+

MODEL

Microbes and Infection xx (2015) 1e8 www.elsevier.com/locate/micinf

Original article

Autoinducer-2 increases biofilm formation via an ica- and bhp-dependent manner in Staphylococcus epidermidis RP62A Ting Xue*, Jingtian Ni, Fei Shang, Xiaolin Chen, Ming Zhang School of Life Sciences, Anhui Agricultural University, Hefei, Anhui 230036, China Received 18 November 2014; accepted 14 January 2015

Abstract Staphylococcus epidermidis has become the most common cause of nosocomial bacteraemia and the principal organism responsible for indwelling medical device -associated infections. Its pathogenicity is mainly due to its ability to form biofilms on the implanted medical devices. Biofilm formation is a quorum-sensing (QS)-dependent process controlled by autoinducers, which are signalling molecules. Here, we investigated the function of the autoinducer-2 (AI-2) QS system, especially the influence of AI-2 on biofilm formation in S. epidermidis RP62A. Results showed that the addition of AI-2 leads to a significant increase in biofilm formation, in contrast with previous studies which showed that AI-2 limits biofilm formation in Staphylococci. We found that AI-2 increases biofilm formation by enhancing the transcription of the ica operon, which is a known component in the AI-2-regulated biofilm pathway. In addition, we first observed that the transcript level of bhp, which encodes a biofilm-associated protein, was also increased following the addition of AI-2. Furthermore, we found that, among the known biofilm regulator genes (icaR, sigB, rbsU, sarA, sarX, sarZ, clpP, agrA, abfR, arlRS, saeRS ), only icaR can be regulated by AI-2, suggesting that AI-2 may regulate biofilm formation by an icaR-dependent mechanism in S. epidermidis RP62A. © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Keywords: Staphylococcus epidermidis; AI-2; Biofilm; ica; bhp

1. Introduction Staphylococcus epidermidis, a predominant inhabitant of the skin and mucous membranes, was once considered harmless to the human body. However, it is now known to be an opportunistic pathogen and the major cause of chronic biofilmassociated infections. It has been reported that nearly 80% of the bacteria involved in biomaterial-associated infections are S. epidermidis. Therefore, it is of great importance to investigate the pathogenesis of S. epidermidis, as the use of implanted medical devices such as central venous catheters (CVCs), urinary catheters, prosthetic heart valves, orthopaedic devices, and contact lenses is becoming more widespread [14,15,18,23]. The strong capacity to form a biofilm on medical devices is thought to be a leading cause of S. epidermidis infections * Corresponding author. Tel./fax: þ86 551 65787380. E-mail address: [email protected] (T. Xue).

[12,17]. Formation of a biofilm is one of the strategies of this bacterium that makes the cells insensitive to antibiotic treatment and helps them escape attacks from the human immune system, leading to persistent infection in the host. Scanning electron microscopy studies showed two steps involved in S. epidermidis colonisation on plastic materials: attachment to the material surface and then the formation of microcolonies and multilayered cell clusters surrounded by a slimy matrix. This slimy substance has been characterised as polysaccharide intercellular adhesin (PIA). It is responsible for cellecell adhesion and is regarded as a trademark of biofilm structure [13,22,24]. PIA is produced by the enzymes coded in an operon composed of four open reading frames (ORFs) icaA, icaD, icaB and icaC. A transcriptional regulator, IcaR, which gene is divergently transcribed from the ica operon, has been identified as the repressor of the ica operon [3,5e7,11,37]. Several other factors associated with biofilm formation have been identified so far, such as accumulation-associated protein

http://dx.doi.org/10.1016/j.micinf.2015.01.003 1286-4579/© 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved. Please cite this article in press as: Xue T, et al., Autoinducer-2 increases biofilm formation via an ica- and bhp-dependent manner in Staphylococcus epidermidis RP62A, Microbes and Infection (2015), http://dx.doi.org/10.1016/j.micinf.2015.01.003

