AUTOPHAGY 2016, VOL. 12, NO. 2, 297–311 http://dx.doi.org/10.1080/15548627.2015.1124224
BASIC RESEARCH PAPER
Autophagy is essential for ultrafine particle-induced inflammation and mucus hyperproduction in airway epithelium Zhi-Hua Chena,#, Yin-Fang Wua,#, Ping-Li Wanga, Yan-Ping Wua, Zhou-Yang Lia, Yun Zhaoa, Jie-Sen Zhoua, Chen Zhua, Chao Caoa, Yuan-Yuan Maoa, Feng Xua, Bei-Bei Wangb, Stephania A. Cormierc, Song-Min Yinga, Wen Lia, and Hua-Hao Shena,d a Department of Respiratory and Critical Care Medicine, Second Affiliated Hospital; Zhejiang University School of Medicine, Hangzhou, Zhejiang; bCore Facilities, Zhejiang University School of Medicine, Hangzhou, Zhejiang; cDepartment of Pediatrics, University of Tennessee Health Science Center, Children’s Foundation Research Institute, Memphis, TN, USA; dState Key Lab of Respiratory Disease, National Clinical Research Center for Respiratory Disease, Guangzhou, China
ABSTRACT
ARTICLE HISTORY
Environmental ultrafine particulate matter (PM) is capable of inducing airway injury, while the detailed molecular mechanisms remain largely unclear. Here, we demonstrate pivotal roles of autophagy in regulation of inflammation and mucus hyperproduction induced by PM containing environmentally persistent free radicals in human bronchial epithelial (HBE) cells and in mouse airways. PM was endocytosed by HBE cells and simultaneously triggered autophagosomes, which then engulfed the invading particles to form amphisomes and subsequent autolysosomes. Genetic blockage of autophagy markedly reduced PM-induced expression of inflammatory cytokines, e.g. IL8 and IL6, and MUC5AC in HBE cells. Mice with impaired autophagy due to knockdown of autophagy-related gene Becn1 or Lc3b displayed significantly reduced airway inflammation and mucus hyperproduction in response to PM exposure in vivo. Interference of the autophagic flux by lysosomal inhibition resulted in accumulated autophagosomes/amphisomes, and intriguingly, this process significantly aggravated the IL8 production through NFKB1, and markedly attenuated MUC5AC expression via activator protein 1. These data indicate that autophagy is required for PM-induced airway epithelial injury, and that inhibition of autophagy exerts therapeutic benefits for PM-induced airway inflammation and mucus hyperproduction, although they are differentially orchestrated by the autophagic flux.
Received 30 March 2015 Revised 5 November 2015 Accepted 18 November 2015
Introduction Ambient air pollution, specifically environmental particulate matter (PM), causes a variety of adverse health effects. The lung is the major target of airborne pollutants. Accumulating evidence suggests that exposure to environmental PM pollution is associated with decreased lung function and increased exacerbation, hospitalization, disease incidence, and/or mortality of certain chronic respiratory diseases such as asthma, chronic obstructive pulmonary disease (COPD), and lung cancer.1-4 However, the molecular mechanisms mediating the adverse effects of PM in these diseases remain largely unknown. Autophagy is a dynamic process responsible for the turnover of cellular organelles and long-lived proteins, which plays a crucial role in cellular homeostasis and adaptation to adverse environments.5,6 More than 30 autophagy-related (ATG) genes and gene products have been identified heretofore, and the most investigated molecules include ATG5, BECN1/Beclin 1, and MAP1LC3B/LC3B (microtubule-associated protein 1 light chain 3 b).7 In mammals, the conversion of LC3B from the free form (LC3B-I) to the phosphatidylethanolamine-conjugated
airway inflammation; autophagy; endocytosis; mucus hyperproduction; ultrafine particulate matter
form (LC3B-II) represents a key step in autophagosome formation, and thus the net amount of LC3B-II is a critical hallmark for monitoring autophagy in mammalian cells.8 In general, the fusion of autophagosomes with lysosomes forms autolysosomes, a process that is part of complete autophagic flux, resulting in the breakdown and efflux of sequestered materials. In the case of endocytosis, the endosomes fuse with autophagosomes to form amphisomes, and the further fusion of amphisomes with lysosomes generates autolysosomes.9,10 Accumulating evidence suggests that autophagy plays important roles in pulmonary diseases.11,12 We have previously demonstrated that autophagy is critical in mediating the cigarette smoke-induced apoptosis of lung epithelial cells and contributes to the development of emphysema.13-15 Autophagy has also been recently shown to mediate cigarette smoke-induced cilia shortening in the airway epithelium.16,17 These data suggest that autophagy is a deleterious process orchestrating various damage processes in airway epithelium during COPD development. Emerging studies also suggest that autophagyrelated pathways are critically involved in nanomaterial
CONTACT Hua-Hao Shen [email protected]; Wen Li [email protected] 88 Jiefang Rd, Hangzhou, 310009, China Color versions of one or more of the figures in this article can be found online at www.tandfonline.com/kaup. # These authors contributed equally to this article. Supplemental data for this article can be accessed on the publisher’s website. © 2016 Taylor & Francis Group, LLC
KEYWORDS
298
Z. H. CHEN ET AL.
toxicity,18-20 and most recently, airborne PM2.5 has been reported to induce autophagy in human lung A549 cells.21,22 However, several critical items remain unclear regarding PM and autophagy in the context of airway injury. Can PM, especially the ultrafine PM, be endocytosed into the airway epithelial cells? Can the endocytosed PM be engulfed by autophagosomes? What are the eventual functions of autophagy in PM-induced damage in bronchial epithelial cells and in vivo? Is PM-induced autophagy deleterious as in case of cigarette smoke-induced airway injury? What are the molecular mechanisms mediating the effects of autophagy in PM-induced cellular injury? The present study addresses these questions using both pharmacological and genetic approaches in vitro and in vivo. Our results demonstrate that ultrafine PM triggers a typical convergence of endocytosis and autophagy in airway epithelial cells, and that autophagy is essential for the subsequent PMinduced inflammation and mucus hyperproduction. We also demonstrate that the lysosomal process differentially regulates the expressions of inflammatory cytokine IL (interleukin) 8 and mucin MUC5AC (mucin 5AC, oligomeric mucus/gelforming), distinctly through NFKB1 (nuclear factor of kappa light polypeptide gene enhancer in B-cells 1) and activator protein-1 (AP-1).
Results Ultrafine PM triggers a typical convergence of endocytosis and autophagy in human bronchial epithelial (HBE) cells Ultrafine PM containing environmentally persistent free radicals were fabricated and characterized previously.23-25 The total radical concentration was 2.5 mM/g PM, and mean diameter was around 0.2 mm. Treatment of HBE cells with this PM triggered typical features of a convergence of endocytosis and autophagy9,10 (Fig. 1A to C). By transmission electronic microscopy (TEM), we observed that endocytosis occurred in the plasma membrane upon PM exposure, with a phagophore emerging close to the endocytosis site (Fig. 1A). Autophagosomes then attempted to fuse with endocytosed PM (Fig. 1B), to form amphisomes and subsequent autolysosomes (Fig. 1C). The sizes of autophagy-captured particles were generally from 0.1 to 0.5 mm (Fig. 1B to D). PM induced a marked elevation of autophagy in HBE cells, as revealed through quantification of the TEM images and the punctation of mRFP-GFP-LC3B (Fig. 1D to F). Western blotting analysis also demonstrated a time- and dose-dependent induction of LC3B-II by PM in HBE cells (Figs. 1G and H). Treatment of PM with a lysosome inhibitor bafilomycin A1 (Baf A1) further enhanced the induction of LC3B-II (Fig. 1I), suggesting that the increased levels of LC3BII by PM treatment were indeed induced, rather than due to an impaired autophagosome-lysosome fusion. Autophagy is required for PM-induced expression of inflammatory cytokines and mucin MUC5AC levels in HBE cells The induced autophagy can be either cytoprotective or deleterious. Therefore, we sought to explore the functions of autophagy
in PM-induced cellular injury. PM exposure induced a marked elevation of the mRNA transcripts as well as the secreted protein levels of inflammatory cytokines IL8 and IL6 in HBE cells, and all of these were significantly decreased in the cells treated with siRNAs targeting autophagy-related genes BECN1 or ATG5 (Fig. 2A to D). However, other inflammatory cytokines, such as those encoded by IL1A, IL1B, IL18, and TNF (tumor necrosis factor), were not or were less significantly induced (Fig. S1). This suggests a deleterious effect of autophagy in mediating PM-induced inflammation in airway epithelial cells. The knockdown effects of all siRNAs used in this study are shown in Figure S2. Mucus hyperproduction by airway epithelial cells is another cardinal feature of chronic airway diseases, which results in airway obstruction and contributes significantly to morbidity and mortality.26,27 However, little is known about the role of PM in mucus production. Among the over 20 mucin genes identified, MUC5AC is one of the most predominant mucins in the airway, and is highly inducible especially in pathological conditions.28 Interestingly, we observed that PM triggered a significant induction of MUC5AC at both mRNA transcripts and protein levels in HBE cells (Fig. 2E and F). Similar to the cytokines, elevated MUC5AC was also effectively attenuated by knockdown of BECN1 or ATG5 (Fig. 2E to G), indicating an essential role of autophagy in PM-induced mucin production in airway epithelial cells. PM-induced airway inflammation is reduced in Becn1C/¡ or lc3b¡/¡ mice To further examine the role of autophagy in regulation of airway inflammation in vivo, Becn1C/¡ and lc3b¡/¡ mice, which exhibit impaired autophagy in lungs and other organs,15-16,29-31 were used in this study. Instillation of PM at 100 mg/d/mouse24 for 2 d resulted in marked accumulations of total inflammatory cells and neutrophils in the bronchoalveolar lavage fluid (BALF), both of which were significantly decreased in the Becn1C/¡ (Fig. 3A and B) or lc3b¡/¡ mice (Fig. 4A and B) relative to their littermate controls. Inflammatory cytokines such as the mouse chemokine (CX-C motif) ligand 1 (CXCL1), CXCL2, and IL6 were also notably reduced in Becn1C/¡ mice in response to PM exposure (Fig. 3C to H). In lc3b¡/¡ mice, the PM-induced CXCL1 was markedly reduced (Fig. 4C and D), while surprisingly, IL6 and CXCL2 were not decreased (Fig. S3). Immunohistological analysis further confirmed that the PM-induced airway inflammation was significantly attenuated in Becn1 heterozygous (Fig. 3I and J) as well as in lc3b¡/¡ mice (Fig. 4E and F). Autophagy is essential for PM-induced mucus hyperproduction in vivo We next sought to confirm the effect of autophagy in regulation of PM-induced mucus production in vivo. Surprisingly, airways collected from the mice instilled with PM at 100 mg/d/mouse for 2 d displayed inappreciable mucus hyperproduction (data not shown). We then increased the period of PM exposure for 4 consecutive d, and in this case, mucus hyperproduction was evident in the small airways of wild-type littermates, as revealed by both periodic acidSchiff (PAS) staining (Fig. 5A and 6A) and immunohistochemistry analysis of MUC5AC (Fig. 5C and 6C). Consistent with the in vitro
AUTOPHAGY
299
Figure 1. PM triggers a typical convergence of endocytosis and autophagy in HBE cells. (A to C) TEM images showing the dynamic process of a typical convergence of endocytosis and autophagy in HBE cells stimulated with PM at 100 mg/ml for 24 h. PG, phagophore; AP, autophagosome; AL, autolysosome; AM, amphisome. (D) Representative TEM image of HBE cells treated with vehicle control or PM. AV, autophagic vacuole. (E) Semiquantified number of AVs in TEM images. The data were represented as AVs per 100 mm2 (n D 15 images for each group). , P < 0.05. (F) Representative images of the punctate staining of mRFP-GFP-LC3B in HBE cells treated with vehicle Control or PM. (G to I) Western blot analyses of the induction of LC3B by PM in HBE cells. Cells were treated with various concentrations of PM for 24 h (G), with 100 mg/ml PM for indicated time points (H), or with 100 mg/ml PM and Baf A1 (10 nM) for 24 h (I). Control, vehicle control.
findings (Fig. 2E and F), PM-induced hyperproduction of MUC5AC was also significantly attenuated in Becn1C/¡ (Fig. 5A to D) or lc3b¡/¡ mice (Fig. 6A to D). The mRNA levels of Muc5ac in the lungs exhibited a similar tendency, with a marked elevation in controls and an obvious reduction in Becn1C/¡ (Fig. 5E) or lc3b¡/¡ mice (Fig. 6E) in response to PM exposure. Lysosomal inhibition of the autophagic flux differentially regulates PM-induced production of IL8 and MUC5AC in HBE cells Generally, the autophagosomes or amphisomes fuse with lysosomes to form autolysosomes, where the engulfed components are degraded. To determine the effects of lysosomal
process on PM-induced inflammation and mucin expression, pharmacological and genetic approaches were used. As expected, Baf A1 treatment together with PM resulted in a dramatic accumulation of amphisomes (Fig. 7A), which was consistent with the enhanced expression of LC3B-II by western blot analysis (Fig. 1I). It should be noted that most of the autophagic vacuoles induced by PM in the presence of Baf A1 were amphisomes, clearly with engulfed black particulates therein (Fig. 7A), suggesting that autophagosomes readily fuse with the PM-containing endosomes. We next examined the effects of Baf A1 on PM-induced cytokines and mucin production. To our surprise, treatment with Baf A1 significantly augmented PM-induced mRNA expression of IL8 (Fig. 7B), whereas it markedly inhibited
300
Z. H. CHEN ET AL.
Figure 2. Autophagy mediates PM-induced inflammatory responses and mucus hyperproduction in HBE cells. Cells were transfected with Control-, ATG5-, or BECN1-siRNA for 24 h, and then were treated with PM (100 mg/ml) for an additional 24 h. The relative levels of IL8 (A), IL6 (C), and MUC5AC (E) mRNA transcripts were detected by quantitative PCR, and the protein levels of IL8 (B) and IL6 (D) in the culture supernatants were measured by ELISA. (F) Representative immunofluorescence images of MUC5AC in HBE cells, and (G) the mean relative fluorescence intensities were normalized to Control (nD10 images for each group). Data are presented as Mean § SEM of at least 3 independent experiments. , P < 0.05; , P < 0.01; , P < 0.001. Scale bar: 20 mm.
the expression of MUC5AC (Fig. 7C). We further confirmed such phenomena through a genetic approach by knockdown of LAMP2 (lysosomal-associated membrane protein 2), whose deficiency impairs the lysosomal function.32,33 Consistent with the effects of Baf A1, knockdown of LAMP2 also significantly exacerbated IL8 expression (Fig. 7D) and notably attenuated MUC5AC production (Fig. 7E) in
response to PM treatment in HBE cells. An additional siRNA was used to confirm the effects of LAMP2 on PMinduced expression of IL8 and MUC5AC (Fig. S4). All these findings suggested that lysosomal inhibition differentially regulated expression of IL8 and MUC5AC likely through different pathways. However, the expression of IL6 by lysosomal inhibition was more complicated, as Baf A1
AUTOPHAGY
301
Figure 3. Becn1C/¡ mice display decreased airway inflammation in response to PM exposure. Becn1 heterozygous and their wildtype littermates (n D 5 to 7 for each group) were instilled intratracheally with PM at 100 mg/d for 2 d, and after 24 h, the total inflammatory cells (A) and the number of neutrophils (B) in the BALF were measured. Expression of the mRNA levels of Cxcl1 (C), Cxcl2 (E) and Il6 (G) in lung tissue were analyzed by quantitative PCR. Protein levels of CXCL1 (D), CXCL2 (F), and IL6 (H) in the BALF were measured by ELISA. (I) Representative images of lung sections stained with H&E. (J) Semiquantified inflammation score of the H&E staining (n D 10 images for each group). Data are presented as Mean § SEM of 3 independent experiments. , P < 0.05; , P < 0.01.
