASPANur7/Nur7 mouse model of Canavan disease to investigate whether a disturbance of water homeostasis might be involved in the disease's progression. Animals showed an age-dependent impairment of motor performance and spongy degeneration in various brain regions, among the basal ganglia, brain stem, and cerebellar white matter. Astrocyte activation was prominent in regions which displayed less tissue damage, such as the corpus callosum, cortex, mesencephalon, and stratum Purkinje of cerebellar lobe IV. Immunohistochemistry revealed alterations in the cellular distribution of the water channel aquaporin 4 in astrocytes of ASPANur7/Nur7 mice. In control animals, aquaporin 4 was located exclusively in the astrocytic end feet. In contrast, in ASPANur7/Nur7 mice, aquaporin 4 was located throughout
Tim Clarner and Nicola Wieczorek contributed equally to this work. Electronic supplementary material The online version of this article (doi:10.1007/s12031-013-0184-4) contains supplementary material, which is available to authorized users. T. Clarner (*) : N. Wieczorek : B. Krauspe : K. Jansen : C. Beyer : M. Kipp Institute of Neuroanatomy, RWTH Aachen University, Wendlingweg 2, 52074 Aachen, Germany e-mail: [email protected]
the cytoplasm. These results indicate that astroglial regulation of water homeostasis might be involved in the partial prevention of spongy degeneration. These observations highlight aquaporin 4 as a potential therapeutic target for Canavan disease. Keywords Aspartoacylase . Canavan Disease . Aquaporin 4 . Astrocyte
Introduction Canavan disease (CD) is a hereditary disorder of the central nervous system (CNS) that is caused by autosomal recessive mutations in the gene encoding for the enzyme aspartoacylase (ASPA). CD is characterized by spongy degeneration of CNS white matter, dysmyelination, edema formation, and astrocyte swelling, leading to severe early onset of neurological disability. The life expectancy of children suffering from the most common infantile/neonatal CD form is variable. While some children die early, others survive into their teenager age or even longer (Matalon and Michals-Matalon 1993–2013). In the CNS, ASPA is expressed by the oligodendrocytes, microglial cells, endothelial cells, ependymal cells, epiplexus cells, and leptomeningeal cells (Moffett et al. 2011). Its substrate N-acetylaspartate (NAA) is believed to be synthesized in the neuronal mitochondria (Baslow and Guilfoyle 2009; Baslow et al. 1999; Moffett et al. 1991). It has been proposed that NAA and its glutamate adduct NAAG are released from the neurons into the extracellular space, where NAAG is further processed by astrocytic membrane-bound peptidase producing NAA and glutamate. NAA can be taken up from the extracellular space by oligodendrocytes, which hydrolize it to acetate and aspartate (Baslow and Guilfoyle 2009).
J Mol Neurosci
Although NAA functions in the brain appear manifold (Moffett et al. 2007), acetate supply via hydrolysis of NAA in oligodendrocytes is thought to be critically involved in myelin lipid synthesis (Benarroch 2008). A lack of acetate in oligodendrocytes due to ASPA dysfunction might be one of the pathomechanisms involved in the development of CD (Arun et al. 2010; Chakraborty et al. 2001; Madhavarao et al. 2005). However, not all of the histopathological hallmarks of CD can be explained by impaired myelin synthesis and maintenance. For example, a lack of acetate fails to explain the cellular and extracellular edema as well as myelin splitting and spongiform vacuolization which are also characteristics for CD (Baslow and Guilfoyle 2009). Baslow in 2002 proposed an important role for NAA in the regulation of water homeostasis in the brain. According to his hypothesis, elevated NAA levels might lead to an increase in CNS osmotic pressure and disturbances in the removal of metabolic water from neurons, mechanisms that likely contribute to the formation of both edema and vacuolization (Baslow and Guilfoyle 2009; Baslow 2002; Baslow 2003). Lithium has been successfully used to reduce overall NAA levels in the brain and urine of CD patients. These patients displayed an improvement in myelination, alertness, social interaction, and visual tracking. A proposed mechanism of action by which lithium reduces NAA levels is the prevention of neuronal NAA efflux to the extracellular fluid, thereby possibly ameliorating changes in osmotic pressure (Assadi et al. 2010; Baslow et al. 2002; Janson et al. 2005; Solsona et al. 2012). Astrocytes are important for the regulation of CNS water homeostasis and formation of cytotoxic brain edema, since they express the water transporters aquaporin 4 (AQP4) (Baslow 2003). Each AQP4 monomer forms a narrow aqueous pore, facilitating the bidirectional water movement across the membranes in response to osmotic gradients (Papadopoulos and Verkman 2013). AQP4 is the principal member of the AQP protein family in the CNS and implicated in cell migration and excitation of neurons. Water channels are not evenly distributed throughout the astrocytic cell compartments. AQP4 is predominantly expressed under normal physiological conditions in the astrocytic end feet which form the glial barrier along small brain vessels and the pia mater (Nagelhus et al. 2004; Masaki et al. 2010). In contrast, AQP9 is mainly found on astrocyte cell bodies and processes (Badaut et al. 2002). Dynamics of AQP4 levels are best documented under ischemia and traumatic injury in the brain where both AQPs are up-regulated (Badaut et al. 2002). In the present study, we used ASPANur7/Nur7 mice as model organisms mimicking certain aspects of CD to investigate the development of motor deficits and tissue vacuolization in mice at different ages. Furthermore, we correlated behavioral and histopathologic changes with astrocyte reactivity and AQP4 expression and subcellular distribution.