2

T. Xue et al. / Microbes and Infection xx (2015) 1e8

(AAP), clumping factor A (ClfA), staphylococcal surface protein (SSP1), major autolysin (AtlE) and biofilm-associated protein (Bap) [4,21,22,27e30]. As group behaviour, biofilm formation is a quorum sensing (QS)-dependent process, which uses secreted small diffusible molecules called autoinducers to accomplish bacterial cell-tocell communication. The autoinducers used by bacteria are typically specific for a narrow range of organisms. Gramnegative bacteria generally use acylated homoserine lactones (AHLs), while Gram-positive bacteria use oligopeptides, which act through two-component phosphorylation cascades [33]. However, a type of unique autoinducer named autoinducer-2 (AI-2) has been proposed to be a universal language for interspecies communication since LuxS, which is the synthetic enzyme of AI-2, is widely conserved in both Gram-negative and Gram-positive bacteria. Most of the cases, AI-2 is synthesised by LuxS in a metabolic pathway known as the activated methyl cycle [31,36]. In this pathway, S-adenosylmethionine is metabolised to S-adenosylhomocysteine, which is subsequently converted to adenine, homocysteine, and 4,5-dihydroxy-2,3-pentanedione (DPD, the precursor of AI-2). DPD is a highly reactive product that can rearrange and self-cycle into diverse molecules, suggesting that distinct but related molecules derived from DPD may be the signals that different bacterial species recognise as AI-2 [36]. The LuxS/ AI-2 QS system was first identified in Vibrio harveyi, where it functions as part of a complex multilayered QS system to regulate bioluminescence and other virulence-associated traits. Subsequently, it was found to be involved in the regulation of a range of behaviours in diverse bacteria, such as biofilm formation in Escherichia coli, virulence-associated traits in Vibrio cholerae, antibiotic susceptibility in Streptococcus anginosus, and motility in enterohaemorrhagic E. coli [1,8,16]. Several previous studies have focused on the function of AI-2 in Staphylococci and have found that AI-2 can be produced by LuxS and might function as a signalling molecule regulating metabolism and virulence. Previous authors have found that deletion of AI-2 increased biofilm formation in both S. epidermidis and Staphylococcus aureus [24,39]. For example, a study described by Xu et al. showed that a luxS mutant strain of S. epidermidis exhibited increased biofilm formation in vitro [38]. The addition of AI-2-containing culture filtrate restored the wild-type phenotype, indicating that AI-2 repressed biofilm formation as signalling molecules in this strain [38]. While another study which investigated the transcriptional profiling influenced by complementation of exogenous AI-2 in a luxS mutant indicated that the transcript level of the ica operon did not change in response to AI-2 addition, thus, the authors hypothesised that expression of the ica genes is impacted by the metabolic function of LuxS rather than AI-2 control [9]. Therefore, the mechanism of how AI-2 affects biofilm formation in Staphylococci still remains further exploration. In this study, we investigated the function of AI-2, in particular its effect on biofilm formation in S. epidermidis RP62A, which has a strong biofilm-formation phenotype and

is considered a reference biofilm-positive strain in a number of reports [10,25,26,34,35]. Unlike the previous studies, we investigated the clear effect of AI-2 on biofilm formation in S. epidermidis RP62A by directly adding AI-2 in the wild type rather than in the luxS mutant. Interestingly, we found that addition of AI-2 increases biofilm formation in S. epidermidis RP62A, which is contrast with the negative effect of AI-2 concluding from the increased biofilm formation in the luxS mutant. While previous work only found that AI-2 regulates biofilms by decreasing the transcript level of the ica operon [38], our work showed that AI-2 regulates biofilm formation in S. epidermidis RP62A, not only via ica but also by increasing the transcript level of bhp, which encodes a Bap homolog protein. Additionally, we investigated how AI-2 regulates biofilm formation and found that it is through an icaRdependent pathway in S. epidermidis RP62A. 2. Materials and methods 2.1. Bacterial strain growth conditions S. epidermidis RP62A was grown in tryptic soy broth (TSB) (soybean-casein digest medium USP; Oxoid) medium. For

Table 1 Oligonucleotide primers used in this study. Primer name

Oligonucleotide (50 e30 )

rt-icaA-f rt-icaA-r rt-icaB-f rt-icaB-r rt-icaC-f rt-icaC-r rt-icaD-f rt-icaD-r rt-icaR-f rt-icaR-r rt-rbf-f rt-rbf-r rt-bhp-f rt-bhp-r rt-uraA-f rt-uraA-r rt-purA-f rt-purA-r rt-nirR-f rt-nirR -r rt-aap-f rt-aap-r rt-agrA-f rt-agrA-r rt-clpP-f rt-clpP-r rt-arlR-f rt-arlR-r rt-saeR-f rt-saeR-r rt-rsbU-f rt-rsbU-r rt-abfR-f rt-abfR-r

GAAAAACCCTTTAATCGATC ACTTCGAGGTCAACAAATTT TCTTTATTAGCGCATTGATG GCTTTAAGCCATTGAATTTG TTTACGTGCGTTTATTTGTG GCCGATTAAAAGATATGGAA ATGGTCAAGCCCAGACAGAG CAAACAAACTCATCCATCCG ACTTGGTCTTTAAAACGGTT CAAACACCATCTTCAAGAAA AAAGAATATACGGCAACACG TGATGCCATTGTCACTGATA CATCTTTTTTGCGTCGTTTA CAGCAACATTTGAACAACAA ATGTTTGAGCGTACCGTT GCCAATAAAGCTGCTGATAT AATAAATTCGTTTGTTCGCG ACTGAATACCCAGCAAACTT AACGCTTCAAGTCTTTCTCT CGAGTTAGTCATTGTCCCAT TACCTTTTTTACGACGACCA GCACCAGAACAACCAAATAG TTGAAGAAAAGCCAATGG TTACGAATTTCACTGGCTAA CTCAAGGACAAGCAACTG ATCACTTCATCAATTAAGC GACAACAACAATCTACAC TTCTTCAATATCAAACGGC ATCGTGGATGATGAACAA GTCGTAACCATTAACTTCTG GCACAACCTAATATGAATGG TAACAGAAGCGGCTACTA AAGACTTGAGCAATCTGG TGTGGTAAGCAACTTGAA