302
Z. H. CHEN ET AL.
Figure 4. lc3b¡/¡ mice exhibit reduced airway inflammation in response to PM exposure. Mice (n D 5 to 7 for each group) were instilled intratracheally with PM at 100 mg/d for 2 d, and after 24 h, the total inflammatory cells (A) and the number of neutrophils (B) in the BALF were measured. Expression of the mRNA levels of Cxcl1 (C) in lung tissue were analyzed by quantitative PCR, and protein levels of CXCL1 (D) in the BALF were measured by ELISA. (E) Representative images of lung sections stained with H&E. (F) Semiquantified inflammation score of the H&E staining (n D 10 images for each group). Data are presented as Mean § SEM of 3 independent experiments. , P < 0.05; , P < 0.01; , P < 0.001.
decreased while LAMP2-siRNA increased its expression in HBE cells (Fig. S5A and B). Differential activation of the NFKB1 and AP-1 pathways by lysosomal inhibition differently mediates PM-induced expression of IL8 and MUC5AC in HBE cells The above intriguing results encouraged us to further explore the possible mechanisms mediating the distinct effects of lysosomal inhibition on PM-induced expression of IL8 and MUC5AC. As the transcription factors NFKB1 and AP-1 are well known to mediate inflammatory responses and mucus production in airway injury, we examined the roles of these factors in PM-induced airway epithelial damages. Interestingly,
inhibition of the NFKB1 pathway by CHUK (conserved helixloop-helix ubiquitous kinase) inhibitor VII or a genetic approach with RELA (v-rel avian reticuloendotheliosis viral oncogene homolog A)-siRNA significantly reduced the PMinduced expression of IL8 (Fig. 8A and C), while it exerted no considerable effect on the mRNA level of MUC5AC (Fig. 8B and D). On the contrary, inhibition of the AP-1 pathway by SP600125 or JUN-siRNA failed to affect the expression of IL8 (Fig. 8E and G), whereas it markedly attenuated the PMinduced production of MUC5AC (Fig. 8F and H). Additional siRNAs for RELA and JUN were used and they showed the same effects on PM-induced IL8 and MUC5AC (Fig. S6). These data suggested that the NFKB1 and AP-1 pathways distinctly regulated PM-induced expression of IL8 and MUC5AC in HBE
AUTOPHAGY
303
Figure 5. Becn1C/¡ mice are resistant to PM-induced mucus production in the airway. Mice (n D 5 to 8 for each group) were instilled intratracheally with PM at 100 mg/d for 4 days. (A) Representative images of lung sections with PAS staining. (B) Semiquantified PAS score. (C) Representative images of lung sections stained for MUC5AC. (D) Quantified percentage of MUC5AC positive cells in the epithelium. (E) The mRNA expression of Muc5ac in lung tissues. Data are presented as Mean § SEM of 3 independent experiments. , P < 0.05; , P < 0.01.
cells. We also observed that IL6 was effectively decreased by both RELA- and JUN-siRNA (Fig. S5C and D), suggesting this cytokine was regulated by both pathways. Since lysosomal inhibition upregulated IL8 and downregulated MUC5AC (Fig. 7B-E), and the NFKB1 and AP-1 pathways distinctly mediated their production, we next examined the roles of lysosomal signaling in regulation of these 2 pathways. Interestingly, in cells treated with LAMP2-siRNA, the basal level of RELA was significantly increased, while that of NFKBIA (nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, a) was notably decreased (Fig. 8I), suggesting that autophagosomes and autolysosomes might differentially regulated the protein degradation of NFKBIA and RELA. On the other hand,
LAMP2-siRNA markedly decreased the phosphorylation of JUN (Fig. 8J), suggesting that the lysosomal process was required for the activation of the AP-1 pathway.
Discussion In the present study, we clearly demonstrate that radical-containing ultrafine PM triggers a typical convergence of endocytosis and autophagy in airway epithelial cells, and that autophagy is essential for PM-induced inflammation and mucus hyperproduction through the NFKB1 and AP-1 pathways. We further clarify that the autophagosomes/amphisomes directly activate the NFKB pathway to produce IL8, while the lysosomal
304
Z. H. CHEN ET AL.
Figure 6. lc3b¡/¡ mice are protected from PM-induced mucus production in the airway. Mice (n D 5 to 8 for each group) were instilled intratracheally with PM at 100 mg/ d for 4 d. (A) Representative images of lung sections with PAS staining. (B) Semiquantified PAS score. (C) Representative images of lung sections stained for MUC5AC. (D) Quantified percentage of MUC5AC positive cells in the epithelium. (E) The mRNA expression of Muc5ac in lung tissues. Data are presented as Mean § SEM of 3 independent experiments. , P < 0.05; , P < 0.01; , P < 0.001.
process is required for activation of the AP-1 pathway and its subsequent induction of MUC5AC (Fig. 9). Certain cytokines such as IL6 are regulated by both pathways, and thus blockade of autophagy effectively reduces, while lysosomal inhibition by different approaches exerts complex effects on, IL6 expression. A growing body of literature suggests that autophagy and lysosomal dysfunction are critical for nanomaterial toxicity (reviewed in ref. 18). The sizes of nanomaterials are generally less than 100 nm, which are readily to be phagocytosed into various cells, while little is known about the cellular fate of larger sized PM. Recently, airborne PM2.5 has been reported to induce autophagy in human lung A549 cells,21,22 however, there is little evidence showing whether the PM could be endocytosed and sequestered by autophagosomes. In the present
study, we have clearly observed that larger sized particles between 0.1 to 0.5 mm (Fig. 1B to D) were able to be endocytosed and subsequently fuse with autophagosomes to form typical amphisomes. The sizes of autophagosomes are usually 0.5 to 1.5 mm,34 making it possible to arrest larger sized PM. The roles of autophagy in airway epithelial damages in various lung diseases remain either deleterious or cytoprotective, most likely depending on the different stimuli or pathogens.11,12,35 For example, in hyperoxia-induced airway epithelial damage, LC3B-siRNA promotes hyperoxia-induced cell death, whereas overexpression of LC3B confers cytoprotection.36 However, various kinds of nanoparticles trigger autophagic cell death, and the autophagy inhibitor 3-methyladenine rescues the nanoparticle-induced epithelial cell death and
AUTOPHAGY
305
Figure 7. Autophagic flux differentially modulates PM-induced expression of IL8 and MUC5AC in HBE cells. (A to C) Cells were treated with PM (100 mg/ml) with or without Baf A1 (10 nM) for 24 h, and were analyzed for the atuophagic vesicles by TEM (A), or were measured for the mRNA levels of IL8 (B) or MUC5AC (C). (D and E) Cells were transfected with Control- or LAMP2-siRNA for 24 h, and then were treated with PM (100 mg/ml) for an additional 24 h to examine the mRNA levels of IL8 (D) or MUC5AC (E). Data are presented as Mean § SEM of 3 independent experiments. , P < 0.05.
ameliorates the acute lung injury in mice.37,38 H5N1 infection also induces autophagic cell death in lung epithelial cells, and blocking autophagy not only reduces the epithelial cell death,39,40 decreases the production of proinflammatory cytokines and chemokines,40 but also ameliorates H5N1-induced acute lung injury and mortality.41 Our present results were consistent with the latter studies demonstrating that autophagy was deleterious in PM-induced epithelial damages and airway injury. Autophagy inhibition effectively resulted in attenuated cytokine production in HBE cells and ameliorative inflammation in mouse lungs. Thus, targeting autophagy inhibition in airway epithelial cells might be effective not only for
COPD,13-17 flu virus infection,39-41 nanomaterial toxicity,18,37,38 but also for environmental PM-induced airway inflammation and exacerbation of various chronic lung diseases. Mucus hyperproduction is another important feature of chronic airway diseases. A couple of studies have investigated the role of PM in mucus production. For example, Val et al. report that fine PM induces MUC5AC expression in HBE cells and in mouse trachea, through the autocrine effect of amphiregulin.42 Another study observes that PM induces mucin secretion in HBE cells through calcium influx and the cyclic adenosine monophosphate-protein kinase A pathway.43 Our current data clearly demonstrated that autophagy was essential
306
Z. H. CHEN ET AL.
Figure 8. The NFKB1 and AP-1 pathways differentially mediate PM-induced expression of IL8 and MUC5AC. Cells were treated with CHUK inhibitor VII (A and B) or AP-1 inhibitor SP600125 (E and F) together with PM (100mg/ml) for 24 h, or treated with RELA- (C and D) or JUN-siRNA (G and H) for 24 h, and then with PM (100 mg/ml) for an additional 24 h. The mRNA expression of IL8 (A, C, E, and G) and MUC5AC (B, D, F, and H) were measured. Data are presented as Mean § SEM. , P < 0.05; , P < 0.001; n.s., not significant. (E and F) Cells were treated with indicated Control- or LAMP2-siRNA for 48 h, and then with PM (100 mg/ml) for an additional 12 h. The protein levels of RELA, NFKBIA (E) or p-JUN (F) were examined by western blot. Images are representative of 3 independent experiments.
AUTOPHAGY
Figure 9. Schematic representation of the mechanisms of PM-induced autophagic flux in the differential regulation of subsequent inflammation and mucus hyperproduction in airway epithelium. Ultrafine PM can be endocytosed into HBE cells and triggers autophagy. The PM-containing endosomes fuse with autophagomes to form amphisomes, and the further fusion of amphisomes with lysosomes generates autolysosomes. PM-induced autophagosomes and amphisomes directly activate the NFKB1 pathway to produce IL8, while autolysosomes are required for AP1 activation to produce MUC5AC. Certain cytokines such as IL6 are regulated by both pathways.
for PM-induced mucus hyperproduction in HBE cells and in mouse lungs. Furthermore, the effect of autophagy on mucus production appeared to be independent of the autophagy-regulated inflammation, as inhibition of the autophagic flux significantly decreased the mucus production but increased the IL8 expression. In fact, we have recently found that autophagy mediated cigarette smoke-induced mucus production via the AP-1 pathway in the context of COPD pathogenesis (paper in submission), which is in complete agreement with the current results. It should be noted that the PM-induced activation of the NFKB1 and AP-1 pathways in HBE cells were differentially regulated by the autophagic flux. In general, both these pathways are redox sensitive and are important for the cellular inflammatory responses. Our current results clearly demonstrate that lysosomal inhibition significantly activated the NFKB signaling while markedly attenuated the AP-1 pathway, suggesting that the accumulation of autophagosomes and amphisosomes led to activation of NFKB1, while the lysosomal degradation process was required for AP-1 activation. To the best of our knowledge, this is the first time that such differential regulation of these 2 pathways has been shown in the same paradigm. The detailed mechanisms of how autophagic flux regulates PM-induced activation of these 2 pathways remain unclear. Numerous studies have investigated the crosstalk between autophagy and NFKB1 signaling, while little is known about the relationship between autophagy and AP-1. However, even within the literature on autophagy and NFKB1, only a few of them focus on how autophagy
307
modulates NFKB1 signaling factors, whereas most address the contrary regulation. Nonetheless, the effects of autophagic flux in regulation of NFKB1 activities are complex, and the molecular mechanisms are extremely complicated, and likely vary depending on cell types and stimuli. NFKBIA, RELA, as well as other NFKB1-related molecules, can all be targets for degradation by autophagosomes or autolysosomes, resulting in completely different outcomes. For example, in a macrophage cell differentiation model, knockdown of ATG5 or treatment with Baf A1 could prevent RELA degradation and induce M2 macrophages to produce a high level of proinflammatory cytokines.44 On the contrary, Criollo et al. have observed that the depletion of essential autophagy modulators, including ATG5, ATG7, BECN1, and PIK3C3 (phosphatidylinositol 3-kinase, catalytic subunit type 3), by RNA interference inhibits TNFdriven NFKB1 activation in 2 human cancer cell lines.45 Similarly, in mice lacking ATG4B, mechanical ventilation induced less autophagy, resulting in the accumulation of SQSTM1 (sequestosome 1) and ubiquitinated NFKBIA, and less NFKB1 activation.46 In intestinal epithelial cells, TNF stimulates formation of autophagosomes and NFKBIA colocalizes with autophagosomal vesicles, and pharmacological or genetic blockade of autophagosome formation or lysosomal inhibition decreases TNF-induced degradation of NFKBIA and lowers NFKB1 target gene expression.47 However, in LAMP2-deficient cells, the levels of NFKBIA were significantly decreased, which should theoretically result in an increased NFKB1 activity.47 Our current data are only partially consistent with these studies, showing that blockade of autophagy attenuated both NFKB1 and AP-1 pathways, while lysosomal inhibition resulted in differential outcomes. In conclusion, we show here for the first time that ultrafine PM (around 0.1 to 0.5 mm) can be endocytosed and triggers a typical convergence of endocytosis and autophagy in airway epithelial cells. We further demonstrate that autophagy is essential for PM-induced activation of NFKB1 and AP-1, and subsequent airway inflammation and mucus hyperproduction. In addition, we observe that the autophagic flux differentially modulates the NFKB1 and AP-1 activities, and the consequent outcomes. Nonetheless, inhibiting autophagy could be an effective therapeutic approach for airway disorders or disease exacerbations induced by airborne particulate pollution.
