Proc. Nadl. Acad. Sci. USA Vol. 89, pp. 7664-7668, August 1992 Biochemistry
ATP hydrolysis by initiation factor 4A is required for translation initiation in Saccharomyces cerevisiae (DEAD box protein/RNA helicase/ATP binding)
SYLVIANE BLUM*, STEFANIE R. SCHMIDt, ARNIM PAUSE:, PETER BUSERt, PATRICK LINDERt, NAHUM SONENBERGt, AND HANS TRACHSEL*§ *Institut fur Biochemie und Molekularbiologie der Universitit Bern, Bfihlstrasse 28, CH-3012 Bern, Switzerland; tDepartment of Microbiology, Biocenter, University of Basel, CH-4056 Basel, Switzerland; and tDepartment of Biochemistry and McGill Cancer Center, McGill University, Montreal, PQ, Canada H3G 1Y6
Communicated by Gottfried Schatz, May 18, 1992
ABSTRACT Saccharomyces cerevisiae translation initiation factor eIF-4A, an RNA helicase of the Asp-Glu-Ala-Asp (DEAD) box protein family, was mutated in the putative ATP binding site and expressed in Escherichia coli. Mutant proteins with alanine at position 66 replaced by glycine [eIF-4A(A66G)J or valine [eIF-4A(A66V)] were purified from Escherichia colt extracts and analyzed in vitro for activity in ATP crosslinking, ATP hydrolysis, RNA helicase, and translation assays. The results show that in vitro ATP hydrolysis activity, RNA helicase activity, and translation activity of eIF-4A correlate with in vivo activity of the factor. Whereas eIF-4A(A66G) showed wild-type activity in all assays, eIF-4A(A66V) was active in ATP crosslinking but inactive in ATP hydrolysis and RNA helicase assays. In vitro translation was supported by wild-type e1IF-4A and eIF-4A(A66G) but not by eIF-4A(A66V). The results show that, for their translation, the majority of mRNAs from Sacharomyces cerevisiae including an mRNA with the initiator AUG positioned 8 nucleotides downstream of the cap structure require eIF-4A that is able to hydrolyze ATP.
of great interest. During the last few years, a large number of proteins with sequence homology to eIF4A were discovered (for a review, see ref. 14). They all share conserved sequence elements including an Asp-Glu-Ala-Asp (DEAD) motif, which gave the name to the family of putative RNA helicases (15). A number of DEAD proteins have also been identified in the yeast Saccharomyces cerevisiae (14), among them yeast eIF4A (16). Yeast eIF-4A could become a model system for studies of RNA helicase function because its activity can be readily measured in in vitro translation extracts (17) and in reconstituted helicase assays (18). We have reported (19) the isolation and in vivo characterization of mutations in TIF) and TIF2 genes encoding the eIF-4A protein in yeast. Here, we report on the further in vitro analysis ofmutations in the putative ATP binding site of yeast eIF4A and their effects on ATPase, RNA helicase, and in vitro translation activity.