Materials and Methods Animals Heterozygote AspaNur7/J mice, (stock number 008607, C57BL/6 J background) were provided by Jackson Laboratory (USA) and used for breeding. ASPANur7 mice carry a point mutation from cytosine to thymidine on position 577 in the ASPA gene on chromosome 11. This mutation leads to the production of a truncated and dysfunctional ASPA enzyme (Traka et al. 2008). Whereas heterozygote carriers of the mutation develop normally and show no signs of impaired motor functions or histopathological alterations, homozygote carriers develop an age-dependent impairment of motor skills, increasing edema, accumulation of NAA within the CNS, and spongy degeneration (Traka et al. 2008). The animals underwent routine cage maintenance once a week and microbiological monitoring according to the Federation of European Laboratory Animal Science Associations recommendations. Food (Sniff Spezialdiäten, Germany) and water were available ad libitum. Research and animal care procedures were approved by the Review Board for the Care of Animal Subjects of the district government (North RhineWestfalia, Germany) and were performed according to international guidelines on the use of laboratory animals. To study age-dependent differences of AspaNur7/Nur7 mice in motor skill performance, animals were divided into three groups. Group 1 “young” (n =3) consisted of animals from 11 to 14 weeks of age, group 2 “middle aged” (n =4) was 18 to 21 weeks old, and group 3 “old” (n =5) was 24–27 weeks of age. Agematched controls (n =5) were obtained from genotyped healthy littermates. Genotyping ASPANur7/Nur7 mice carry a homozygote transition of cytosine to thymidine on position 577 in the gene encoding for ASPA, causing the nonsense mutation Q193X (Traka et al. 2008). Mice were genotyped by sequencing the areas of interest on chromosome 11. Therefore, the DNA was isolated from mouse tail using the NucleoSpin® tissue kit (MachereyNagel, Germany; 740952.50) according to the manufacturer's instructions. The DNA region of interest was amplified by polymerase chain reaction (PCR) using the following primer pair: ASPA sense TGACATTGTCTCTGTTATTTTCCA and ASPA antisense CCCCCAAGTTAAGCCATGTA, resulting in a PCR product of 289 bp in length. The PCR product was purified with the NucleoSpin® Extract II kit (MachereyNagel, Germany; 740609.50) and subsequently sequenced by Seqlab (Göttingen, Germany). The sequence of interest was as follows: CACGGTGTCCTTAGAGCTGATATTTT AGAC(C/T)AAATGAGAAAAATGATAAAACATGCTCA typical result of the sequence analysis of WT, heterozygote
J Mol Neurosci
ASPANur7, and homozygote ASPANur7/Nur7 animals is shown in supplementary Fig. 1. Motor Skill Tests To investigate age-dependent impairment of motor skills, we performed two distinct test paradigms. A four-paw “hanging wire” approach was performed to assess paw strength as indicator of neuromuscular functions (Crawley 1999). Therefore, a wire cage lid was bordered with tape to form a 10 cm×15.5 cm field in which the animals were placed. Mice were allowed to strongly grip the wires and the lid was gently turned upside down, which were held approximately 20 cm above cushioned ground and the latency to fall was measured. Healthy mice can avoid falling off for at least 60 s and a cutoff was set at this time point. Neuromuscular disabilities result in preterm falloffs. To test motor coordination and balance, rotarod treadmill tests were performed using the IITC Rotarod (Series 8, Life Science). Linear acceleration from 4 to 40 rpm over a 5-min test session was applied. Two trials per day were performed with each animal on four consecutive days and the latency to fall was measured for each animal. Before initiation of the experiments, mice were allowed to acclimatize to the testing environment for at least 1 h. Consecutive trials were timematched (starting at 4 p.m.) to exclude a possible impact of circadian rhythm on motor performance. Tissue Preparation For gene expression studies, mice were deeply anesthetized and transcardially perfused with 20 ml of ice-cold saline. Brains were removed and the regions of interest were dissected by a stereomicroscopic approach as published previously by our group (Schmidt et al. 2013). Tissue was subsequently homogenized in PeqGold RNA Pure (PeqLab, Germany; cat. no. 30-1010) or snap frozen in liquid nitrogen and stored at −80 °C until use. The isolation procedures were performed according to the manufacturer's protocol. RNA concentration and purity were photometrically measured on a NanoDrop 1000 (Thermo Fisher Scientific, USA).