Please cite this article in press as: Xue T, et al., Autoinducer-2 increases biofilm formation via an ica- and bhp-dependent manner in Staphylococcus epidermidis RP62A, Microbes and Infection (2015), http://dx.doi.org/10.1016/j.micinf.2015.01.003

T. Xue et al. / Microbes and Infection xx (2015) 1e8

microarray experiments, overnight cultures of S. epidermidis were diluted 1:100 into 50 ml of TSB and incubated at 30  C with shaking at 180 rpm until they reached the midlogarithmic growth phase (OD600 ¼ 1.8). The media was solidified with 1.5% (wt/vol) agar if necessary. The AI-2 used in this experiment was DPD purchased from Omm Scientific Inc. 2.2. Total RNA isolation, cDNA generation, and microarray processing Overnight cultures of S. epidermidis RP62A were diluted 1:100 in LB medium and grown to the late exponential phase (OD600 ¼ 2.1). Cells were collected and resuspended in TE (Tris-EDTA) buffer (pH 8.0) containing 10 g per litre of lysozyme and 40 mg per litre of lysostaphin. After incubation at 37  C for 5 min, S. epidermidis cells were prepared for total RNA extraction using the Trizol method (Invitrogen), and residual DNA was removed with DNase (RNase free; TaKaRa). The microarray processing and data analysis were conducted by the Biochip Company of Shanghai, China. The array design was based on the RP62A genome sequence. Real-time reverse transcription-PCR (RT-PCR) was performed with a PrimeScript 1st Strand cDNA synthesis kit and SYBR Premix Ex Taq (TaKaRa) using a StepOne real-time PCR system (Applied Biosystems). The quantity of cDNA measured by real-time PCR was normalised to the abundance of 16S cDNA [2]. All of the real-time RT-PCR assays were repeated at least three times with similar results. All quantitative data were analysed using Student's t tests. P < 0.01 was considered to be statistically significant. The primers used in this study were listed in Table 1.

3

2.3. Biofilm assays The method for biofilm quantification was performed as described previously and modified as follows [13,25,39]. S. epidermidis strains were grown in TSB for 16 h and diluted 1:100 into fresh TSB. The diluted cultures were transferred into sterile 96-well flat-bottomed tissue culture plates and incubated at 37  C for 24 h. The adherent bacteria were stained with crystal violet, and the excess stain was washed off gently with slowly running water. The biomass of the biofilm was determined using a MicroELISA auto-reader (Bio-Rad Co.) at a wavelength of 490 nm under single-wavelength mode [20,40]. Laser scanning confocal microscopy (CLSM) was performed on a Zeiss LSM710 system (Carl Zeiss, Jena, Germany) with a 20  0.8 n.a. apochromatic objective. The strains were stained with Acridine Orange for fluorescence detection. The laser wavelength used for the CLSM was 488 nm. Z-stacks were collected at 1 mm intervals. Confocal parameters for WT biofilm detection were taken as standard settings. Each confocal experiment was repeated four times. The three-dimensional biofilm images were rendered with Imaris 7.0 (Bitplane, Zurich, Switzerland). 3. Results 3.1. AI-2 increases biofilm formation in S. epidermidis RP62A Biofilm assays in 96-well plates were performed in order to investigate the effect of AI-2 on biofilm formation. As shown in Fig. 1A, the chemically-synthesised pre-AI-2 molecule

Fig. 1. Biofilm formation under static conditions and chemical complementation by DPD at different concentrations. Biofilm growth of S. epidermidis RP62A (WT) and the WT complemented with chemically-synthesised DPD at different concentrations in 24-well plates for 12 h under aerobic conditions (0, 5 mM, 10 mM, 20 mM, 40 mM). A&B. The cells that adhered to the plate after staining with crystal violet were measured by OD490 (**P < 0.01). C. Biofilm integrity and fluorescence were monitored by CLSM. D. Growth curves of S. epidermidis RP62A (WT) and the WT complemented with chemically-synthesised DPD at different concentrations. Error bars indicate standard deviations. The results represent a mean of three independent experiments. Please cite this article in press as: Xue T, et al., Autoinducer-2 increases biofilm formation via an ica- and bhp-dependent manner in Staphylococcus epidermidis RP62A, Microbes and Infection (2015), http://dx.doi.org/10.1016/j.micinf.2015.01.003