EXPERIMENTAL PROCEDURES Construction of Expression Vectors. For technical reasons we used the TIFI-TIF2 (TIFI-2) hybrid gene that codes for the same protein as TIFI or TIF2 (19). The TIFI-2 hybrid gene and a Shine-Dalgarno (SD) sequence were inserted downstream of the T7 promoter of plasmid pTZ18 (Pharmacia) into the Sac I and Pst I sites of the polylinker. For this the nucleotide sequence upstream of the ATG codon of the TIFI-2 gene was replaced by the sequence GAGCTCAGGAGGAAAATAAAA i by site-directed mutagenesis, where underlined sequences are the Shine-Dalgarno sequence and the initiator codon, respectively. This recreated a Sac I site upstream of the SD sequence. DNA sequences encoding eIF-4A with mutations at position 66 of the putative ATP binding site (19) were cut out of the plasmid pFL39(ACla) with restriction enzymes Acc I and Pst I, inserted into pTZ18/SD-TIF linearized with Acc I and Pst I, and gel-purified. All three plasmids, pTZ18/SD-TIF (wildtype, alanine at position 66), pTZ18/SD-TIF(A66G) (glycine at position 66), and pTZ18/SD-TIF(A66V) (valiue at position 66), were sequenced to check the mutated position 66 and expressed in Escherichia coli HB101 as authentic eIF4A proteins. Expression and Purification of eIF-4A from E. colt. Wildtype and mutant eIF-4A proteins were expressed in 1.5-liter cultures of E. coli HB101 grown to an OD595 of 3 to 4. Cells were pelleted for 5 min at 1000 x g and washed once with distilled water. About 6 g of cells were resuspended in 12 ml of 20 mM Tris HCl, pH 7.4/100 mM KCl/0.2 mM EDTA/14
Initiation oftranslation is a multistep biochemical pathway in which initiator Met-tRNA is bound to the ribosome and the ribosome is positioned at an initiator AUG codon on mRNA. In eukaryotes, this pathway includes binding of translation initiation factors to the 7-methylguanosine 5'-triphosphate (m7Gppp) cap structure at the 5' end of mRNA, local mRNA secondary structure unwinding, and binding of the small ribosomal subunit (for reviews, see refs. 1-5). Bound ribosomal subunits then scan the mRNA until they reach the initiator AUG codon. To function as an initiator codon, the AUG codon has to be flanked by appropriate nucleotide sequences (6). Binding of ribosomal subunits to mRNA and scanning are believed to require ATP (7) and are inhibited by RNA secondary structure (for a review, see ref. 8). Recently, unwinding of mRNA secondary structure was demonstrated in vitro with the two eukaryotic initiation factors eIF-4A and eIF-4B in the presence of ATP (9). The weak RNA binding and ATPase activity of eIF-4A is stimulated by eIF-4B (10). It is therefore assumed that both factors cooperate closely to melt RNA secondary structures. Sequencing of mouse eIF-4A and HeLa eIF-4B cDNAs revealed an ATP binding site in eIF-4A (11) and an RNA binding motif in eIF-4B (12) and binding of ATP to mouse eIF-4A could be abolished by mutating its putative ATP binding site (13). Altogether this indicates that eIF-4A is responsible for ATP hydrolysis during RNA unwinding. Since mRNA secondary structures are inhibitory for translation initiation, the elucidation of the mechanism by which eIF-4A and associated factors melt double-stranded RNA is
Abbreviations: eIF-4A and eIF-4B, eukaryotic initiation factors 4A and 4B, respectively; CAT, chloramphenicol acetyltransferase; TK, thymidine kinase. §To whom reprint requests should be addressed.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
7664