Materials and methods Cell culture HBE cells were purchased from American Type Culture Collection (CRL-2741), and were maintained in RPMI 1640 with 10% FBS, 50 U/ml penicillin, and 50 U/ml streptomycin. Reagents The initial set of siRNAs of Control(sc-37007), ATG5(sc41445), BECN1(sc-29797), RELA (sc-29410), LAMP2 (sc29390), JUN (sc-29223) were purchased from Santa Cruz
308
Z. H. CHEN ET AL.
Biotechnology. An additional set of siRNAs of RELA, LAMP2, and JUN were designed and synthesized by Shanghai GenePharma for verifying the effects (see supplementary Reagents). The siRNA transfection reagent (SL100568) and the PloyJet in vitro DNA Transfection reagent (SL100688) were purchased from SignaGen Laboratories. Antibodies against ACTB (Santa Cruz Biotechnology, sc-47778), LC3B (Sigma-Aldrich, L7543), RELA (Cell Signaling Technology, 8242), NFKBIA (Cell Signaling Technology, 4812), p-JUN (Cell Signaling Technology, 3270), and MUC5AC (Abcam, ab24071) were used. All of these antibodies were diluted at 1:1000 in 5% nonfat dried milk, except for the LC3B and ACTB which were diluted at 1:2000. All primers used in the study were synthesized by Sangon Biotech, Shanghai. ELISA kits for human IL8 (D8000C), human IL6 (D6050), mouse CXCL1 (MKC00B), mouse CXCL2 (MM200), mouse IL6 (M6000B) were purchased from R&D systems. IKK inhibitor VII was purchased from Calbiochem (401486), and its final concentration in culture medium was 1 mg/ml. Baf A1 (B1793) and SP600125 (S5567) were from Sigma-Aldrich, and the final concentrations in the culture medium were 10 nM and 10 mM respectively.
The siRNA transfection was performed with the transfection reagent following the manufacturer’s protocol. Briefly, 5 £ 104 cells were placed in each well of 6-well plates for 18 h prior to transfection. The siRNA in 1 ml growth medium were incubated with HBE cells for 5 h. The infection medium was removed and replaced with fresh growth medium. The mRFPGFP-LC3B plasmid was transfected into cells by using PloyJet in vitro DNA Transfection reagent. 1 £ 106 cells were seeded to a 6 cm dish 24 h before mRFP-GFP-LC3 plasmid transfection. The infection medium was replaced with fresh growth medium after being incubated with HBE cells for 8 h. Confocal images were viewed using a Zeiss LSM confocal laser scanning microscope (Carl Zeiss, G€ottingen, Germany).
Animals
RNA isolation and quantitative real-time PCR analysis
C/¡
Becn1 mice were kindly provided by Dr. Beth Levine, University of Texas Southwestern Medical Center. lc3b¡/¡ mice were from Jackson Laboratory. All mice were maintained in a specific pathogen-free facility. All experimental protocols were approved by the Ethical Committee for Animal Studies at Zhejiang University. In vivo and in vitro PM exposure PM was produced as previously described,23-25 which was tested negative for lipooligosaccharide contamination, and was vacuum-packed in ampoules. In vivo, PM was suspended and sonicated in sterile saline to a final concentration at 2 mg/ml. To establish a mouse model of acute airway inflammation, mice were treated with 100 mg PM (in 50 ml saline) per day by intratracheal instillation for 2 d. The period of PM exposure
was increased for consecutive 4 d for studying the mucus hyperproduction. Control mice received the same volume of saline. In vitro, PM was suspended and sonicated in sterile saline to a final concentration at 1 mg/ml, and HBE cells were treated with PM at 100 mg/ml. Transfection
RNA from cells and lung homogenates was isolated using Trizol (Invitrogen, 15596 026). Reverse transcription was performed with Reverse Transcription Reagents (Takara Biotechnology, DRR037A). The expression of human IL8, IL6, and MUC5AC, and mouse Cxcl1, Cxcl2, Il6, and Muc5ac were measured by quantitative real-time PCR using SYBR Green Master Mix (Takara Biotechnology, DRR041A) on a StepOne real-time PCR system (Applied Biosystems, Foster City, CA). All protocols were performed according to the manufacturer’s instructions. The primers used in the present study are listed in Table 1. Western blot assay After treatment with PM, HBE cells were lysed in RIPA buffer (Beyotime, P0013B) containing protease (Roche Diagnostics
Table 1. Primers used for quantitative real time PCR analysis. Species Human Human Human Human Mouse Mouse Mouse Mouse Mouse
Genes ACTB Reverse: CTCCTTAATGTCACGCACGAT IL8 Reverse: AACCCTCTGCACCCAGTTTTC IL6 Reverse: CCATCTTTGGAAGGTTCAGGTTG MUC5AC Reverse: GCGCACAGAGGATGACAGT Actb Reverse: CCAGTTGGTAACAATGCCATGT Cxcl1 Reverse: CAGGGTCAAGGCAAGCCTC Cxcl2 Reverse: CTCAGACAGCGAGGCACATC Il6 Reverse: AGTGGTATAGACAGGTCTGTTGG Muc5ac Reverse: AAGGGGTATAGCTGGCCTGA
Primer sequence (50 –30 ) Forward: CATGTACGTTGCTATCCAGGC Forward: ACTGAGAGTGATTGAGAGTGGAC Forward: ACTCACCTCTTCAGAACGAATTG Forward: CAGCACAACCCCTGTTTCAAA Forward: GGCTGTATTCCCCTCCATCG Forward: CTGGGATTCACCTCAAGAACATC Forward: TGTCCCTCAACGGAAGAACC Forward: CTGCAAGAGACTTCCATCCAG Forward: CTGTGACATTATCCCATAAGCCC
AUTOPHAGY
GmbH, 04-693-116-001) and phosphatase inhibitors (Roche Diagnostics GmbH, 04-906-837-001). Lysates were run on gels and immunoblotted with relevant antibodies using standard methods. ACTB served as a protein loading control.
309
slides. Cells were stained with Wright–Giemsa stain (Baso, BA4017), and differential counts were determined by counting 200 total cells. Histological analyses
Immunofluorescence staining HBE cells were seeded on cleaned and autoclaved glass coverslips. After exposure to PMs, the cells were washed with phosphate-buffered saline (PBS; Biotopped, 150814), and then fixed in 4% formaldehyde solution. Subsequently, the cells were treated with 0.1% Triton-X-100 (Sigma-Aldrich, LC262801) in PBS for permeabilization and blocked with 5% BSA (SigmaAldrich, B2064) followed by washing with PBS. Anti-MUC5AC was used at 1:200 dilution overnight at 4 C. After washing the cells with PBS, Alexa Fluor® 488 goat anti-mouse IgG (HCL) antibody (Invitrogen, A11001) solution was added and incubated for 1 h at RT, and washed again, allowed to air dry completely and cells mounted on slides in a drop of Vectashield plus DAPI mounting medium (Life Technologies, P36935). Fluorescent images were captured with a Zeiss LSM laser scanning confocal microscope. The relative fluorescence intensity was measured with Image-Pro Plus 6.0 (Media Cybernetics, Silver Spring, MD, USA), and the mean relative fluorescence intensities were normalized to the levels of control. ELISA The concentration of IL8 and IL6 in culture supernatants and concentration of CXCL1, CXCL2 and IL6 in BALF supernatants were determined with ELISA kits following the manufacturer’s protocol.
After treatment with PM, the lungs were collected and fixed in formalin for 24 h. Then these collected lungs were embedded in paraffin and were stained with hematoxylin and eosin (H&E) or PAS following standard protocols.48-49 Inflammation was assessed according to published guidelines,48 and PASstained goblet cells in airway epithelium were scored as described previously.49 Immunohistochemistry Sections of lung tissues were immunostained with antiMUC5AC according to the manufacturer’s instructions. Images were scanned with an Olympus BX53 inverted microscope (Olympus, Melville, NY). Image quantitative analysis was performed as previously described.50 MUC5AC positive bronchial epithelial cells were presented as a percentage of total epithelial cells. Statistics Results are presented as means § SEM. Data were analyzed with GraphPad Prism 5.01 (GraphPad software, San Diego, CA USA). Differences between 2 groups were identified using the Student t test. A value of P less than 0.05 was considered to be statistically significant.
Abbreviations Transmission electron microscopy For transmission electron microscopy (TEM) analysis, HBE cells were fixed in 2.5% glutaradehyde in PBS for 24 h after experimental manipulations. These cells were washed in PBS, postfixed in 1% osmium tetroxide, and stained with 4% uranyl acetate. The samples were embedded in embedding medium after being dehydrated. Ultrathin sections were stained with uranyl acetate and lead citrate. Images were taken using a TECNA1 10 transmission electron microscope (FEI, Hillsboro, Oregon, USA) at 80 kv. In order to quantify the alteration of the number of the autophagic vacuoles (AVs), the area of the cell cytoplasm was measured by using Image-Pro Plus 6.0. The data were represented as AVs per 100 mm2.
ACTB AP-1 AVs BECN1 Baf A1 BALF CXCL COPD HBE H&E IL LAMP2 MAP1LC3B/LC3B MUC5AC NFKB1 NFKBIA
BALF collection and analysis Twenty-four h after the last exposure to PM, BALF was obtained utilizing 3 instillations, of each was performed with 0.4 ml PBS injected into the lungs, and with drawn to collect the cells. The total number of BALF cells was counted, and then the remaining BALF was centrifuged at 400 g for 10min at 4 C. The supernatant was stored at ¡80 C and used for analysis of cytokines. The cell pellet was suspended in 200 ml PBS, and 10 ml of the suspension was spun onto glass microscope
PAS PM RELA TEM TNF
actin, b; ATG, autophagy-related activator protein 1 autophagic vacuoles Beclin 1, autophagy related bafilomycin A1 bronchoalveolar lavage fluid chemokine (C-X-C motif) ligand chronic obstructive pulmonary disease human bronchial epithelial hematoxylin and eosin interleukin lysosomal-associated membrane protein 2 microtubule-associated protein 1 light chain 3 b mucin 5AC, oligomeric mucus/gel-forming nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, a periodic acid-Schiff particulate matter v-rel avian reticuloendotheliosis viral oncogene homolog A transmission electronic microscopy tumor necrosis factor
Disclosure of potential conflicts of interest There were no potential conflicts of interest to be disclosed.
310
Z. H. CHEN ET AL.
Funding This work was supported by the Key Project of Chinese National Programs for Fundamental Research and Development (973 program, 2015CB553405), the General Projects (31170859 and 81370142 to Z.H.C.) and the Young Investigator Project (81200021 to P.L.W.) from the National Natural Science Foundation of China, the Distinguished Young Investigator Award (LR14H010001 to P.L.W.) from Natural Science Foundation of Zhejiang Province, the Key Science-Technology Innovation Team of Zhejiang Province (2011R50016), and the project from the National Clinical Research Center of China for Respiratory Disease.