4

T. Xue et al. / Microbes and Infection xx (2015) 1e8

DPD at concentrations of 0 mM, 5 mM, 10 mM, 20 mM, and 40 mM was added to different wells containing S. epidermidis RP62A; we observed that the intensity of the staining biofilm increased as the concentration of AI-2 increased. Additionally, the absorbance of the biofilm at a wavelength of 490 nm was tested, and these results also confirmed our observation and showed that exogenous AI-2 increases biofilm formation in S. epidermidis RP62A (Fig. 1B). We also tested the biofilm by laser scanning confocal microscope assays, generating results that were consistent with those of the previous 96-well plate assays (Fig. 1C). To exclude the effect of AI-2 on the metabolism and growth of this bacterium in light of the high concentration of AI-2 we used in the experiments, the growth rates of the bacteria with the addition of exogenous AI-2 at different concentrations were assessed. The results showed that the AI-2 has no influence on the growth of S. epidermidis

RP62A (Fig. 1D), indicating that AI-2 might modulate biofilm formation in a signalling manner. 3.2. Effect of AI-2 on S. epidermidis gene transcription To characterise the gene transcriptional profiling influenced by AI-2, microarray assays were performed using the wild type strain RP62A and the wild type strain with exogenous AI2. AI-2 was added to a final concentration of 20 mM. A twofold induction ratio was used as a cut-off limit to compare the transcriptional profiling in the wild type and the wild type with AI-2. The microarray data indicated that 27 genes were induced and 15 genes were repressed in the wild type strain treated with AI-2. Most of the genes regulated by AI-2 were involved in metabolism, signal transduction, and virulence of S. epidermidis (Table 2). As expected, the transcript levels of a

Table 2 Main genes affected by AI-2 in S. epidermidis rp62A. Gene ID

Gene product

Change fold treated/untreated

SERP0202 SERP0037 SERP0320 SERP0458 SERP0649 SERP0765 SERP1250 SERP1321 SERP1339 SERP1897 SERP1992 SERP2177 SERP2283 SERP2522 SERP2536 SERP0034 SERP0005 SERP0095 SERP0332 SERP0402 SERP0868 SERP1079 SERP1502 SERP1535 SERP1791 SERP2004 SERP2005 SERP2018 SERP2138 SERP2185 SERP2190 SERP2191 SERP2187 SERP2186 SERP2257 SERP2295 SERP2294 SERP2296 SERP2344 SERP2343 SERP2346 SERP2392

Deoxynucleoside kinase family protein Trans-sulfuration enzyme family protein Transcriptional regulator, Rbf homolog Sodium transport family protein Phosphoribosylaminoimidazole carboxylase, catalytic subunit, PurE Uracil permease, UraA Glyceraldehyde 3-phosphate dehydrogenase, GapB Hypothetical protein Putative fluoride ion transporter, CrcB2 Hypothetical protein Transcriptional regulator, NirR Betaine aldehyde dehydrogenase, BetB Phosphonate ABC transporter, permease protein, MaoC domain protein Adenylosuccinate synthetase, PurA 5-methyltetrahydropteroyltriglutamate-homocysteine methyltransferase, MetE Glucose-inhibited division protein B, RsmG Trans-sulfuration enzyme family protein Lipoprotein, putative Iron compound ABC transporter, ATP-binding protein Aerobic glycerol-3-phosphate dehydrogenase, GlpD 2-oxoisovalerate dehydrogenase, E3 component, lipoamide dehydrogenase, LpdA DNA-binding protein, putative Hypothetical protein PTS system, lactose-specific IIA component, LacF Amino acid ABC transporter, permease protein Amino acid ABC transporter, amino acid-binding protein Hypothetical protein Probable transglycosylase, IsaA Adenylylsulfate kinase, CysC Sulfite reductase (NADPH) hemoprotein beta-component, CysI Sulfite reductase (NADPH) flavoprotein alpha-component, CysJ Hypothetical protein Sulphate adenylyltransferase, Sat Acetoin reductase Intercellular adhesion protein B, IcaB Intercellular adhesion protein D, IcaD Intercellular adhesion protein C, IcaC DAK2 domain protein Hypothetical protein Glycerol dehydrogenase, GldA Cell wall associated biofilm protein, Bap-homolog protein, Bhp

0.434594 0.411862 0.431965 0.430663 0.247647 0.426439 0.499002 0.361795 0.456204 0.491642 0.346021 0.484262 0.432152 0.469043 0.378931 2.597403 2.570694 2.849003 2.155172 2.298851 2.040816 2.057613 2.202643 2.150538 2.227171 2.087683 3.30033 2.631579 2.45098 2.398082 2.012072 2.409639 2.247191 7.633588 2.785515 2.832861 2.079002 2.087683 2.188184 3.571429 2.298851 2.638522

Please cite this article in press as: Xue T, et al., Autoinducer-2 increases biofilm formation via an ica- and bhp-dependent manner in Staphylococcus epidermidis RP62A, Microbes and Infection (2015), http://dx.doi.org/10.1016/j.micinf.2015.01.003