Biochemistry: Blum et al. mM 2-mercaptoethanol/1 mM phenylmethylsulfonyl fluoride and lysed with a Jeda press at 5 bars (1 bar = 100 kPa). The homogenate was centrifuged in a TFT 65.13 rotor (Centrikon, Zurich) at 49,000 rpm for 2 h at 40C (K factor = 50). The pellet was discarded and the supernatant was further fractionated. Chromatographic Procedures. All chromatographic steps were performed at 80C and the presence of eIF-4A was measured by Western blot analysis. E. coli total protein was applied to a Whatman DE-52 column (2 x 10 cm), equilibrated with buffer A (20 mM TrisHCl, pH 7.6/0.2 mM EDTA) containing 150 mM KCl. The column was washed with the buffer A containing 150 mM KCl and eIF-4A was step-eluted with buffer A containing 300 mM KCl. The protein mixture was diluted to 150 mM KCl with buffer B [20 mM Tris HCl (pH 7.6)] and applied to a Pharmacia Mono Q (5/5) column equilibrated with buffer B. The column was washed with buffer B containing 150 mM KCl and for 5 min with a gradient from 150 mM KCl to 180 mM KCl in buffer B at a flow rate of 1.5 ml/min. Elution of eIF-4A was done with a 52.5-ml gradient from 180 mM to 220 mM KCl in buffer B at a flow rate of 1.5 ml/min. The factor was eluted at about 200 mM KCl. Fractions containing eIF-4A were brought to 1.5 M ammonium sulfate by addition of crystalline ammonium sulfate and kept on ice overnight. The protein solution was filtered and applied to a Pharmacia phenyl-Superose HR (5/5) column equilibrated with 20 mM Hepes-KOH, pH 7.4/1.5 M ammonium sulfate. The column was washed with this buffer and eIF-4A was eluted with a 15-ml gradient from 1.5 M to no ammonium sulfate in 20 mM Hepes-KOH (pH 7.4) at a flow rate of 0.25 ml/min. Fractions containing eIF4A were dialyzed against 20 mM Hepes-KOH, pH 7.4/100 mM K(OAc)/0.2 mM EDTA. SDS/Polyacrylamide Gel Electrophoresis and Western Blot Analysis. SDS/polyacrylamide gel electrophoresis (20) and Western blot analysis (17, 21) were done as described. Western blots were incubated with sera of rats immunized with wild-type yeast eIF-4A (17). Crosslinking of ATP to eLF-4A. UV-induced crosslinking was essentially done as described by Sarkar et al. (22) with a few modifications. Reaction mixtures (10 IlI) containing 1 ,ug of eIF-4A in 50 mM Tris HCl, pH 7.5/50 mM KC1/3 mM Mg(OAc)2/0.1 mM dithiothreitol/6% (wt/vol) glycerol and 5 ,Ci of [a-32P]ATP (3000 Ci/mmol; 1 Ci = 37 GBq) were mixed on ice, placed on a Parafilm-covered glass plate on ice, and irradiated for 15 min from a distance of 3 cm with an 8-W Sylvania G8T5 germicidal lamp. Proteins were fractionated by SDS/polyacrylamide gel electrophoresis, and gels were stained with Coomassie brilliant blue, dried, and exposed to Fuji x-ray film. ATPase Assay. The release of phosphate from [y-32P]ATP (3000 Ci/mmol) was measured as described (23). The only modification introduced was to carry out the reactions at the bottom of 15-ml Falcon tubes to allow phosphate extraction without transfer of reaction mixtures. RNA Unwinding Assay. The unwinding assay and the preparation of the duplex RNA substrate were carried out as described (18). The RNA consisted of a 10-base-pair duplex region and two 3'-terminal single-stranded tails. For the helicase assay, 2 jig of recombinant yeast eIF-4A and 0.3 jig of recombinant mammalian eIF-4B were incubated with 0.4 ng of 32P-labeled RNA (107 cpm/pg of RNA) for 30 min at 37°C in 20 mM TrisHCl, pH 7.5/70 mM KCl/0.5 mM Mg(OAc)2/1.5 mM dithiothreitol/l mM ATP/20 units of RNasin (Promega) in a final volume of 40 ,ul. The reactions were stopped by addition of 0.125 vol of 3% (wt/vol) SDS/ 30% glycerol/150 mM EDTA. Total reaction mixtures were then analyzed by SDS/polyacrylamide gel electrophoresis and the reaction products were visualized by autoradiography.
Proc. Natl. Acad. Sci. USA 89 (1992)
7665
In Vitro Translation. eIF-4A-dependent extracts were prepared and cell-free translation was performed as described (17). Total yeast RNA from strain ABYS was prepared as described (24). The chloramphenicol acetyltransferase (CAT) gene was transcribed from the plasmid pSP64 in vitro with SP6 polymerase in the presence of 7-methylguanosine (5')triphospho(5')guanosine (m7GpppG) to cap the transcripts (25). The thymidine kinase (TK) gene with the ATG translation initiation start codon 8 nucleotides downstream of the cap structure was transcribed from the plasmid TK30 in vitro with T7 polymerase in the presence of m7GpppG to cap the transcripts (25).