References 1. Gehring U, Gruzieva O, Agius RM, Beelen R, Custovic A, Cyrys J, Eeftens M, Flexeder C, Fuertes E, Heinrich J, et al. Air pollution exposure and lung function in children: the ESCAPE project. Environ Health Perspect 2013; 121:1357-64; PMID:24076757 2. Karakatsani A, Analitis A, Perifanou D, Ayres JG, Harrison RM, Kotronarou A, Kavouras IG, Pekkanen J, H€ameri K, Kos GP, et al. Particulate matter air pollution and respiratory symptoms in individuals having either asthma or chronic obstructive pulmonary disease: a European multicentre panel study. Environ Health 2012; 11:75; PMID:23039312; http://dx.doi.org/10.1186/1476-069X-11-75 3. Gan WQ, FitzGerald JM, Carlsten C, Sadatsafavi M, Brauer M. Associations of ambient air pollution with chronic obstructive pulmonary disease hospitalization and mortality. Am J Respir Crit Care Med 2013; 187:721-7; PMID:23392442; http://dx.doi.org/10.1164/ rccm.201211-2004OC 4. Raaschou-Nielsen O, Andersen ZJ, Beelen R, Samoli E, Stafoggia M, Weinmayr G, Hoffmann B, Fischer P, Nieuwenhuijsen MJ, Brunekreef B, et al. Air pollution and lung cancer incidence in 17 European cohorts: prospective analyses from the European Study of Cohorts for Air Pollution Effects (ESCAPE). Lancet Oncol 2013; 14:813-22; PMID:23849838; http://dx.doi.org/10.1016/S14702045(13)70279-1 5. Choi AM, Ryter SW, Levine B. Autophagy in human health and disease. N Engl J Med 2013; 368:651-62; PMID:23406030; http://dx.doi. org/10.1056/NEJMra1205406 6. Levine B, Kroemer G. Autophagy in the pathogenesis of disease. Cell 2008; 132:27-42; PMID:18191218; http://dx.doi.org/10.1016/j. cell.2007.12.018 7. He C, Klionsky DJ. Regulation mechanisms and signaling pathways of autophagy. Annu Rev Genet 2009; 43:67-93; PMID:19653858; http:// dx.doi.org/10.1146/annurev-genet-102808-114910 8. Klionsky DJ, Abdalla FC, Abeliovich H, Abraham RT, Acevedo-Arozena A, Adeli K, Agholme L, Agnello M, Agostinis P, Aguirre-Ghiso JA, et al. Guidelines for the use and interpretation of assays for monitoring autophagy. Autophagy 2012; 8:445-544; PMID:22966490; http://dx.doi.org/10.4161/auto.19496 9. Klionsky DJ, Eskelinen EL, Deretic V. Autophagosomes, phagosomes, autolysosomes, phagolysosomes, autophagolysosomes… wait, I’m confused. Autophagy 2014; 10:549-51; PMID:24657946; http://dx.doi. org/10.4161/auto.28448 10. Gordon PB, Seglen PO. Prelysosomal convergence of autophagic and endocytic pathways. Biochem Biophys Res Commun 1988; 151:40-47; PMID:3126737; http://dx.doi.org/10.1016/0006-291X(88)90556-6 11. Ryter SW, Nakahira K, Haspel JA, Choi AM. Autophagy in pulmonary diseases. Annu Rev Physiol 2012; 74:377-401; PMID:22035347; http://dx.doi.org/10.1146/annurev-physiol-020911-153348 12. Patel AS, Morse D, Choi AM. Regulation and Functional Significance of Autophagy in Respiratory Cell Biology and Disease. Am J Respir Cell Mol Biol 2013; 48:1-9; PMID:22984088; http://dx.doi.org/ 10.1165/rcmb.2012-0282TR 13. Chen ZH, Kim HP, Sciurba FC, Lee SJ, Feghali-Bostwick C, Stolz DB, Dhir R, Landreneau RJ, Schuchert MJ, Yousem SA, et al. Egr-1 regulates autophagy in cigarette smoke-induced chronic obstructive pulmonary disease. PLoS One 2008; 3:e3316; PMID:18830406; http://dx. doi.org/10.1371/journal.pone.0003316
14. Kim HP, Wang X, Chen ZH, Lee SJ, Huang MH, Wang Y, Ryter SW, Choi AM. Autophagic proteins regulate cigarette smoke-induced apoptosis: protective role of heme oxygenase-1. Autophagy. 2008 Oct; 4 (7):887-95; http://dx.doi.org/10.4161/auto.6767 15. Chen ZH, Lam HC, Jin Y, Kim HP, Cao J, Lee SJ, Ifedigbo E, Parameswaran H, Ryter SW, Choi AM. Autophagy protein microtubule-associated protein 1 light chain-3B (LC3B) activates extrinsic apoptosis during cigarette smoke-induced emphysema. Proc Natl Acad Sci USA 2010; 107:18880-5; PMID:20956295; http://dx.doi.org/10.1073/ pnas.1005574107 16. Lam HC, Cloonan SM, Bhashyam AR, Haspel JA, Singh A, Sathirapongsasuti JF, Cervo M, Yao H, Chung AL, Mizumura K, et al. Histone deacetylase 6-mediated selective autophagy regulates COPDassociated cilia dysfunction. J Clin Invest 2013; 123:5212-30; PMID:24200693; http://dx.doi.org/10.1172/JCI69636 17. Cloonan SM, Lam HC, Ryter SW, Choi AM. “Ciliophagy”: The consumption of cilia components by autophagy. Autophagy 2014; 10:5324; PMID:24401596; http://dx.doi.org/10.4161/auto.27641 18. Stern ST, Adiseshaiah PP, Crist RM. Autophagy and lysosomal dysfunction as emerging mechanisms of nanomaterial toxicity. Part Fibre Toxicol 2012; 9:20; PMID:22697169; http://dx.doi.org/10.1186/1743-8977-9-20 19. Zabirnyk O, Yezhelyev M, Seleverstov O. Nanoparticles as a novel class of autophagy activators. Autophagy 2007; 3:278-81; PMID:17351332; http://dx.doi.org/10.4161/auto.3916 20. Khan MI, Mohammad A, Patil G, Naqvi SA, Chauhan LK, Ahmad I. Induction of ROS, mitochondrial damage and autophagy in lung epithelial cancer cells by iron oxide nanoparticles. Biomaterials 2012; 33:1477-88; PMID:22098780; http://dx.doi.org/10.1016/j. biomaterials.2011.10.080 21. Deng X, Zhang F, Wang L, Rui W, Long F, Zhao Y, Chen D, Ding W. Airborne fine particulate matter induces multiple cell death pathways in human lung epithelial cells. Apoptosis 2014; 19:1099-112; PMID:24722831; http://dx.doi.org/10.1007/s10495-014-0980-5 22. Deng X, Zhang F, Rui W, Long F, Wang L, Feng Z, Chen D, Ding W. PM2.5-induced oxidative stress triggers autophagy in human lung epithelial A549 cells. Toxicol In Vitro 2013; 27:1762-70; PMID:23685237; http://dx.doi.org/10.1016/j.tiv.2013.05.004 23. Lomnicki S, Truong H, Vejerano E, Dellinger B. Copper oxide-based model of persistent free radical formation on combustion-derived particulate matter. Environ Sci Technol 2008; 42:4982-8; PMID:18678037; http://dx.doi.org/10.1021/es071708h 24. Wang P, You D, Saravia J, Shen H, Cormier SA. Maternal exposure to combustion generated PM inhibits pulmonary Th1 maturation and concomitantly enhances postnatal asthma development in offspring. Part Fibre Toxicol. 2013; 10:29; PMID:23856009; http://dx.doi.org/ 10.1186/1743-8977-10-29 25. Balakrishna, S. Lomnicki S, McAvey KM, Cole RB, Dellinger B, Cormier SA. Environmentally persistent free radicals amplify ultrafine particle mediated cellular oxidative stress and cytotoxicity. Part. Fibre. Toxicol. 2009; 6:11 26. Hogg JC, Timens W. The pathology of chronic obstructive pulmonary disease. Annu Rev Pathol 2009; 4:435-59; PMID:18954287; http://dx. doi.org/10.1146/annurev.pathol.4.110807.092145 27. Hogg JC, Chu F, Utokaparch S, Woods R, Elliott WM, Buzatu L, Cherniack RM, Rogers RM, Sciurba FC, Coxson HO, Pare PD. The nature of small-airway obstruction in chronic obstructive pulmonary disease. N Engl J Med 2004; 350:2645-53; PMID:15215480; http://dx. doi.org/10.1056/NEJMoa032158 28. Fahy JV. Dickey BF. Airway Mucus Function and Dysfunction. N Engl J Med 2010; 363:2233-47; PMID:21121836; http://dx.doi.org/10.1056/ NEJMra0910061 29. Nakahira K, Haspel JA, Rathinam VA, Lee SJ, Dolinay T, Lam HC, Englert JA, Rabinovitch M, Cernadas M, Kim HP, et al. Autophagy proteins regulate innate immune responses by inhibiting the release of mitochondrial DNA mediated by the NALP3 inflammasome. Nat Immunol 2011; 12:222-30; PMID:21151103; http://dx.doi.org/ 10.1038/ni.1980 30. Lee S, Lee SJ, Coronata AA, Fredenburgh LE, Chung SW, Perrella MA, Nakahira K, Ryter SW, Choi AM. Carbon monoxide confers protection in sepsis by enhancing beclin 1-dependent autophagy and
AUTOPHAGY
31.
32.
33.
34. 35.
36.
37.
38.
39.
40.
phagocytosis. Antioxid Redox Signal 2014; 20:432-42; PMID:23971531; http://dx.doi.org/10.1089/ars.2013.5368 Lee SJ, Kim HP, Jin Y, Choi AM, Ryter SW. Beclin 1 deficiency is associated with increased hypoxia-induced angiogenesis. Autophagy 2011; 7:829-39; PMID:21685724; http://dx.doi.org/10.4161/auto.7.8.15598 Bandyopadhyay U, Kaushik S, Varticovski L, Cuervo AM. The chaperone-mediated autophagy receptor organizes in dynamic protein complexes at the lysosomal membrane. Mol Cell Biol 2008; 28:5747-63; PMID:18644871; http://dx.doi.org/10.1128/ MCB.02070-07 Fortunato F, B€ urgers H, Bergmann F, Rieger P, B€ uchler MW, Kroemer G, Werner J. Impaired autolysosome formation correlates with Lamp2 depletion: role of apoptosis, autophagy, and necrosis in pancreatitis. Gastroenterology 2009; 137:350-60, 360.e1-5; PMID:19362087; http:// dx.doi.org/10.1053/j.gastro.2009.04.003 Mizushima N, Ohsumi Y, Yoshimori T. Autophagosome formation in mammalian cells. Cell Struct. Funct 2002; 27:421-9 Hu Y, Liu J, Wu YF, Lou J, Mao YY, Shen HH, Chen ZH. mTOR and autophagy in regulation of acute lung injury: a review and perspective. Microbes Infect 2014; 16:727-34; PMID:25084494; http://dx.doi.org/ 10.1016/j.micinf.2014.07.005 Lee SJ, Smith A, Guo L, Alastalo TP, Li M, Sawada H, Liu X, Chen ZH, Ifedigbo E, Jin Y, et al. Autophagic protein LC3B confers resistance against hypoxia-induced pulmonary hypertension. Am J Respir Crit Care Med 2011; 183:649-58; PMID:20889906; http://dx.doi.org/ 10.1164/rccm.201005-0746OC Li C, Liu H, Sun Y, Wang H, Guo F, Rao S, Deng J, Zhang Y, Miao Y, Guo C, et al. PAMAM nanoparticles promote acute lung injury by inducing autophagic cell death through the Akt-TSC2-mTOR signaling pathway. J Mol Cell Biol 2009; 1:37-45; PMID:19516051; http:// dx.doi.org/10.1093/jmcb/mjp002 Liu HL, Zhang YL, Yang N, Zhang YX, Liu XQ, Li CG, Zhao Y, Wang YG, Zhang GG, Yang P, et al. A functionalized singlewalled carbon nanotube-induced autophagic cell death in human lung cells through Akt-TSC2-mTOR signaling. Cell Death Dis 2011; 2:e159; PMID:21593791; http://dx.doi.org/10.1038/ cddis.2011.27 Ma J, Sun Q, Mi R, Zhang H. Avian influenza A virus H5N1 causes autophagy-mediated cell death through suppression of mTOR signaling. J Genet Genomics 2011; 38:533-7; PMID:22133684; http://dx.doi. org/10.1016/j.jgg.2011.10.002 Sun Y, Li C, Shu Y, Ju X, Zou Z, Wang H, Rao S, Guo F, Liu H, Nan W, et al. Inhibition of autophagy ameliorates acute lung injury caused by avian influenza A H5N1 infection. Sci Signal 2012; 5:ra16; PMID:22355189; http://dx.doi.org/10.1126/scisignal.2001931
311
41. Pan H, Zhang Y, Luo Z, Li P, Liu L, Wang C, Wang H, Li H, Ma Y. Autophagy mediates avian influenza H5N1 pseudotyped particleinduced lung inflammation through NF-kappaB and p38 MAPK signaling pathways. Am J Physiol Lung Cell Mol Physiol 2014; 306:18395; http://dx.doi.org/10.1152/ajplung.00147.2013 42. Val S, Belade E, George I, Boczkowski J, Baeza-Squiban A. Fine PM induce airway MUC5AC expression through the autocrine effect of amphiregulin. Arch Toxicol 2012; 86:1851-9; PMID:22820758; http:// dx.doi.org/10.1007/s00204-012-0903-6 43. Yu H, Li Q, Kolosov VP, Perelman JM, Zhou X. Regulation of particulate matter-induced mucin secretion by transient receptor potential vanilloid 1 receptors. Inflammation 2012; 35:1851-9; PMID:22829138; http://dx.doi.org/10.1007/s10753-012-9506-x 44. Chang CP, Su YC, Hu CW, Lei HY. TLR2-dependent selective autophagy regulates NF-kB lysosomal degradation in hepatomaderived M2 macrophage differentiation. Cell Death Differ. 2013; 20:515-23; PMID:23175187; http://dx.doi.org/10.1038/cdd.2012.146 45. Criollo A, Chereau F, Malik SA, Niso-Santano M, Mari~ no G, Galluzzi L, Maiuri MC, Baud V, Kroemer G. Autophagy is required for the activation of NFkB. Cell Cycle 2012; 11:194-9; PMID:22186785; http://dx.doi.org/10.4161/cc.11.1.18669 Amado46. L opez-Alonso I, Aguirre A, Gonzalez-L opez A, Fernandez AF, Rodrıguez L, Astudillo A, Batalla-Solıs E, Albaiceta GM. Impairment of autophagy decreases ventilator-induced lung injury by blockade of the NF-kB pathway. Am J Physiol Lung Cell Mol Physiol 2013; 304:L844852; PMID:Can’t; http://dx.doi.org/10.1152/ajplung.00422.2012 47. Colleran A, Ryan A, O’Gorman A, Mureau C, Liptrot C, Dockery P, Fearnhead H, Egan LJ. Autophagosomal IkappaB alpha degradation plays a role in the long term control of tumor necrosis factor-alpha-induced nuclear factor-kappaB (NF-kappaB) activity. J Biol Chem 2011; 286:22886-93; PMID:21454695; http://dx.doi.org/10.1074/jbc.M110.199950 48. Lee KS, Lee HK, Hayflick JS, Lee YC, Puri KD. Inhibition of phosphoinositide 3-kinase delta attenuates allergic airway inflammation and hyperresponsiveness in murine asthma model. FASEB J 2006; 20:45565; PMID:16507763; http://dx.doi.org/10.1096/fj.05-5045com 49. McMillan SJ, Bishop B, Townsend MJ, McKenzie AN, Lloyd CM. The absence of interleukin 9 does not affect the development of allergeninduced pulmonary inflammation nor airway hyperreactivity. J Exp Med 2002; 195:51-7; PMID:11781365; http://dx.doi.org/10.1084/ jem.20011732 50. Xanthou, G. Alissafi T, Semitekolou M, Simoes DC, Economidou E, Gaga M, Lambrecht BN, Lloyd CM, Panoutsakopoulou V. Osteopontin has a crucial role in allergic airway disease through regulation of dendritic cell subsets. Nat Med 2007; 13:570-8; PMID:17435770; http://dx.doi.org/10.1038/nm1580
BASIC RESEARCH PAPER
Autophagy is essential for ultrafine particle-induced inflammation and mucus hyperproduction in airway epithelium Zhi-Hua Chena,#, Yin-Fang Wua,#, Ping-Li Wanga, Yan-Ping Wua, Zhou-Yang Lia, Yun Zhaoa, Jie-Sen Zhoua, Chen Zhua, Chao Caoa, Yuan-Yuan Maoa, Feng Xua, Bei-Bei Wangb, Stephania A. Cormierc, Song-Min Yinga, Wen Lia, and Hua-Hao Shena,d a Department of Respiratory and Critical Care Medicine, Second Affiliated Hospital; Zhejiang University School of Medicine, Hangzhou, Zhejiang; bCore Facilities, Zhejiang University School of Medicine, Hangzhou, Zhejiang; cDepartment of Pediatrics, University of Tennessee Health Science Center, Children’s Foundation Research Institute, Memphis, TN, USA; dState Key Lab of Respiratory Disease, National Clinical Research Center for Respiratory Disease, Guangzhou, China
ABSTRACT
ARTICLE HISTORY
Environmental ultrafine particulate matter (PM) is capable of inducing airway injury, while the detailed molecular mechanisms remain largely unclear. Here, we demonstrate pivotal roles of autophagy in regulation of inflammation and mucus hyperproduction induced by PM containing environmentally persistent free radicals in human bronchial epithelial (HBE) cells and in mouse airways. PM was endocytosed by HBE cells and simultaneously triggered autophagosomes, which then engulfed the invading particles to form amphisomes and subsequent autolysosomes. Genetic blockage of autophagy markedly reduced PM-induced expression of inflammatory cytokines, e.g. IL8 and IL6, and MUC5AC in HBE cells. Mice with impaired autophagy due to knockdown of autophagy-related gene Becn1 or Lc3b displayed significantly reduced airway inflammation and mucus hyperproduction in response to PM exposure in vivo. Interference of the autophagic flux by lysosomal inhibition resulted in accumulated autophagosomes/amphisomes, and intriguingly, this process significantly aggravated the IL8 production through NFKB1, and markedly attenuated MUC5AC expression via activator protein 1. These data indicate that autophagy is required for PM-induced airway epithelial injury, and that inhibition of autophagy exerts therapeutic benefits for PM-induced airway inflammation and mucus hyperproduction, although they are differentially orchestrated by the autophagic flux.