T. Xue et al. / Microbes and Infection xx (2015) 1e8

5

range of biofilm formation-associated genes were changed, such as icaADBC, which is responsible for the production of PIA. Moreover, the transcript levels of the ica regulator gene, icaR, also changed with the addition of AI-2. It is interesting that we first observed that the transcript level of bhp was also increased with the addition of AI-2. However, the transcript level of the agr operon and the sar operon, which are wellknown biofilm-regulating genes in S. epidermidis, did not change, indicating that AI-2 regulates biofilm formation via an Agr or Sar-independent pathway. Furthermore, the transcript levels of a set of selected genes were verified using real-time RT-PCR measurements. Fig. 2 shows that there was a positive correlation between the two techniques. 3.3. AI-2 regulates biofilm formation by regulating the ica operon and bhp Real-time RT-PCR experiments were performed to test the transcript levels of genes that are most likely to be associated with biofilm formation in the wild type strain and wild type treated with 20 mM AI-2. The ica operon and bhp, which were found to be potentially affected by AI-2 according to our microarray results, were first examined. The results confirmed that the transcript levels of icaA, icaB, icaC, icaD and bhp were all increased with the addition of AI-2 (Fig. 3A). Additionally, according to previous studies, there are several other genes that encode proteins associated with the biofilm formation process, such as aap, clfA, ssp1, atlE, and esp; therefore, we performed real-time RT-PCR experiments to test the transcript levels of these genes. As shown in Fig. 3A, the transcription of aap, clfA, ssp1, atlE and esp appeared not to change in the wild type with the addition of AI-2 compared

Fig. 2. Correlation of microarray and real-time RT-PCR results (microarray vs. real-time RT-PCR). The differences in the transcription of seven genes were log2 transformed and plotted against each other. The diagonal line in this figure indicates that the ratio obtained using the microarray is similar to that from the real-time RT-PCR. The abscissa of points in this figure represents log2 ratio of WT plus AI-2/WT according to the real-time RT-PCR data, and the vertical coordinate represents log2 ratio of WT plus AI-2/WT according to the microarray data. The two methods are better correlated if the points are closer to the diagonal line.

Fig. 3. Comparative measurement of transcription of the biofilm-associated genes and their regulators. Relative transcript levels of ica, bap, aap, esp clfA, ssp1, atlE (A) and the regulatory elements known to modulate biofilm such as icaR, sigB, rbsU, sarA, sarX, sarZ, clpP, agrA, abfR, arlRS, and saeRS (B), were determined by real-time RT-PCR in S. epidermidis RP62A (WT) and the WT complemented with 20 mM chemically-synthesised DPD. Error bars indicate standard deviations. The results represent a mean of three independent experiments. The transcript level of each gene (icaA, icaD, icaB, icaC, bhp and icaR) in the wild type with 20 mM AI-2 was compared with that in the wild type without AI-2 addition (**P < 0.01).

with the wild type strain, suggesting that AI-2 regulates biofilm formation mainly by regulating the ica operon and bhp. Furthermore, the transcript levels of some regulator genes that have been identified as involved in biofilm formation were detected. Due to changes in the transcription of icaABCD, the transcript level of icaR was first tested. As expected, icaR transcript level was regulated by exogenous AI-2, indicating that AI-2 regulates the ica operon through icaR. To identify the intermediates of the AI-2-regulating icaR and bhp pathway, the transcript levels of known biofilm regulator genes (sigB, rbsU, sarA, sarX, sarZ, clpP, agrA, abfR, arlRS, saeRS ) were also tested; however, none of these were affected by the addition of exogenous AI-2, suggesting that AI-2 may regulate biofilm formation in an icaR-dependent mechanism in S. epidermidis RP62A. 3.4. AI-2 regulates biofilm formation in different stages of biofilm formation Previous studies have shown that there are several stages of biofilm formation on plastic materials: first, attachment to a plastic surface, and second, intercellular adhesion among cells,

Please cite this article in press as: Xue T, et al., Autoinducer-2 increases biofilm formation via an ica- and bhp-dependent manner in Staphylococcus epidermidis RP62A, Microbes and Infection (2015), http://dx.doi.org/10.1016/j.micinf.2015.01.003

6

T. Xue et al. / Microbes and Infection xx (2015) 1e8

followed by transition into the stationary phase [37]. To determine at which stage the effect of AI-2 regulation was most significant, we harvested the bacterial suspensions after different culture times in 96-well plates and tested the transcript levels of icaA, icaR and bhp in wild type strains and in wild type treated with exogenous AI-2. The results showed that the changes were apparent after 8 h and 12 h of culture (Fig. 4), suggesting that the regulation effect of AI-2 on biofilm formation mostly occurs in the stage of intercellular adhesion. 4. Discussion As biofilm formation is thought to be the leading cause of persistent infection caused by S. epidermidis, extracellular antigenic markers of Staphylococci related to biofilm production have been intensively investigated in the past decades. S. epidermidis RP62A (ATCC 35984), which is considered a reference biofilm-positive strain, has been previously used as a preferential model strain for such studies by a number of authors [3,19,21,25]. However, little is known about the regulators associated with biofilm formation in this strain. In this study, we focused on investigating the influence of AI-2 on biofilm formation and its mechanism of action. Understanding