RESULTS Purification of eIF-4A. One of the sequence elements conserved in the DEAD protein family of RNA helicases is the sequence motif AXXGXGKT (15). This sequence is believed to be part of an ATP binding site (26). The alanine residue in this motif (position 66 in S. cerevisiae eIF-4A) is found in most proteins of this family. To probe its significance, Ala-66 was replaced by glycine, eIF-4A(A66G), or valine, eIF-4A(A66V) (19). Replacement with glycine resulted in wild-type growth rate, whereas replacement with valine was lethal for the cells (19). To analyze these mutations biochemically, wild-type and mutant TIF genes were expressed in E. coli and the proteins were purified to near homogeneity. A Coomassie brilliant blue-stained SDS/polyacrylamide gel displaying the purified eIF-4A preparations is shown in Fig. 1. All preparations show the major 43-kDa eIF-4A band and a slightly faster migrating protein band that must be related to eIF-4A because it reacts with anti-eIF-4A antibodies (17). Crosslinking of ATP to eIF-4A. Since the mutations introduced into eIF-4A lie in the putative ATP binding domain, the interaction of wild-type (eIF-4Awt) and mutant yeast eIF-4A with ATP was analyzed. The interaction was measured by incubating eIF-4A preparations with labeled ATP, followed by UV-crosslinking of eIF-4A-ATP complexes and analysis of the labeled proteins on SDS/polyacrylamide gels. The autoradiogram in Fig. 2 shows that all eIF-4A preparations were able to bind and crosslink similar amounts of ATP. However, we cannot estimate binding constants or possible changes in binding constants from this experiment. As a control, crosslinking was done in the presence of various concentrations of unlabeled ATP, dATP, GTP, CTP, or TTP. The addition of ATP or dATP to a concentration of 10 uM lowered signal intensity strongly whereas GTP, CTP, or TTP at 100 ,M had no influence on signal intensity (data not shown). 1
2
3
C3
>
CD
CD
I-
I-
cK
c- TK mRNA->
40
S_
~--
duplex
_b0
S0
_ _.
4
4-
_
:..
monomer
-,,P
a
eK
FIG. 4. RNA helicase activity of eIF-4A. The RNA helicase assay was performed and the autoradiogram is shown. Lanes: 1, duplex RNA incubated under unwinding conditions without protein for 30 min at 37rC; 2, duplex RNA incubated for 5 min at 90TC; 3, wild-type eIF-4A plus eIF-4B without ATP; 4, eIF-4B by itself; 5, eIF-4Awt plus eIF-4B; 6, eIF-4A(A66G) plus eIF-4B; 7, eIF4A(A66V) plus eIF-4B. The nature of the band between duplex and monomer RNA is not known.
CD >
> W
*-
3: (AD
ATP hydrolysis by initiation factor 4A is required for translation initiation in Saccharomyces cerevisiae (DEAD box protein/RNA helicase/ATP binding)
SYLVIANE BLUM*, STEFANIE R. SCHMIDt, ARNIM PAUSE:, PETER BUSERt, PATRICK LINDERt, NAHUM SONENBERGt, AND HANS TRACHSEL*§ *Institut fur Biochemie und Molekularbiologie der Universitit Bern, Bfihlstrasse 28, CH-3012 Bern, Switzerland; tDepartment of Microbiology, Biocenter, University of Basel, CH-4056 Basel, Switzerland; and tDepartment of Biochemistry and McGill Cancer Center, McGill University, Montreal, PQ, Canada H3G 1Y6
Communicated by Gottfried Schatz, May 18, 1992
ABSTRACT Saccharomyces cerevisiae translation initiation factor eIF-4A, an RNA helicase of the Asp-Glu-Ala-Asp (DEAD) box protein family, was mutated in the putative ATP binding site and expressed in Escherichia coli. Mutant proteins with alanine at position 66 replaced by glycine [eIF-4A(A66G)J or valine [eIF-4A(A66V)] were purified from Escherichia colt extracts and analyzed in vitro for activity in ATP crosslinking, ATP hydrolysis, RNA helicase, and translation assays. The results show that in vitro ATP hydrolysis activity, RNA helicase activity, and translation activity of eIF-4A correlate with in vivo activity of the factor. Whereas eIF-4A(A66G) showed wild-type activity in all assays, eIF-4A(A66V) was active in ATP crosslinking but inactive in ATP hydrolysis and RNA helicase assays. In vitro translation was supported by wild-type e1IF-4A and eIF-4A(A66G) but not by eIF-4A(A66V). The results show that, for their translation, the majority of mRNAs from Sacharomyces cerevisiae including an mRNA with the initiator AUG positioned 8 nucleotides downstream of the cap structure require eIF-4A that is able to hydrolyze ATP.