Received 30 March 2015 Revised 5 November 2015 Accepted 18 November 2015
Introduction Ambient air pollution, specifically environmental particulate matter (PM), causes a variety of adverse health effects. The lung is the major target of airborne pollutants. Accumulating evidence suggests that exposure to environmental PM pollution is associated with decreased lung function and increased exacerbation, hospitalization, disease incidence, and/or mortality of certain chronic respiratory diseases such as asthma, chronic obstructive pulmonary disease (COPD), and lung cancer.1-4 However, the molecular mechanisms mediating the adverse effects of PM in these diseases remain largely unknown. Autophagy is a dynamic process responsible for the turnover of cellular organelles and long-lived proteins, which plays a crucial role in cellular homeostasis and adaptation to adverse environments.5,6 More than 30 autophagy-related (ATG) genes and gene products have been identified heretofore, and the most investigated molecules include ATG5, BECN1/Beclin 1, and MAP1LC3B/LC3B (microtubule-associated protein 1 light chain 3 b).7 In mammals, the conversion of LC3B from the free form (LC3B-I) to the phosphatidylethanolamine-conjugated
airway inflammation; autophagy; endocytosis; mucus hyperproduction; ultrafine particulate matter
form (LC3B-II) represents a key step in autophagosome formation, and thus the net amount of LC3B-II is a critical hallmark for monitoring autophagy in mammalian cells.8 In general, the fusion of autophagosomes with lysosomes forms autolysosomes, a process that is part of complete autophagic flux, resulting in the breakdown and efflux of sequestered materials. In the case of endocytosis, the endosomes fuse with autophagosomes to form amphisomes, and the further fusion of amphisomes with lysosomes generates autolysosomes.9,10 Accumulating evidence suggests that autophagy plays important roles in pulmonary diseases.11,12 We have previously demonstrated that autophagy is critical in mediating the cigarette smoke-induced apoptosis of lung epithelial cells and contributes to the development of emphysema.13-15 Autophagy has also been recently shown to mediate cigarette smoke-induced cilia shortening in the airway epithelium.16,17 These data suggest that autophagy is a deleterious process orchestrating various damage processes in airway epithelium during COPD development. Emerging studies also suggest that autophagyrelated pathways are critically involved in nanomaterial
CONTACT Hua-Hao Shen [email protected]; Wen Li [email protected] 88 Jiefang Rd, Hangzhou, 310009, China Color versions of one or more of the figures in this article can be found online at www.tandfonline.com/kaup. # These authors contributed equally to this article. Supplemental data for this article can be accessed on the publisher’s website. © 2016 Taylor & Francis Group, LLC
KEYWORDS
298
Z. H. CHEN ET AL.
toxicity,18-20 and most recently, airborne PM2.5 has been reported to induce autophagy in human lung A549 cells.21,22 However, several critical items remain unclear regarding PM and autophagy in the context of airway injury. Can PM, especially the ultrafine PM, be endocytosed into the airway epithelial cells? Can the endocytosed PM be engulfed by autophagosomes? What are the eventual functions of autophagy in PM-induced damage in bronchial epithelial cells and in vivo? Is PM-induced autophagy deleterious as in case of cigarette smoke-induced airway injury? What are the molecular mechanisms mediating the effects of autophagy in PM-induced cellular injury? The present study addresses these questions using both pharmacological and genetic approaches in vitro and in vivo. Our results demonstrate that ultrafine PM triggers a typical convergence of endocytosis and autophagy in airway epithelial cells, and that autophagy is essential for the subsequent PMinduced inflammation and mucus hyperproduction. We also demonstrate that the lysosomal process differentially regulates the expressions of inflammatory cytokine IL (interleukin) 8 and mucin MUC5AC (mucin 5AC, oligomeric mucus/gelforming), distinctly through NFKB1 (nuclear factor of kappa light polypeptide gene enhancer in B-cells 1) and activator protein-1 (AP-1).
Results Ultrafine PM triggers a typical convergence of endocytosis and autophagy in human bronchial epithelial (HBE) cells Ultrafine PM containing environmentally persistent free radicals were fabricated and characterized previously.23-25 The total radical concentration was 2.5 mM/g PM, and mean diameter was around 0.2 mm. Treatment of HBE cells with this PM triggered typical features of a convergence of endocytosis and autophagy9,10 (Fig. 1A to C). By transmission electronic microscopy (TEM), we observed that endocytosis occurred in the plasma membrane upon PM exposure, with a phagophore emerging close to the endocytosis site (Fig. 1A). Autophagosomes then attempted to fuse with endocytosed PM (Fig. 1B), to form amphisomes and subsequent autolysosomes (Fig. 1C). The sizes of autophagy-captured particles were generally from 0.1 to 0.5 mm (Fig. 1B to D). PM induced a marked elevation of autophagy in HBE cells, as revealed through quantification of the TEM images and the punctation of mRFP-GFP-LC3B (Fig. 1D to F). Western blotting analysis also demonstrated a time- and dose-dependent induction of LC3B-II by PM in HBE cells (Figs. 1G and H). Treatment of PM with a lysosome inhibitor bafilomycin A1 (Baf A1) further enhanced the induction of LC3B-II (Fig. 1I), suggesting that the increased levels of LC3BII by PM treatment were indeed induced, rather than due to an impaired autophagosome-lysosome fusion. Autophagy is required for PM-induced expression of inflammatory cytokines and mucin MUC5AC levels in HBE cells The induced autophagy can be either cytoprotective or deleterious. Therefore, we sought to explore the functions of autophagy
in PM-induced cellular injury. PM exposure induced a marked elevation of the mRNA transcripts as well as the secreted protein levels of inflammatory cytokines IL8 and IL6 in HBE cells, and all of these were significantly decreased in the cells treated with siRNAs targeting autophagy-related genes BECN1 or ATG5 (Fig. 2A to D). However, other inflammatory cytokines, such as those encoded by IL1A, IL1B, IL18, and TNF (tumor necrosis factor), were not or were less significantly induced (Fig. S1). This suggests a deleterious effect of autophagy in mediating PM-induced inflammation in airway epithelial cells. The knockdown effects of all siRNAs used in this study are shown in Figure S2. Mucus hyperproduction by airway epithelial cells is another cardinal feature of chronic airway diseases, which results in airway obstruction and contributes significantly to morbidity and mortality.26,27 However, little is known about the role of PM in mucus production. Among the over 20 mucin genes identified, MUC5AC is one of the most predominant mucins in the airway, and is highly inducible especially in pathological conditions.28 Interestingly, we observed that PM triggered a significant induction of MUC5AC at both mRNA transcripts and protein levels in HBE cells (Fig. 2E and F). Similar to the cytokines, elevated MUC5AC was also effectively attenuated by knockdown of BECN1 or ATG5 (Fig. 2E to G), indicating an essential role of autophagy in PM-induced mucin production in airway epithelial cells. PM-induced airway inflammation is reduced in Becn1C/¡ or lc3b¡/¡ mice To further examine the role of autophagy in regulation of airway inflammation in vivo, Becn1C/¡ and lc3b¡/¡ mice, which exhibit impaired autophagy in lungs and other organs,15-16,29-31 were used in this study. Instillation of PM at 100 mg/d/mouse24 for 2 d resulted in marked accumulations of total inflammatory cells and neutrophils in the bronchoalveolar lavage fluid (BALF), both of which were significantly decreased in the Becn1C/¡ (Fig. 3A and B) or lc3b¡/¡ mice (Fig. 4A and B) relative to their littermate controls. Inflammatory cytokines such as the mouse chemokine (CX-C motif) ligand 1 (CXCL1), CXCL2, and IL6 were also notably reduced in Becn1C/¡ mice in response to PM exposure (Fig. 3C to H). In lc3b¡/¡ mice, the PM-induced CXCL1 was markedly reduced (Fig. 4C and D), while surprisingly, IL6 and CXCL2 were not decreased (Fig. S3). Immunohistological analysis further confirmed that the PM-induced airway inflammation was significantly attenuated in Becn1 heterozygous (Fig. 3I and J) as well as in lc3b¡/¡ mice (Fig. 4E and F). Autophagy is essential for PM-induced mucus hyperproduction in vivo We next sought to confirm the effect of autophagy in regulation of PM-induced mucus production in vivo. Surprisingly, airways collected from the mice instilled with PM at 100 mg/d/mouse for 2 d displayed inappreciable mucus hyperproduction (data not shown). We then increased the period of PM exposure for 4 consecutive d, and in this case, mucus hyperproduction was evident in the small airways of wild-type littermates, as revealed by both periodic acidSchiff (PAS) staining (Fig. 5A and 6A) and immunohistochemistry analysis of MUC5AC (Fig. 5C and 6C). Consistent with the in vitro
AUTOPHAGY
299
Figure 1. PM triggers a typical convergence of endocytosis and autophagy in HBE cells. (A to C) TEM images showing the dynamic process of a typical convergence of endocytosis and autophagy in HBE cells stimulated with PM at 100 mg/ml for 24 h. PG, phagophore; AP, autophagosome; AL, autolysosome; AM, amphisome. (D) Representative TEM image of HBE cells treated with vehicle control or PM. AV, autophagic vacuole. (E) Semiquantified number of AVs in TEM images. The data were represented as AVs per 100 mm2 (n D 15 images for each group). , P < 0.05. (F) Representative images of the punctate staining of mRFP-GFP-LC3B in HBE cells treated with vehicle Control or PM. (G to I) Western blot analyses of the induction of LC3B by PM in HBE cells. Cells were treated with various concentrations of PM for 24 h (G), with 100 mg/ml PM for indicated time points (H), or with 100 mg/ml PM and Baf A1 (10 nM) for 24 h (I). Control, vehicle control.
findings (Fig. 2E and F), PM-induced hyperproduction of MUC5AC was also significantly attenuated in Becn1C/¡ (Fig. 5A to D) or lc3b¡/¡ mice (Fig. 6A to D). The mRNA levels of Muc5ac in the lungs exhibited a similar tendency, with a marked elevation in controls and an obvious reduction in Becn1C/¡ (Fig. 5E) or lc3b¡/¡ mice (Fig. 6E) in response to PM exposure. Lysosomal inhibition of the autophagic flux differentially regulates PM-induced production of IL8 and MUC5AC in HBE cells Generally, the autophagosomes or amphisomes fuse with lysosomes to form autolysosomes, where the engulfed components are degraded. To determine the effects of lysosomal
process on PM-induced inflammation and mucin expression, pharmacological and genetic approaches were used. As expected, Baf A1 treatment together with PM resulted in a dramatic accumulation of amphisomes (Fig. 7A), which was consistent with the enhanced expression of LC3B-II by western blot analysis (Fig. 1I). It should be noted that most of the autophagic vacuoles induced by PM in the presence of Baf A1 were amphisomes, clearly with engulfed black particulates therein (Fig. 7A), suggesting that autophagosomes readily fuse with the PM-containing endosomes. We next examined the effects of Baf A1 on PM-induced cytokines and mucin production. To our surprise, treatment with Baf A1 significantly augmented PM-induced mRNA expression of IL8 (Fig. 7B), whereas it markedly inhibited
300
Z. H. CHEN ET AL.
Figure 2. Autophagy mediates PM-induced inflammatory responses and mucus hyperproduction in HBE cells. Cells were transfected with Control-, ATG5-, or BECN1-siRNA for 24 h, and then were treated with PM (100 mg/ml) for an additional 24 h. The relative levels of IL8 (A), IL6 (C), and MUC5AC (E) mRNA transcripts were detected by quantitative PCR, and the protein levels of IL8 (B) and IL6 (D) in the culture supernatants were measured by ELISA. (F) Representative immunofluorescence images of MUC5AC in HBE cells, and (G) the mean relative fluorescence intensities were normalized to Control (nD10 images for each group). Data are presented as Mean § SEM of at least 3 independent experiments. , P < 0.05; , P < 0.01; , P < 0.001. Scale bar: 20 mm.