these processes provides new clues for the therapeutic treatment of infections caused by this species of bacteria. Previous studies have found that the LuxS/AI-2 QS system affects biofilm development in Staphylococci, and the results of these studies revealed that AI-2 limits biofilm formation [38,39]. In contrast, here we observed that the addition of exogenous AI-2 significantly enhanced biofilm formation in S. epidermidis RP62A. However, it has to be pointed out that our study has been performed on the different genetic backgrounds with that of the previous work. All the previous studies found that deletion of luxS increased biofilm formation, and addition of AI-2 restored the parental phenotype, thus revealing the negative effect of AI-2 on biofilm formation; while our study examined the effect of AI-2 on biofilm formation in wild type strain. Moreover, aside from S. epidermidis RP62A, we detected the effect of AI-2 on biofilm formation in other wild type strains, including (S. epidermidis CSF41498 and three clinical S. epidermidis strains which we have isolated before). However, there was no apparent change in biofilm formation in response to AI-2 addition (data not shown). This indicated that in different strains, the mechanism by which AI-2 regulates biofilm-associated behaviours may be different. In addition, due to the methodology limitation, the physiological concentration of AI-2 in different bacteria strains can

Fig. 4. Comparative measurement of transcription of the biofilm-associated genes (icaA, icaR, and bhp) in different stages of biofilm formation. A. 4 h; B. 8 h; C. 12 h; D. 16 h. Error bars indicate standard deviations. The results represent a mean of three independent experiments. The transcript level of each gene (icaA, icaR, and bhp) in the wild type with different concentrations of AI-2 (5 mM, 10 mM, 20 mM, 40 mM) was compared respectively with that in the wild type without AI-2 addition (**P < 0.01). Please cite this article in press as: Xue T, et al., Autoinducer-2 increases biofilm formation via an ica- and bhp-dependent manner in Staphylococcus epidermidis RP62A, Microbes and Infection (2015), http://dx.doi.org/10.1016/j.micinf.2015.01.003

T. Xue et al. / Microbes and Infection xx (2015) 1e8

not be precisely measured. In the previous work, Yu et al. found that, in S. aureus NCTC8325, nanoM concentration of AI-2 could complement biofilm differences in the luxS mutant, while microM concentration had no effect [39]. In contrast, in our work, microM concentration of AI-2 increased the biofilm formation in S. epidermidis RP62A, while nanoM concentration had no effect. This indicated that in different strains, the physiological concentration of AI-2 may be different. The Bhp protein in S. epidermidis RP62A is a homologue of biofilm-associated protein (Bap) found in S. aureus. The gene encoding bap was first discovered in a transposon-insertion mutant in S. aureus, which showed a significant decrease in attachment to inert surfaces, intercellular adhesion and biofilm formation. Interestingly, all staphylococcal isolates harbouring bap are highly adherent and strong biofilm producers [4,29]. Subsequently, a gene encoding the Bap-homologous protein Bhp was found in the genome of S epidermidis RP62A [32]. Bhp has a predicted molecular mass of 258 kDa and has been shown to contribute to S. epidermidis biofilm formation [29]. Our work is the first to observe that AI-2 affects biofilm formation by regulating the transcription of bhp. The transcript level of bhp increased 4-fold after the addition of AI-2, indicating that AI-2enhanced biofilm formation is related to the significant increase in the Bhp protein in this strain. In a QS process, bacteria secrete small, diffusible signalling molecules that accumulate in the external environment. When the concentration of the autoinducers reaches a threshold, an alteration of gene expression is induced, allowing the bacteria to adopt behaviours that are only productive when the bacteria are working together as a group. In this study, we investigated at which stage the effect of AI-2 on biofilm formation was most significant. Our results showed that in the stage of cellto-cell adhesion, the change in the transcript levels of the biofilm-associated genes was most apparent. This indicated that AI-2 functions during the stage of intercellular adhesion, confirming the role of AI-2 as a cell-to-cell communicator in the process of developing biofilm-associated behaviours. Conflict of interest statement The authors have declared that no competing interests exist. Acknowledgements This work was supported by the Talent Project of Anhui Agricultural University (YJ2013-6 and XKTS2013-6) and the Project of Anhui Province Key Discipline of Biology (2014TSTD003). References [1] Ahmed NA, Petersen FC, Scheie AA. AI-2 quorum sensing affects antibiotic susceptibility in Streptococcus anginosus. J Antimicrob Chemother 2007;60:49e53. [2] Chen YW, Zhao P, Borup R, Hoffman EP. Expression profiling in the muscular dystrophies: identification of novel aspects of molecular pathophysiology. J Cell Biol 2000;151:1321e36.