of great interest. During the last few years, a large number of proteins with sequence homology to eIF4A were discovered (for a review, see ref. 14). They all share conserved sequence elements including an Asp-Glu-Ala-Asp (DEAD) motif, which gave the name to the family of putative RNA helicases (15). A number of DEAD proteins have also been identified in the yeast Saccharomyces cerevisiae (14), among them yeast eIF4A (16). Yeast eIF-4A could become a model system for studies of RNA helicase function because its activity can be readily measured in in vitro translation extracts (17) and in reconstituted helicase assays (18). We have reported (19) the isolation and in vivo characterization of mutations in TIF) and TIF2 genes encoding the eIF-4A protein in yeast. Here, we report on the further in vitro analysis ofmutations in the putative ATP binding site of yeast eIF4A and their effects on ATPase, RNA helicase, and in vitro translation activity.
EXPERIMENTAL PROCEDURES Construction of Expression Vectors. For technical reasons we used the TIFI-TIF2 (TIFI-2) hybrid gene that codes for the same protein as TIFI or TIF2 (19). The TIFI-2 hybrid gene and a Shine-Dalgarno (SD) sequence were inserted downstream of the T7 promoter of plasmid pTZ18 (Pharmacia) into the Sac I and Pst I sites of the polylinker. For this the nucleotide sequence upstream of the ATG codon of the TIFI-2 gene was replaced by the sequence GAGCTCAGGAGGAAAATAAAA i by site-directed mutagenesis, where underlined sequences are the Shine-Dalgarno sequence and the initiator codon, respectively. This recreated a Sac I site upstream of the SD sequence. DNA sequences encoding eIF-4A with mutations at position 66 of the putative ATP binding site (19) were cut out of the plasmid pFL39(ACla) with restriction enzymes Acc I and Pst I, inserted into pTZ18/SD-TIF linearized with Acc I and Pst I, and gel-purified. All three plasmids, pTZ18/SD-TIF (wildtype, alanine at position 66), pTZ18/SD-TIF(A66G) (glycine at position 66), and pTZ18/SD-TIF(A66V) (valiue at position 66), were sequenced to check the mutated position 66 and expressed in Escherichia coli HB101 as authentic eIF4A proteins. Expression and Purification of eIF-4A from E. colt. Wildtype and mutant eIF-4A proteins were expressed in 1.5-liter cultures of E. coli HB101 grown to an OD595 of 3 to 4. Cells were pelleted for 5 min at 1000 x g and washed once with distilled water. About 6 g of cells were resuspended in 12 ml of 20 mM Tris HCl, pH 7.4/100 mM KCl/0.2 mM EDTA/14
Initiation oftranslation is a multistep biochemical pathway in which initiator Met-tRNA is bound to the ribosome and the ribosome is positioned at an initiator AUG codon on mRNA. In eukaryotes, this pathway includes binding of translation initiation factors to the 7-methylguanosine 5'-triphosphate (m7Gppp) cap structure at the 5' end of mRNA, local mRNA secondary structure unwinding, and binding of the small ribosomal subunit (for reviews, see refs. 1-5). Bound ribosomal subunits then scan the mRNA until they reach the initiator AUG codon. To function as an initiator codon, the AUG codon has to be flanked by appropriate nucleotide sequences (6). Binding of ribosomal subunits to mRNA and scanning are believed to require ATP (7) and are inhibited by RNA secondary structure (for a review, see ref. 8). Recently, unwinding of mRNA secondary structure was demonstrated in vitro with the two eukaryotic initiation factors eIF-4A and eIF-4B in the presence of ATP (9). The weak RNA binding and ATPase activity of eIF-4A is stimulated by eIF-4B (10). It is therefore assumed that both factors cooperate closely to melt RNA secondary structures. Sequencing of mouse eIF-4A and HeLa eIF-4B cDNAs revealed an ATP binding site in eIF-4A (11) and an RNA binding motif in eIF-4B (12) and binding of ATP to mouse eIF-4A could be abolished by mutating its putative ATP binding site (13). Altogether this indicates that eIF-4A is responsible for ATP hydrolysis during RNA unwinding. Since mRNA secondary structures are inhibitory for translation initiation, the elucidation of the mechanism by which eIF-4A and associated factors melt double-stranded RNA is