the expression of MUC5AC (Fig. 7C). We further confirmed such phenomena through a genetic approach by knockdown of LAMP2 (lysosomal-associated membrane protein 2), whose deficiency impairs the lysosomal function.32,33 Consistent with the effects of Baf A1, knockdown of LAMP2 also significantly exacerbated IL8 expression (Fig. 7D) and notably attenuated MUC5AC production (Fig. 7E) in
response to PM treatment in HBE cells. An additional siRNA was used to confirm the effects of LAMP2 on PMinduced expression of IL8 and MUC5AC (Fig. S4). All these findings suggested that lysosomal inhibition differentially regulated expression of IL8 and MUC5AC likely through different pathways. However, the expression of IL6 by lysosomal inhibition was more complicated, as Baf A1
AUTOPHAGY
301
Figure 3. Becn1C/¡ mice display decreased airway inflammation in response to PM exposure. Becn1 heterozygous and their wildtype littermates (n D 5 to 7 for each group) were instilled intratracheally with PM at 100 mg/d for 2 d, and after 24 h, the total inflammatory cells (A) and the number of neutrophils (B) in the BALF were measured. Expression of the mRNA levels of Cxcl1 (C), Cxcl2 (E) and Il6 (G) in lung tissue were analyzed by quantitative PCR. Protein levels of CXCL1 (D), CXCL2 (F), and IL6 (H) in the BALF were measured by ELISA. (I) Representative images of lung sections stained with H&E. (J) Semiquantified inflammation score of the H&E staining (n D 10 images for each group). Data are presented as Mean § SEM of 3 independent experiments. , P < 0.05; , P < 0.01.
302
Z. H. CHEN ET AL.
Figure 4. lc3b¡/¡ mice exhibit reduced airway inflammation in response to PM exposure. Mice (n D 5 to 7 for each group) were instilled intratracheally with PM at 100 mg/d for 2 d, and after 24 h, the total inflammatory cells (A) and the number of neutrophils (B) in the BALF were measured. Expression of the mRNA levels of Cxcl1 (C) in lung tissue were analyzed by quantitative PCR, and protein levels of CXCL1 (D) in the BALF were measured by ELISA. (E) Representative images of lung sections stained with H&E. (F) Semiquantified inflammation score of the H&E staining (n D 10 images for each group). Data are presented as Mean § SEM of 3 independent experiments. , P < 0.05; , P < 0.01; , P < 0.001.
decreased while LAMP2-siRNA increased its expression in HBE cells (Fig. S5A and B). Differential activation of the NFKB1 and AP-1 pathways by lysosomal inhibition differently mediates PM-induced expression of IL8 and MUC5AC in HBE cells The above intriguing results encouraged us to further explore the possible mechanisms mediating the distinct effects of lysosomal inhibition on PM-induced expression of IL8 and MUC5AC. As the transcription factors NFKB1 and AP-1 are well known to mediate inflammatory responses and mucus production in airway injury, we examined the roles of these factors in PM-induced airway epithelial damages. Interestingly,
inhibition of the NFKB1 pathway by CHUK (conserved helixloop-helix ubiquitous kinase) inhibitor VII or a genetic approach with RELA (v-rel avian reticuloendotheliosis viral oncogene homolog A)-siRNA significantly reduced the PMinduced expression of IL8 (Fig. 8A and C), while it exerted no considerable effect on the mRNA level of MUC5AC (Fig. 8B and D). On the contrary, inhibition of the AP-1 pathway by SP600125 or JUN-siRNA failed to affect the expression of IL8 (Fig. 8E and G), whereas it markedly attenuated the PMinduced production of MUC5AC (Fig. 8F and H). Additional siRNAs for RELA and JUN were used and they showed the same effects on PM-induced IL8 and MUC5AC (Fig. S6). These data suggested that the NFKB1 and AP-1 pathways distinctly regulated PM-induced expression of IL8 and MUC5AC in HBE
AUTOPHAGY
303
Figure 5. Becn1C/¡ mice are resistant to PM-induced mucus production in the airway. Mice (n D 5 to 8 for each group) were instilled intratracheally with PM at 100 mg/d for 4 days. (A) Representative images of lung sections with PAS staining. (B) Semiquantified PAS score. (C) Representative images of lung sections stained for MUC5AC. (D) Quantified percentage of MUC5AC positive cells in the epithelium. (E) The mRNA expression of Muc5ac in lung tissues. Data are presented as Mean § SEM of 3 independent experiments. , P < 0.05; , P < 0.01.
cells. We also observed that IL6 was effectively decreased by both RELA- and JUN-siRNA (Fig. S5C and D), suggesting this cytokine was regulated by both pathways. Since lysosomal inhibition upregulated IL8 and downregulated MUC5AC (Fig. 7B-E), and the NFKB1 and AP-1 pathways distinctly mediated their production, we next examined the roles of lysosomal signaling in regulation of these 2 pathways. Interestingly, in cells treated with LAMP2-siRNA, the basal level of RELA was significantly increased, while that of NFKBIA (nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, a) was notably decreased (Fig. 8I), suggesting that autophagosomes and autolysosomes might differentially regulated the protein degradation of NFKBIA and RELA. On the other hand,
LAMP2-siRNA markedly decreased the phosphorylation of JUN (Fig. 8J), suggesting that the lysosomal process was required for the activation of the AP-1 pathway.
Discussion In the present study, we clearly demonstrate that radical-containing ultrafine PM triggers a typical convergence of endocytosis and autophagy in airway epithelial cells, and that autophagy is essential for PM-induced inflammation and mucus hyperproduction through the NFKB1 and AP-1 pathways. We further clarify that the autophagosomes/amphisomes directly activate the NFKB pathway to produce IL8, while the lysosomal
304
Z. H. CHEN ET AL.
Figure 6. lc3b¡/¡ mice are protected from PM-induced mucus production in the airway. Mice (n D 5 to 8 for each group) were instilled intratracheally with PM at 100 mg/ d for 4 d. (A) Representative images of lung sections with PAS staining. (B) Semiquantified PAS score. (C) Representative images of lung sections stained for MUC5AC. (D) Quantified percentage of MUC5AC positive cells in the epithelium. (E) The mRNA expression of Muc5ac in lung tissues. Data are presented as Mean § SEM of 3 independent experiments. , P < 0.05; , P < 0.01; , P < 0.001.
process is required for activation of the AP-1 pathway and its subsequent induction of MUC5AC (Fig. 9). Certain cytokines such as IL6 are regulated by both pathways, and thus blockade of autophagy effectively reduces, while lysosomal inhibition by different approaches exerts complex effects on, IL6 expression. A growing body of literature suggests that autophagy and lysosomal dysfunction are critical for nanomaterial toxicity (reviewed in ref. 18). The sizes of nanomaterials are generally less than 100 nm, which are readily to be phagocytosed into various cells, while little is known about the cellular fate of larger sized PM. Recently, airborne PM2.5 has been reported to induce autophagy in human lung A549 cells,21,22 however, there is little evidence showing whether the PM could be endocytosed and sequestered by autophagosomes. In the present
study, we have clearly observed that larger sized particles between 0.1 to 0.5 mm (Fig. 1B to D) were able to be endocytosed and subsequently fuse with autophagosomes to form typical amphisomes. The sizes of autophagosomes are usually 0.5 to 1.5 mm,34 making it possible to arrest larger sized PM. The roles of autophagy in airway epithelial damages in various lung diseases remain either deleterious or cytoprotective, most likely depending on the different stimuli or pathogens.11,12,35 For example, in hyperoxia-induced airway epithelial damage, LC3B-siRNA promotes hyperoxia-induced cell death, whereas overexpression of LC3B confers cytoprotection.36 However, various kinds of nanoparticles trigger autophagic cell death, and the autophagy inhibitor 3-methyladenine rescues the nanoparticle-induced epithelial cell death and
AUTOPHAGY
305
Figure 7. Autophagic flux differentially modulates PM-induced expression of IL8 and MUC5AC in HBE cells. (A to C) Cells were treated with PM (100 mg/ml) with or without Baf A1 (10 nM) for 24 h, and were analyzed for the atuophagic vesicles by TEM (A), or were measured for the mRNA levels of IL8 (B) or MUC5AC (C). (D and E) Cells were transfected with Control- or LAMP2-siRNA for 24 h, and then were treated with PM (100 mg/ml) for an additional 24 h to examine the mRNA levels of IL8 (D) or MUC5AC (E). Data are presented as Mean § SEM of 3 independent experiments. , P < 0.05.
ameliorates the acute lung injury in mice.37,38 H5N1 infection also induces autophagic cell death in lung epithelial cells, and blocking autophagy not only reduces the epithelial cell death,39,40 decreases the production of proinflammatory cytokines and chemokines,40 but also ameliorates H5N1-induced acute lung injury and mortality.41 Our present results were consistent with the latter studies demonstrating that autophagy was deleterious in PM-induced epithelial damages and airway injury. Autophagy inhibition effectively resulted in attenuated cytokine production in HBE cells and ameliorative inflammation in mouse lungs. Thus, targeting autophagy inhibition in airway epithelial cells might be effective not only for
COPD,13-17 flu virus infection,39-41 nanomaterial toxicity,18,37,38 but also for environmental PM-induced airway inflammation and exacerbation of various chronic lung diseases. Mucus hyperproduction is another important feature of chronic airway diseases. A couple of studies have investigated the role of PM in mucus production. For example, Val et al. report that fine PM induces MUC5AC expression in HBE cells and in mouse trachea, through the autocrine effect of amphiregulin.42 Another study observes that PM induces mucin secretion in HBE cells through calcium influx and the cyclic adenosine monophosphate-protein kinase A pathway.43 Our current data clearly demonstrated that autophagy was essential
306
Z. H. CHEN ET AL.
Figure 8. The NFKB1 and AP-1 pathways differentially mediate PM-induced expression of IL8 and MUC5AC. Cells were treated with CHUK inhibitor VII (A and B) or AP-1 inhibitor SP600125 (E and F) together with PM (100mg/ml) for 24 h, or treated with RELA- (C and D) or JUN-siRNA (G and H) for 24 h, and then with PM (100 mg/ml) for an additional 24 h. The mRNA expression of IL8 (A, C, E, and G) and MUC5AC (B, D, F, and H) were measured. Data are presented as Mean § SEM. , P < 0.05; , P < 0.001; n.s., not significant. (E and F) Cells were treated with indicated Control- or LAMP2-siRNA for 48 h, and then with PM (100 mg/ml) for an additional 12 h. The protein levels of RELA, NFKBIA (E) or p-JUN (F) were examined by western blot. Images are representative of 3 independent experiments.
AUTOPHAGY
Figure 9. Schematic representation of the mechanisms of PM-induced autophagic flux in the differential regulation of subsequent inflammation and mucus hyperproduction in airway epithelium. Ultrafine PM can be endocytosed into HBE cells and triggers autophagy. The PM-containing endosomes fuse with autophagomes to form amphisomes, and the further fusion of amphisomes with lysosomes generates autolysosomes. PM-induced autophagosomes and amphisomes directly activate the NFKB1 pathway to produce IL8, while autolysosomes are required for AP1 activation to produce MUC5AC. Certain cytokines such as IL6 are regulated by both pathways.
for PM-induced mucus hyperproduction in HBE cells and in mouse lungs. Furthermore, the effect of autophagy on mucus production appeared to be independent of the autophagy-regulated inflammation, as inhibition of the autophagic flux significantly decreased the mucus production but increased the IL8 expression. In fact, we have recently found that autophagy mediated cigarette smoke-induced mucus production via the AP-1 pathway in the context of COPD pathogenesis (paper in submission), which is in complete agreement with the current results. It should be noted that the PM-induced activation of the NFKB1 and AP-1 pathways in HBE cells were differentially regulated by the autophagic flux. In general, both these pathways are redox sensitive and are important for the cellular inflammatory responses. Our current results clearly demonstrate that lysosomal inhibition significantly activated the NFKB signaling while markedly attenuated the AP-1 pathway, suggesting that the accumulation of autophagosomes and amphisosomes led to activation of NFKB1, while the lysosomal degradation process was required for AP-1 activation. To the best of our knowledge, this is the first time that such differential regulation of these 2 pathways has been shown in the same paradigm. The detailed mechanisms of how autophagic flux regulates PM-induced activation of these 2 pathways remain unclear. Numerous studies have investigated the crosstalk between autophagy and NFKB1 signaling, while little is known about the relationship between autophagy and AP-1. However, even within the literature on autophagy and NFKB1, only a few of them focus on how autophagy
307
modulates NFKB1 signaling factors, whereas most address the contrary regulation. Nonetheless, the effects of autophagic flux in regulation of NFKB1 activities are complex, and the molecular mechanisms are extremely complicated, and likely vary depending on cell types and stimuli. NFKBIA, RELA, as well as other NFKB1-related molecules, can all be targets for degradation by autophagosomes or autolysosomes, resulting in completely different outcomes. For example, in a macrophage cell differentiation model, knockdown of ATG5 or treatment with Baf A1 could prevent RELA degradation and induce M2 macrophages to produce a high level of proinflammatory cytokines.44 On the contrary, Criollo et al. have observed that the depletion of essential autophagy modulators, including ATG5, ATG7, BECN1, and PIK3C3 (phosphatidylinositol 3-kinase, catalytic subunit type 3), by RNA interference inhibits TNFdriven NFKB1 activation in 2 human cancer cell lines.45 Similarly, in mice lacking ATG4B, mechanical ventilation induced less autophagy, resulting in the accumulation of SQSTM1 (sequestosome 1) and ubiquitinated NFKBIA, and less NFKB1 activation.46 In intestinal epithelial cells, TNF stimulates formation of autophagosomes and NFKBIA colocalizes with autophagosomal vesicles, and pharmacological or genetic blockade of autophagosome formation or lysosomal inhibition decreases TNF-induced degradation of NFKBIA and lowers NFKB1 target gene expression.47 However, in LAMP2-deficient cells, the levels of NFKBIA were significantly decreased, which should theoretically result in an increased NFKB1 activity.47 Our current data are only partially consistent with these studies, showing that blockade of autophagy attenuated both NFKB1 and AP-1 pathways, while lysosomal inhibition resulted in differential outcomes. In conclusion, we show here for the first time that ultrafine PM (around 0.1 to 0.5 mm) can be endocytosed and triggers a typical convergence of endocytosis and autophagy in airway epithelial cells. We further demonstrate that autophagy is essential for PM-induced activation of NFKB1 and AP-1, and subsequent airway inflammation and mucus hyperproduction. In addition, we observe that the autophagic flux differentially modulates the NFKB1 and AP-1 activities, and the consequent outcomes. Nonetheless, inhibiting autophagy could be an effective therapeutic approach for airway disorders or disease exacerbations induced by airborne particulate pollution.