Reverse transcription was performed using 1 μg of total RNA and a MMLV reverse transcriptase kit (Invitrogen, Germany, 28025-013) as published previously (Brisevac et al. 2012). For immunohistochemical analysis, mice were immediately perfused with 20 ml ice-cold saline and subsequently with 20 ml PFA (2 %) containing picric acid as published previously (Acs et al. 2009). After overnight post-fixation at 4 °C in the same fixative, tissue was processed for paraffin embedding. Brains were divided in a medio-sagittal orientation, embedded and sliced into 5-μm sections. Real-Time Polymerase Chain Reaction Gene expression was evaluated by real-time polymerase chain reaction (RT-PCR) utilizing SYBR Green SensiMixTM (Bioline, Germany, QT615-05) and carried out on the MyIQ RT-PCR detection system (Biorad, Germany) applying a standardized protocol as published previously (Clarner et al. 2011). Relative quantification of gene expression was performed with the ΔCt method. Hypoxanthin–guanin– phoshoribosyltransferase (HPRT) served as reference gene. Primer sequences and annealing temperatures are given in Table 1. Immunohistochemistry For immunohistochemistry (IHC), sections were rehydrated and heat-unmasked in citrate or Tris buffer where applicable (see Table 2), blocked with PBS containing 1 % normal horse or goat serum, and incubated overnight with the primary antibody diluted in blocking solution at 4 °C. Anti-glial fibrillary acidic protein antibody (anti-GFAP) was used to visualize astrocytes. Anti-adenomatous polyposis coli antibody (antiAPC) was used to detect mature oligodendrocyte cell bodies. To detect alterations in the distribution of AQP4 water channels in wild-type and AspaNur7/Nur7 mice, slices were stained with Anti-AQP4 antibodies. After washing, sections were incubated with biotinylated secondary antibodies (dilution 1:500; BA-1000 (anti-rabbit) or BA-2000 (anti-mouse); Vector Laboratories, Peterborough, UK) for 1 h, followed by
Table 1 Primer sequences and annealing temperatures Primer name
Sense
Antisense
Annealing temperature (°C)
Product length (bp)
Alpha1 syntrophin Aquaporin 4 (AQP4) Glial fibrillary acidic protein(GFAP) Hypoxanthin–guanin– phoshoribosyltransferase (HPRT)
GGGGCCGGGAAAACAAGAT CTTTCTGGAAGGCAGTCTCAG GAGATGATGGAGCTCAATGACC GCTGGTGAAAAGGACCTCT
ATCCCCAACAAAAAGGGCCTC CCACACCGACAAAACAAAGAT CTGGATCTCCTCCTCCAGCGA CACAGGACTAGAACACCTGC
61 61 60 60
88 62 380 248
J Mol Neurosci Table 2 Antibodies used in the experiments Antibody (primary)
Manufacturer
Host
Concentration and antigen retrieval
Adenomatous poliposis coli (APC) Aquaporin 4 (AQP4) Glial fibrillary acid protein (GFAP)
Milipore OP80 Abcam ab46182 Encore RPCA-GFAP
Mouse IgG Rabbit Rabbit
1:200 (citrate buffer) 1:500 (Tris–EDTA buffer) 1:1,000 (none)
peroxidase-coupled avidin–biotin complexes (ABC kit; Vector Laboratories). Anti-AQP4 stains were incubated with EnVision™ kit (Dako, Germany; K400711). Antibody reaction was visualized using 3,3′-diaminobenzidine (DAB; DAKO, Germany). Detailed information about the antibodies is given in Table 2. Statistics Intergroup differences were tested by ANOVA followed by Tukey's post hoc test (multiple groups) or Student's t test (two groups). All statistical tests were performed using GraphPad Prism 5 (GraphPad Software Inc.). All data are given as
Fig. 1 Age-dependent motor skill testing of ASPANur7/Nur7 mice. a Homozygote carriers of the Nur7 mutation showed significant loss of paw strength in a hanging wire approach. b Results of rotarod testing are shown. All investigated groups displayed a significantly decreased
arithmetic means±SEM. The p values are indicated as p ≤ 0.05, p ≤0.01, and p ≤0.001.
Results and Discussion In a first set of experiments, we aimed to analyzing how the phenotype of ASPANur7/Nur7 mice develops with age indicating an ongoing and progressing CNS damage due to ASPA deficiency. Two distinct experimental approaches were applied to assess both neuromuscular function (four-limb hanging wire approach) and motor performance (rotarod treadmill tests). For all experiments, age-matched healthy
latency to fall in comparison to healthy littermates. c Younger animals (11–14 weeks) showed significantly better motor performance compared to older animals. ***p