Abbreviations: eIF-4A and eIF-4B, eukaryotic initiation factors 4A and 4B, respectively; CAT, chloramphenicol acetyltransferase; TK, thymidine kinase. §To whom reprint requests should be addressed.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
7664
Biochemistry: Blum et al. mM 2-mercaptoethanol/1 mM phenylmethylsulfonyl fluoride and lysed with a Jeda press at 5 bars (1 bar = 100 kPa). The homogenate was centrifuged in a TFT 65.13 rotor (Centrikon, Zurich) at 49,000 rpm for 2 h at 40C (K factor = 50). The pellet was discarded and the supernatant was further fractionated. Chromatographic Procedures. All chromatographic steps were performed at 80C and the presence of eIF-4A was measured by Western blot analysis. E. coli total protein was applied to a Whatman DE-52 column (2 x 10 cm), equilibrated with buffer A (20 mM TrisHCl, pH 7.6/0.2 mM EDTA) containing 150 mM KCl. The column was washed with the buffer A containing 150 mM KCl and eIF-4A was step-eluted with buffer A containing 300 mM KCl. The protein mixture was diluted to 150 mM KCl with buffer B [20 mM Tris HCl (pH 7.6)] and applied to a Pharmacia Mono Q (5/5) column equilibrated with buffer B. The column was washed with buffer B containing 150 mM KCl and for 5 min with a gradient from 150 mM KCl to 180 mM KCl in buffer B at a flow rate of 1.5 ml/min. Elution of eIF-4A was done with a 52.5-ml gradient from 180 mM to 220 mM KCl in buffer B at a flow rate of 1.5 ml/min. The factor was eluted at about 200 mM KCl. Fractions containing eIF-4A were brought to 1.5 M ammonium sulfate by addition of crystalline ammonium sulfate and kept on ice overnight. The protein solution was filtered and applied to a Pharmacia phenyl-Superose HR (5/5) column equilibrated with 20 mM Hepes-KOH, pH 7.4/1.5 M ammonium sulfate. The column was washed with this buffer and eIF-4A was eluted with a 15-ml gradient from 1.5 M to no ammonium sulfate in 20 mM Hepes-KOH (pH 7.4) at a flow rate of 0.25 ml/min. Fractions containing eIF4A were dialyzed against 20 mM Hepes-KOH, pH 7.4/100 mM K(OAc)/0.2 mM EDTA. SDS/Polyacrylamide Gel Electrophoresis and Western Blot Analysis. SDS/polyacrylamide gel electrophoresis (20) and Western blot analysis (17, 21) were done as described. Western blots were incubated with sera of rats immunized with wild-type yeast eIF-4A (17). Crosslinking of ATP to eLF-4A. UV-induced crosslinking was essentially done as described by Sarkar et al. (22) with a few modifications. Reaction mixtures (10 IlI) containing 1 ,ug of eIF-4A in 50 mM Tris HCl, pH 7.5/50 mM KC1/3 mM Mg(OAc)2/0.1 mM dithiothreitol/6% (wt/vol) glycerol and 5 ,Ci of [a-32P]ATP (3000 Ci/mmol; 1 Ci = 37 GBq) were mixed on ice, placed on a Parafilm-covered glass plate on ice, and irradiated for 15 min from a distance of 3 cm with an 8-W Sylvania G8T5 germicidal lamp. Proteins were fractionated by SDS/polyacrylamide gel electrophoresis, and gels were stained with Coomassie brilliant blue, dried, and exposed to Fuji x-ray film. ATPase Assay. The release of phosphate from [y-32P]ATP (3000 Ci/mmol) was measured as described (23). The only modification introduced was to carry out the reactions at the bottom of 15-ml Falcon tubes to allow phosphate extraction without transfer of reaction mixtures. RNA Unwinding Assay. The unwinding assay and the preparation of the duplex RNA substrate were carried out as described (18). The RNA consisted of a 10-base-pair duplex region and two 3'-terminal single-stranded tails. For the helicase assay, 2 jig of recombinant yeast eIF-4A and 0.3 jig of recombinant mammalian eIF-4B were incubated with 0.4 ng of 32P-labeled RNA (107 cpm/pg of RNA) for 30 min at 37°C in 20 mM TrisHCl, pH 7.5/70 mM KCl/0.5 mM Mg(OAc)2/1.5 mM dithiothreitol/l mM ATP/20 units of RNasin (Promega) in a final volume of 40 ,ul. The reactions were stopped by addition of 0.125 vol of 3% (wt/vol) SDS/ 30% glycerol/150 mM EDTA. Total reaction mixtures were then analyzed by SDS/polyacrylamide gel electrophoresis and the reaction products were visualized by autoradiography.