7

[3] Conlon KM, Humphreys H, O'Gara JP. icaR encodes a transcriptional repressor involved in environmental regulation of ica operon expression and biofilm formation in Staphylococcus epidermidis. J Bacteriol 2002;184:4400e8. [4] Cucarella C, Solano C, Valle J, Amorena B, Lasa I, Penades JR. Bap, a Staphylococcus aureus surface protein involved in biofilm formation. J Bacteriol 2001;183:2888e96. [5] Dobinsky S, Bartscht K, Mack D. Influence of Tn917 insertion on transcription of the icaADBC operon in six biofilm-negative transposon mutants of Staphylococcus epidermidis. Plasmid 2002;47:10e7. [6] Dobinsky S, Kiel K, Rohde H, Bartscht K, Knobloch JK, Horstkotte MA, et al. Glucose-related dissociation between icaADBC transcription and biofilm expression by Staphylococcus epidermidis: evidence for an additional factor required for polysaccharide intercellular adhesin synthesis. J Bacteriol 2003;185:2879e86. [7] Hou Z, Da F, Liu B, Xue X, Xu X, Zhou Y, et al. R-thanatin inhibits growth and biofilm formation of methicillin-resistant Staphylococcus epidermidis in vivo and in vitro. Antimicrob Agents Chemother 2013; 57:5045e52. [8] Li J, Attila C, Wang L, Wood TK, Valdes JJ, Bentley WE. Quorum sensing in Escherichia coli is signaled by AI-2/LsrR: effects on small RNA and biofilm architecture. J Bacteriol 2007;189:6011e20. [9] Li M, Villaruz AE, Vadyvaloo V, Sturdevant DE, Otto M. AI-2dependent gene regulation in Staphylococcus epidermidis. BMC Microbiol 2008;8:4. [10] Linton CJ, Sherriff A, Millar MR. Use of a modified Robbins device to directly compare the adhesion of Staphylococcus epidermidis RP62A to surfaces. J Appl Microbiol 1999;86:194e202. [11] Liu X, Sun X, Wu Y, Xie C, Zhang W, Wang D, et al. Oxidation-sensing regulator AbfR regulates oxidative stress responses, bacterial aggregation, and biofilm formation in Staphylococcus epidermidis. J Biol Chem 2013;288:3739e52. [12] Mack D, Becker P, Chatterjee I, Dobinsky S, Knobloch JK, Peters G, et al. Mechanisms of biofilm formation in Staphylococcus epidermidis and Staphylococcus aureus: functional molecules, regulatory circuits, and adaptive responses. Int J Med Microbiol 2004;294:203e12. [13] Mack D, Rohde H, Dobinsky S, Riedewald J, Nedelmann M, Knobloch JK, et al. Identification of three essential regulatory gene loci governing expression of Staphylococcus epidermidis polysaccharide intercellular adhesin and biofilm formation. Infect Immun 2000;68:3799e807. [14] Martin LF, Harris JM, Fehr DM, Peter AO, Appelbaum PC, Spangler SK, et al. Vascular prosthetic infection with Staphylococcus epidermidis: experimental study of pathogenesis and therapy. J Vasc Surg 1989; 9:464e71. [15] McCann MT, Gilmore BF, Gorman SP. Staphylococcus epidermidis device-related infections: pathogenesis and clinical management. J Pharm Pharmacol 2008;60:1551e71. [16] Miller MB, Skorupski K, Lenz DH, Taylor RK, Bassler BL. Parallel quorum sensing systems converge to regulate virulence in Vibrio cholerae. Cell 2002;110:303e14. [17] O'Gara JP. ica and beyond: biofilm mechanisms and regulation in Staphylococcus epidermidis and Staphylococcus aureus. FEMS Microbiol Lett 2007;270:179e88. [18] Otto M. Staphylococcus epidermidis pathogenesis. Methods Mol Biol 2014;1106:17e31. [19] Polonio RE, Mermel LA, Paquette GE, Sperry JF. Eradication of biofilmforming Staphylococcus epidermidis (RP62A) by a combination of sodium salicylate and vancomycin. Antimicrob Agents Chemother 2001;45:3262e6. [20] Pozzi C, Waters EM, Rudkin JK, Schaeffer CR, Lohan AJ, Tong P, et al. Methicillin resistance alters the biofilm phenotype and attenuates virulence in Staphylococcus aureus device-associated infections. PLoS Pathog 2012;8:e1002626. [21] Reiter KC, Sant'anna FH, d'Azevedo PA. Upregulation of icaA, atlE and aap genes by linezolid but not vancomycin in Staphylococcus epidermidis RP62A biofilms. Int J Antimicrob Agents 2014;43(3):248e53. [22] Rohde H, Burdelski C, Bartscht K, Hussain M, Buck F, Horstkotte MA, et al. Induction of Staphylococcus epidermidis biofilm formation via

Please cite this article in press as: Xue T, et al., Autoinducer-2 increases biofilm formation via an ica- and bhp-dependent manner in Staphylococcus epidermidis RP62A, Microbes and Infection (2015), http://dx.doi.org/10.1016/j.micinf.2015.01.003

8

[23]

[24]

[25]

[26]

[27]

[28]

[29]

[30]