Materials and methods Cell culture HBE cells were purchased from American Type Culture Collection (CRL-2741), and were maintained in RPMI 1640 with 10% FBS, 50 U/ml penicillin, and 50 U/ml streptomycin. Reagents The initial set of siRNAs of Control(sc-37007), ATG5(sc41445), BECN1(sc-29797), RELA (sc-29410), LAMP2 (sc29390), JUN (sc-29223) were purchased from Santa Cruz
308
Z. H. CHEN ET AL.
Biotechnology. An additional set of siRNAs of RELA, LAMP2, and JUN were designed and synthesized by Shanghai GenePharma for verifying the effects (see supplementary Reagents). The siRNA transfection reagent (SL100568) and the PloyJet in vitro DNA Transfection reagent (SL100688) were purchased from SignaGen Laboratories. Antibodies against ACTB (Santa Cruz Biotechnology, sc-47778), LC3B (Sigma-Aldrich, L7543), RELA (Cell Signaling Technology, 8242), NFKBIA (Cell Signaling Technology, 4812), p-JUN (Cell Signaling Technology, 3270), and MUC5AC (Abcam, ab24071) were used. All of these antibodies were diluted at 1:1000 in 5% nonfat dried milk, except for the LC3B and ACTB which were diluted at 1:2000. All primers used in the study were synthesized by Sangon Biotech, Shanghai. ELISA kits for human IL8 (D8000C), human IL6 (D6050), mouse CXCL1 (MKC00B), mouse CXCL2 (MM200), mouse IL6 (M6000B) were purchased from R&D systems. IKK inhibitor VII was purchased from Calbiochem (401486), and its final concentration in culture medium was 1 mg/ml. Baf A1 (B1793) and SP600125 (S5567) were from Sigma-Aldrich, and the final concentrations in the culture medium were 10 nM and 10 mM respectively.
The siRNA transfection was performed with the transfection reagent following the manufacturer’s protocol. Briefly, 5 £ 104 cells were placed in each well of 6-well plates for 18 h prior to transfection. The siRNA in 1 ml growth medium were incubated with HBE cells for 5 h. The infection medium was removed and replaced with fresh growth medium. The mRFPGFP-LC3B plasmid was transfected into cells by using PloyJet in vitro DNA Transfection reagent. 1 £ 106 cells were seeded to a 6 cm dish 24 h before mRFP-GFP-LC3 plasmid transfection. The infection medium was replaced with fresh growth medium after being incubated with HBE cells for 8 h. Confocal images were viewed using a Zeiss LSM confocal laser scanning microscope (Carl Zeiss, G€ottingen, Germany).
Animals
RNA isolation and quantitative real-time PCR analysis
C/¡
Becn1 mice were kindly provided by Dr. Beth Levine, University of Texas Southwestern Medical Center. lc3b¡/¡ mice were from Jackson Laboratory. All mice were maintained in a specific pathogen-free facility. All experimental protocols were approved by the Ethical Committee for Animal Studies at Zhejiang University. In vivo and in vitro PM exposure PM was produced as previously described,23-25 which was tested negative for lipooligosaccharide contamination, and was vacuum-packed in ampoules. In vivo, PM was suspended and sonicated in sterile saline to a final concentration at 2 mg/ml. To establish a mouse model of acute airway inflammation, mice were treated with 100 mg PM (in 50 ml saline) per day by intratracheal instillation for 2 d. The period of PM exposure
was increased for consecutive 4 d for studying the mucus hyperproduction. Control mice received the same volume of saline. In vitro, PM was suspended and sonicated in sterile saline to a final concentration at 1 mg/ml, and HBE cells were treated with PM at 100 mg/ml. Transfection
RNA from cells and lung homogenates was isolated using Trizol (Invitrogen, 15596 026). Reverse transcription was performed with Reverse Transcription Reagents (Takara Biotechnology, DRR037A). The expression of human IL8, IL6, and MUC5AC, and mouse Cxcl1, Cxcl2, Il6, and Muc5ac were measured by quantitative real-time PCR using SYBR Green Master Mix (Takara Biotechnology, DRR041A) on a StepOne real-time PCR system (Applied Biosystems, Foster City, CA). All protocols were performed according to the manufacturer’s instructions. The primers used in the present study are listed in Table 1. Western blot assay After treatment with PM, HBE cells were lysed in RIPA buffer (Beyotime, P0013B) containing protease (Roche Diagnostics
Table 1. Primers used for quantitative real time PCR analysis. Species Human Human Human Human Mouse Mouse Mouse Mouse Mouse
Genes ACTB Reverse: CTCCTTAATGTCACGCACGAT IL8 Reverse: AACCCTCTGCACCCAGTTTTC IL6 Reverse: CCATCTTTGGAAGGTTCAGGTTG MUC5AC Reverse: GCGCACAGAGGATGACAGT Actb Reverse: CCAGTTGGTAACAATGCCATGT Cxcl1 Reverse: CAGGGTCAAGGCAAGCCTC Cxcl2 Reverse: CTCAGACAGCGAGGCACATC Il6 Reverse: AGTGGTATAGACAGGTCTGTTGG Muc5ac Reverse: AAGGGGTATAGCTGGCCTGA
Primer sequence (50 –30 ) Forward: CATGTACGTTGCTATCCAGGC Forward: ACTGAGAGTGATTGAGAGTGGAC Forward: ACTCACCTCTTCAGAACGAATTG Forward: CAGCACAACCCCTGTTTCAAA Forward: GGCTGTATTCCCCTCCATCG Forward: CTGGGATTCACCTCAAGAACATC Forward: TGTCCCTCAACGGAAGAACC Forward: CTGCAAGAGACTTCCATCCAG Forward: CTGTGACATTATCCCATAAGCCC
AUTOPHAGY
GmbH, 04-693-116-001) and phosphatase inhibitors (Roche Diagnostics GmbH, 04-906-837-001). Lysates were run on gels and immunoblotted with relevant antibodies using standard methods. ACTB served as a protein loading control.
309
slides. Cells were stained with Wright–Giemsa stain (Baso, BA4017), and differential counts were determined by counting 200 total cells. Histological analyses
Immunofluorescence staining HBE cells were seeded on cleaned and autoclaved glass coverslips. After exposure to PMs, the cells were washed with phosphate-buffered saline (PBS; Biotopped, 150814), and then fixed in 4% formaldehyde solution. Subsequently, the cells were treated with 0.1% Triton-X-100 (Sigma-Aldrich, LC262801) in PBS for permeabilization and blocked with 5% BSA (SigmaAldrich, B2064) followed by washing with PBS. Anti-MUC5AC was used at 1:200 dilution overnight at 4 C. After washing the cells with PBS, Alexa Fluor® 488 goat anti-mouse IgG (HCL) antibody (Invitrogen, A11001) solution was added and incubated for 1 h at RT, and washed again, allowed to air dry completely and cells mounted on slides in a drop of Vectashield plus DAPI mounting medium (Life Technologies, P36935). Fluorescent images were captured with a Zeiss LSM laser scanning confocal microscope. The relative fluorescence intensity was measured with Image-Pro Plus 6.0 (Media Cybernetics, Silver Spring, MD, USA), and the mean relative fluorescence intensities were normalized to the levels of control. ELISA The concentration of IL8 and IL6 in culture supernatants and concentration of CXCL1, CXCL2 and IL6 in BALF supernatants were determined with ELISA kits following the manufacturer’s protocol.
After treatment with PM, the lungs were collected and fixed in formalin for 24 h. Then these collected lungs were embedded in paraffin and were stained with hematoxylin and eosin (H&E) or PAS following standard protocols.48-49 Inflammation was assessed according to published guidelines,48 and PASstained goblet cells in airway epithelium were scored as described previously.49 Immunohistochemistry Sections of lung tissues were immunostained with antiMUC5AC according to the manufacturer’s instructions. Images were scanned with an Olympus BX53 inverted microscope (Olympus, Melville, NY). Image quantitative analysis was performed as previously described.50 MUC5AC positive bronchial epithelial cells were presented as a percentage of total epithelial cells. Statistics Results are presented as means § SEM. Data were analyzed with GraphPad Prism 5.01 (GraphPad software, San Diego, CA USA). Differences between 2 groups were identified using the Student t test. A value of P less than 0.05 was considered to be statistically significant.
Abbreviations Transmission electron microscopy For transmission electron microscopy (TEM) analysis, HBE cells were fixed in 2.5% glutaradehyde in PBS for 24 h after experimental manipulations. These cells were washed in PBS, postfixed in 1% osmium tetroxide, and stained with 4% uranyl acetate. The samples were embedded in embedding medium after being dehydrated. Ultrathin sections were stained with uranyl acetate and lead citrate. Images were taken using a TECNA1 10 transmission electron microscope (FEI, Hillsboro, Oregon, USA) at 80 kv. In order to quantify the alteration of the number of the autophagic vacuoles (AVs), the area of the cell cytoplasm was measured by using Image-Pro Plus 6.0. The data were represented as AVs per 100 mm2.
ACTB AP-1 AVs BECN1 Baf A1 BALF CXCL COPD HBE H&E IL LAMP2 MAP1LC3B/LC3B MUC5AC NFKB1 NFKBIA
BALF collection and analysis Twenty-four h after the last exposure to PM, BALF was obtained utilizing 3 instillations, of each was performed with 0.4 ml PBS injected into the lungs, and with drawn to collect the cells. The total number of BALF cells was counted, and then the remaining BALF was centrifuged at 400 g for 10min at 4 C. The supernatant was stored at ¡80 C and used for analysis of cytokines. The cell pellet was suspended in 200 ml PBS, and 10 ml of the suspension was spun onto glass microscope
PAS PM RELA TEM TNF
actin, b; ATG, autophagy-related activator protein 1 autophagic vacuoles Beclin 1, autophagy related bafilomycin A1 bronchoalveolar lavage fluid chemokine (C-X-C motif) ligand chronic obstructive pulmonary disease human bronchial epithelial hematoxylin and eosin interleukin lysosomal-associated membrane protein 2 microtubule-associated protein 1 light chain 3 b mucin 5AC, oligomeric mucus/gel-forming nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, a periodic acid-Schiff particulate matter v-rel avian reticuloendotheliosis viral oncogene homolog A transmission electronic microscopy tumor necrosis factor
Disclosure of potential conflicts of interest There were no potential conflicts of interest to be disclosed.
310
Z. H. CHEN ET AL.
Funding This work was supported by the Key Project of Chinese National Programs for Fundamental Research and Development (973 program, 2015CB553405), the General Projects (31170859 and 81370142 to Z.H.C.) and the Young Investigator Project (81200021 to P.L.W.) from the National Natural Science Foundation of China, the Distinguished Young Investigator Award (LR14H010001 to P.L.W.) from Natural Science Foundation of Zhejiang Province, the Key Science-Technology Innovation Team of Zhejiang Province (2011R50016), and the project from the National Clinical Research Center of China for Respiratory Disease.