Proc. Natl. Acad. Sci. USA 89 (1992)
7665
In Vitro Translation. eIF-4A-dependent extracts were prepared and cell-free translation was performed as described (17). Total yeast RNA from strain ABYS was prepared as described (24). The chloramphenicol acetyltransferase (CAT) gene was transcribed from the plasmid pSP64 in vitro with SP6 polymerase in the presence of 7-methylguanosine (5')triphospho(5')guanosine (m7GpppG) to cap the transcripts (25). The thymidine kinase (TK) gene with the ATG translation initiation start codon 8 nucleotides downstream of the cap structure was transcribed from the plasmid TK30 in vitro with T7 polymerase in the presence of m7GpppG to cap the transcripts (25).
RESULTS Purification of eIF-4A. One of the sequence elements conserved in the DEAD protein family of RNA helicases is the sequence motif AXXGXGKT (15). This sequence is believed to be part of an ATP binding site (26). The alanine residue in this motif (position 66 in S. cerevisiae eIF-4A) is found in most proteins of this family. To probe its significance, Ala-66 was replaced by glycine, eIF-4A(A66G), or valine, eIF-4A(A66V) (19). Replacement with glycine resulted in wild-type growth rate, whereas replacement with valine was lethal for the cells (19). To analyze these mutations biochemically, wild-type and mutant TIF genes were expressed in E. coli and the proteins were purified to near homogeneity. A Coomassie brilliant blue-stained SDS/polyacrylamide gel displaying the purified eIF-4A preparations is shown in Fig. 1. All preparations show the major 43-kDa eIF-4A band and a slightly faster migrating protein band that must be related to eIF-4A because it reacts with anti-eIF-4A antibodies (17). Crosslinking of ATP to eIF-4A. Since the mutations introduced into eIF-4A lie in the putative ATP binding domain, the interaction of wild-type (eIF-4Awt) and mutant yeast eIF-4A with ATP was analyzed. The interaction was measured by incubating eIF-4A preparations with labeled ATP, followed by UV-crosslinking of eIF-4A-ATP complexes and analysis of the labeled proteins on SDS/polyacrylamide gels. The autoradiogram in Fig. 2 shows that all eIF-4A preparations were able to bind and crosslink similar amounts of ATP. However, we cannot estimate binding constants or possible changes in binding constants from this experiment. As a control, crosslinking was done in the presence of various concentrations of unlabeled ATP, dATP, GTP, CTP, or TTP. The addition of ATP or dATP to a concentration of 10 uM lowered signal intensity strongly whereas GTP, CTP, or TTP at 100 ,M had no influence on signal intensity (data not shown). 1
2
3
C3
>
CD
CD
I-
I-
cK
c- TK mRNA->
40
S_
~--
duplex
_b0
S0
_ _.
4
4-
_
:..
monomer
-,,P
a
eK
FIG. 4. RNA helicase activity of eIF-4A. The RNA helicase assay was performed and the autoradiogram is shown. Lanes: 1, duplex RNA incubated under unwinding conditions without protein for 30 min at 37rC; 2, duplex RNA incubated for 5 min at 90TC; 3, wild-type eIF-4A plus eIF-4B without ATP; 4, eIF-4B by itself; 5, eIF-4Awt plus eIF-4B; 6, eIF-4A(A66G) plus eIF-4B; 7, eIF4A(A66V) plus eIF-4B. The nature of the band between duplex and monomer RNA is not known.
CD >
> W
*-
3: (AD