T. Xue et al. / Microbes and Infection xx (2015) 1e8 proteolytic processing of the accumulation-associated protein by staphylococcal and host proteases. Mol Microbiol 2005;55:1883e95. Rohde H, Frankenberger S, Zahringer U, Mack D. Structure, function and contribution of polysaccharide intercellular adhesin (PIA) to Staphylococcus epidermidis biofilm formation and pathogenesis of biomaterial-associated infections. Eur J Cell Biol 2010;89:103e11. Rohde H, Knobloch JK, Horstkotte MA, Mack D. Correlation of biofilm expression types of Staphylococcus epidermidis with polysaccharide intercellular adhesin synthesis: evidence for involvement of icaADBC genotype-independent factors. Med Microbiol Immunol 2001; 190:105e12. Sadovskaya I, Vinogradov E, Flahaut S, Kogan G, Jabbouri S. Extracellular carbohydrate-containing polymers of a model biofilm-producing strain, Staphylococcus epidermidis RP62A. Infect Immun 2005;73:3007e17. Sadovskaya I, Vinogradov E, Li J, Jabbouri S. Structural elucidation of the extracellular and cell-wall teichoic acids of Staphylococcus epidermidis RP62A, a reference biofilm-positive strain. Carbohydr Res 2004;339:1467e73. Sivadon V, Rottman M, Quincampoix JC, Prunier E, de Mazancourt P, Bernard L, et al. Polymorphism of the cell wall-anchoring domain of the autolysin-adhesin AtlE and its relationship to sequence type, as revealed by multilocus sequence typing of invasive and commensal Staphylococcus epidermidis strains. J Clin Microbiol 2006;44:1839e43. Sun D, Accavitti MA, Bryers JD. Inhibition of biofilm formation by monoclonal antibodies against Staphylococcus epidermidis RP62A accumulation-associated protein. Clin Diagn Lab Immunol 2005; 12:93e100. Tormo MA, Knecht E, Gotz F, Lasa I, Penades JR. Bap-dependent biofilm formation by pathogenic species of Staphylococcus: evidence of horizontal gene transfer? Microbiology 2005;151:2465e75. Vandecasteele SJ, Peetermans WE, Merckx RR, Rijnders BJA, Van Eldere J. Reliability of the ica, aap and atlE genes in the discrimination between invasive, colonizing and contaminant Staphylococcus

[31]

[32] [33]

[34]

[35]

[36]

[37]

[38]

[39]

[40]

epidermidis isolates in the diagnosis of catheter-related infections. Clin Microbiol Infect 2003;9:114e9. Vendeville A, Winzer K, Heurlier K, Tang CM, Hardie KR. Making 'sense' of metabolism: autoinducer-2, LuxS and pathogenic bacteria. Nat Rev Microbiol 2005;3:383e96. von Eiff C, Peters G, Heilmann C. Pathogenesis of infections due to coagulase-negative staphylococci. Lancet Infect Dis 2002;2:677e85. Vuong C, Gerke C, Somerville GA, Fischer ER, Otto M. Quorumsensing control of biofilm factors in Staphylococcus epidermidis. J Infect Dis 2003;188:706e18. Wang IW, Anderson JM, Jacobs MR, Marchant RE. Adhesion of Staphylococcus epidermidis to biomedical polymers: contributions of surface thermodynamics and hemodynamic shear conditions. J Biomed Mater Res 1995;29:485e93. Wang IW, Anderson JM, Marchant RE. Platelet-mediated adhesion of Staphylococcus epidermidis to hydrophobic NHLBI reference polyethylene. J Biomed Mater Res 1993;27:1119e28. Winzer K, Hardie KR, Burgess N, Doherty N, Kirke D, Holden MT, et al. LuxS: its role in central metabolism and the in vitro synthesis of 4hydroxy-5-methyl-3(2H)-furanone. Microbiology 2002;148:909e22. Wu Y, Wang J, Xu T, Liu J, Yu W, Lou Q, et al. The two-component signal transduction system ArlRS regulates Staphylococcus epidermidis biofilm formation in an ica-dependent manner. PLoS One 2012; 7:e40041. Xu L, Li H, Vuong C, Vadyvaloo V, Wang J, Yao Y, et al. Role of the luxS quorum-sensing system in biofilm formation and virulence of Staphylococcus epidermidis. Infect Immun 2006;74:488e96. Yu D, Zhao L, Xue T, Sun B. Staphylococcus aureus autoinducer-2 quorum sensing decreases biofilm formation in an icaR-dependent manner. BMC Microbiol 2012;12:288. Ziebuhr W, Heilmann C, G€otz F, Meyer P, Wilms K, Straube E, et al. Detection of the intercellular adhesion gene cluster (ica) and phase variation in Staphylococcus epidermidis blood culture strains and mucosal isolates. Infect Immun 1997;65:890e6.

Please cite this article in press as: Xue T, et al., Autoinducer-2 increases biofilm formation via an ica- and bhp-dependent manner in Staphylococcus epidermidis RP62A, Microbes and Infection (2015), http://dx.doi.org/10.1016/j.micinf.2015.01.003