References 1. Gehring U, Gruzieva O, Agius RM, Beelen R, Custovic A, Cyrys J, Eeftens M, Flexeder C, Fuertes E, Heinrich J, et al. Air pollution exposure and lung function in children: the ESCAPE project. Environ Health Perspect 2013; 121:1357-64; PMID:24076757 2. Karakatsani A, Analitis A, Perifanou D, Ayres JG, Harrison RM, Kotronarou A, Kavouras IG, Pekkanen J, H€ameri K, Kos GP, et al. Particulate matter air pollution and respiratory symptoms in individuals having either asthma or chronic obstructive pulmonary disease: a European multicentre panel study. Environ Health 2012; 11:75; PMID:23039312; http://dx.doi.org/10.1186/1476-069X-11-75 3. Gan WQ, FitzGerald JM, Carlsten C, Sadatsafavi M, Brauer M. Associations of ambient air pollution with chronic obstructive pulmonary disease hospitalization and mortality. Am J Respir Crit Care Med 2013; 187:721-7; PMID:23392442; http://dx.doi.org/10.1164/ rccm.201211-2004OC 4. Raaschou-Nielsen O, Andersen ZJ, Beelen R, Samoli E, Stafoggia M, Weinmayr G, Hoffmann B, Fischer P, Nieuwenhuijsen MJ, Brunekreef B, et al. Air pollution and lung cancer incidence in 17 European cohorts: prospective analyses from the European Study of Cohorts for Air Pollution Effects (ESCAPE). Lancet Oncol 2013; 14:813-22; PMID:23849838; http://dx.doi.org/10.1016/S14702045(13)70279-1 5. Choi AM, Ryter SW, Levine B. Autophagy in human health and disease. N Engl J Med 2013; 368:651-62; PMID:23406030; http://dx.doi. org/10.1056/NEJMra1205406 6. Levine B, Kroemer G. Autophagy in the pathogenesis of disease. Cell 2008; 132:27-42; PMID:18191218; http://dx.doi.org/10.1016/j. cell.2007.12.018 7. He C, Klionsky DJ. Regulation mechanisms and signaling pathways of autophagy. Annu Rev Genet 2009; 43:67-93; PMID:19653858; http:// dx.doi.org/10.1146/annurev-genet-102808-114910 8. Klionsky DJ, Abdalla FC, Abeliovich H, Abraham RT, Acevedo-Arozena A, Adeli K, Agholme L, Agnello M, Agostinis P, Aguirre-Ghiso JA, et al. Guidelines for the use and interpretation of assays for monitoring autophagy. Autophagy 2012; 8:445-544; PMID:22966490; http://dx.doi.org/10.4161/auto.19496 9. Klionsky DJ, Eskelinen EL, Deretic V. Autophagosomes, phagosomes, autolysosomes, phagolysosomes, autophagolysosomes… wait, I’m confused. Autophagy 2014; 10:549-51; PMID:24657946; http://dx.doi. org/10.4161/auto.28448 10. Gordon PB, Seglen PO. Prelysosomal convergence of autophagic and endocytic pathways. Biochem Biophys Res Commun 1988; 151:40-47; PMID:3126737; http://dx.doi.org/10.1016/0006-291X(88)90556-6 11. Ryter SW, Nakahira K, Haspel JA, Choi AM. Autophagy in pulmonary diseases. Annu Rev Physiol 2012; 74:377-401; PMID:22035347; http://dx.doi.org/10.1146/annurev-physiol-020911-153348 12. Patel AS, Morse D, Choi AM. Regulation and Functional Significance of Autophagy in Respiratory Cell Biology and Disease. Am J Respir Cell Mol Biol 2013; 48:1-9; PMID:22984088; http://dx.doi.org/ 10.1165/rcmb.2012-0282TR 13. Chen ZH, Kim HP, Sciurba FC, Lee SJ, Feghali-Bostwick C, Stolz DB, Dhir R, Landreneau RJ, Schuchert MJ, Yousem SA, et al. Egr-1 regulates autophagy in cigarette smoke-induced chronic obstructive pulmonary disease. PLoS One 2008; 3:e3316; PMID:18830406; http://dx. doi.org/10.1371/journal.pone.0003316
14. Kim HP, Wang X, Chen ZH, Lee SJ, Huang MH, Wang Y, Ryter SW, Choi AM. Autophagic proteins regulate cigarette smoke-induced apoptosis: protective role of heme oxygenase-1. Autophagy. 2008 Oct; 4 (7):887-95; http://dx.doi.org/10.4161/auto.6767 15. Chen ZH, Lam HC, Jin Y, Kim HP, Cao J, Lee SJ, Ifedigbo E, Parameswaran H, Ryter SW, Choi AM. Autophagy protein microtubule-associated protein 1 light chain-3B (LC3B) activates extrinsic apoptosis during cigarette smoke-induced emphysema. Proc Natl Acad Sci USA 2010; 107:18880-5; PMID:20956295; http://dx.doi.org/10.1073/ pnas.1005574107 16. Lam HC, Cloonan SM, Bhashyam AR, Haspel JA, Singh A, Sathirapongsasuti JF, Cervo M, Yao H, Chung AL, Mizumura K, et al. Histone deacetylase 6-mediated selective autophagy regulates COPDassociated cilia dysfunction. J Clin Invest 2013; 123:5212-30; PMID:24200693; http://dx.doi.org/10.1172/JCI69636 17. Cloonan SM, Lam HC, Ryter SW, Choi AM. “Ciliophagy”: The consumption of cilia components by autophagy. Autophagy 2014; 10:5324; PMID:24401596; http://dx.doi.org/10.4161/auto.27641 18. Stern ST, Adiseshaiah PP, Crist RM. Autophagy and lysosomal dysfunction as emerging mechanisms of nanomaterial toxicity. Part Fibre Toxicol 2012; 9:20; PMID:22697169; http://dx.doi.org/10.1186/1743-8977-9-20 19. Zabirnyk O, Yezhelyev M, Seleverstov O. Nanoparticles as a novel class of autophagy activators. Autophagy 2007; 3:278-81; PMID:17351332; http://dx.doi.org/10.4161/auto.3916 20. Khan MI, Mohammad A, Patil G, Naqvi SA, Chauhan LK, Ahmad I. Induction of ROS, mitochondrial damage and autophagy in lung epithelial cancer cells by iron oxide nanoparticles. Biomaterials 2012; 33:1477-88; PMID:22098780; http://dx.doi.org/10.1016/j. biomaterials.2011.10.080 21. Deng X, Zhang F, Wang L, Rui W, Long F, Zhao Y, Chen D, Ding W. Airborne fine particulate matter induces multiple cell death pathways in human lung epithelial cells. Apoptosis 2014; 19:1099-112; PMID:24722831; http://dx.doi.org/10.1007/s10495-014-0980-5 22. Deng X, Zhang F, Rui W, Long F, Wang L, Feng Z, Chen D, Ding W. PM2.5-induced oxidative stress triggers autophagy in human lung epithelial A549 cells. Toxicol In Vitro 2013; 27:1762-70; PMID:23685237; http://dx.doi.org/10.1016/j.tiv.2013.05.004 23. Lomnicki S, Truong H, Vejerano E, Dellinger B. Copper oxide-based model of persistent free radical formation on combustion-derived particulate matter. Environ Sci Technol 2008; 42:4982-8; PMID:18678037; http://dx.doi.org/10.1021/es071708h 24. Wang P, You D, Saravia J, Shen H, Cormier SA. Maternal exposure to combustion generated PM inhibits pulmonary Th1 maturation and concomitantly enhances postnatal asthma development in offspring. Part Fibre Toxicol. 2013; 10:29; PMID:23856009; http://dx.doi.org/ 10.1186/1743-8977-10-29 25. Balakrishna, S. Lomnicki S, McAvey KM, Cole RB, Dellinger B, Cormier SA. Environmentally persistent free radicals amplify ultrafine particle mediated cellular oxidative stress and cytotoxicity. Part. Fibre. Toxicol. 2009; 6:11 26. Hogg JC, Timens W. The pathology of chronic obstructive pulmonary disease. Annu Rev Pathol 2009; 4:435-59; PMID:18954287; http://dx. doi.org/10.1146/annurev.pathol.4.110807.092145 27. Hogg JC, Chu F, Utokaparch S, Woods R, Elliott WM, Buzatu L, Cherniack RM, Rogers RM, Sciurba FC, Coxson HO, Pare PD. The nature of small-airway obstruction in chronic obstructive pulmonary disease. N Engl J Med 2004; 350:2645-53; PMID:15215480; http://dx. doi.org/10.1056/NEJMoa032158 28. Fahy JV. Dickey BF. Airway Mucus Function and Dysfunction. N Engl J Med 2010; 363:2233-47; PMID:21121836; http://dx.doi.org/10.1056/ NEJMra0910061 29. Nakahira K, Haspel JA, Rathinam VA, Lee SJ, Dolinay T, Lam HC, Englert JA, Rabinovitch M, Cernadas M, Kim HP, et al. Autophagy proteins regulate innate immune responses by inhibiting the release of mitochondrial DNA mediated by the NALP3 inflammasome. Nat Immunol 2011; 12:222-30; PMID:21151103; http://dx.doi.org/ 10.1038/ni.1980 30. Lee S, Lee SJ, Coronata AA, Fredenburgh LE, Chung SW, Perrella MA, Nakahira K, Ryter SW, Choi AM. Carbon monoxide confers protection in sepsis by enhancing beclin 1-dependent autophagy and
AUTOPHAGY
31.
32.
33.
34. 35.
36.
37.
38.
39.
40.
phagocytosis. Antioxid Redox Signal 2014; 20:432-42; PMID:23971531; http://dx.doi.org/10.1089/ars.2013.5368 Lee SJ, Kim HP, Jin Y, Choi AM, Ryter SW. Beclin 1 deficiency is associated with increased hypoxia-induced angiogenesis. Autophagy 2011; 7:829-39; PMID:21685724; http://dx.doi.org/10.4161/auto.7.8.15598 Bandyopadhyay U, Kaushik S, Varticovski L, Cuervo AM. The chaperone-mediated autophagy receptor organizes in dynamic protein complexes at the lysosomal membrane. Mol Cell Biol 2008; 28:5747-63; PMID:18644871; http://dx.doi.org/10.1128/ MCB.02070-07 Fortunato F, B€ urgers H, Bergmann F, Rieger P, B€ uchler MW, Kroemer G, Werner J. Impaired autolysosome formation correlates with Lamp2 depletion: role of apoptosis, autophagy, and necrosis in pancreatitis. Gastroenterology 2009; 137:350-60, 360.e1-5; PMID:19362087; http:// dx.doi.org/10.1053/j.gastro.2009.04.003 Mizushima N, Ohsumi Y, Yoshimori T. Autophagosome formation in mammalian cells. Cell Struct. Funct 2002; 27:421-9 Hu Y, Liu J, Wu YF, Lou J, Mao YY, Shen HH, Chen ZH. mTOR and autophagy in regulation of acute lung injury: a review and perspective. Microbes Infect 2014; 16:727-34; PMID:25084494; http://dx.doi.org/ 10.1016/j.micinf.2014.07.005 Lee SJ, Smith A, Guo L, Alastalo TP, Li M, Sawada H, Liu X, Chen ZH, Ifedigbo E, Jin Y, et al. Autophagic protein LC3B confers resistance against hypoxia-induced pulmonary hypertension. Am J Respir Crit Care Med 2011; 183:649-58; PMID:20889906; http://dx.doi.org/ 10.1164/rccm.201005-0746OC Li C, Liu H, Sun Y, Wang H, Guo F, Rao S, Deng J, Zhang Y, Miao Y, Guo C, et al. PAMAM nanoparticles promote acute lung injury by inducing autophagic cell death through the Akt-TSC2-mTOR signaling pathway. J Mol Cell Biol 2009; 1:37-45; PMID:19516051; http:// dx.doi.org/10.1093/jmcb/mjp002 Liu HL, Zhang YL, Yang N, Zhang YX, Liu XQ, Li CG, Zhao Y, Wang YG, Zhang GG, Yang P, et al. A functionalized singlewalled carbon nanotube-induced autophagic cell death in human lung cells through Akt-TSC2-mTOR signaling. Cell Death Dis 2011; 2:e159; PMID:21593791; http://dx.doi.org/10.1038/ cddis.2011.27 Ma J, Sun Q, Mi R, Zhang H. Avian influenza A virus H5N1 causes autophagy-mediated cell death through suppression of mTOR signaling. J Genet Genomics 2011; 38:533-7; PMID:22133684; http://dx.doi. org/10.1016/j.jgg.2011.10.002 Sun Y, Li C, Shu Y, Ju X, Zou Z, Wang H, Rao S, Guo F, Liu H, Nan W, et al. Inhibition of autophagy ameliorates acute lung injury caused by avian influenza A H5N1 infection. Sci Signal 2012; 5:ra16; PMID:22355189; http://dx.doi.org/10.1126/scisignal.2001931
311
41. Pan H, Zhang Y, Luo Z, Li P, Liu L, Wang C, Wang H, Li H, Ma Y. Autophagy mediates avian influenza H5N1 pseudotyped particleinduced lung inflammation through NF-kappaB and p38 MAPK signaling pathways. Am J Physiol Lung Cell Mol Physiol 2014; 306:18395; http://dx.doi.org/10.1152/ajplung.00147.2013 42. Val S, Belade E, George I, Boczkowski J, Baeza-Squiban A. Fine PM induce airway MUC5AC expression through the autocrine effect of amphiregulin. Arch Toxicol 2012; 86:1851-9; PMID:22820758; http:// dx.doi.org/10.1007/s00204-012-0903-6 43. Yu H, Li Q, Kolosov VP, Perelman JM, Zhou X. Regulation of particulate matter-induced mucin secretion by transient receptor potential vanilloid 1 receptors. Inflammation 2012; 35:1851-9; PMID:22829138; http://dx.doi.org/10.1007/s10753-012-9506-x 44. Chang CP, Su YC, Hu CW, Lei HY. TLR2-dependent selective autophagy regulates NF-kB lysosomal degradation in hepatomaderived M2 macrophage differentiation. Cell Death Differ. 2013; 20:515-23; PMID:23175187; http://dx.doi.org/10.1038/cdd.2012.146 45. Criollo A, Chereau F, Malik SA, Niso-Santano M, Mari~ no G, Galluzzi L, Maiuri MC, Baud V, Kroemer G. Autophagy is required for the activation of NFkB. Cell Cycle 2012; 11:194-9; PMID:22186785; http://dx.doi.org/10.4161/cc.11.1.18669 Amado46. L opez-Alonso I, Aguirre A, Gonzalez-L opez A, Fernandez AF, Rodrıguez L, Astudillo A, Batalla-Solıs E, Albaiceta GM. Impairment of autophagy decreases ventilator-induced lung injury by blockade of the NF-kB pathway. Am J Physiol Lung Cell Mol Physiol 2013; 304:L844852; PMID:Can’t; http://dx.doi.org/10.1152/ajplung.00422.2012 47. Colleran A, Ryan A, O’Gorman A, Mureau C, Liptrot C, Dockery P, Fearnhead H, Egan LJ. Autophagosomal IkappaB alpha degradation plays a role in the long term control of tumor necrosis factor-alpha-induced nuclear factor-kappaB (NF-kappaB) activity. J Biol Chem 2011; 286:22886-93; PMID:21454695; http://dx.doi.org/10.1074/jbc.M110.199950 48. Lee KS, Lee HK, Hayflick JS, Lee YC, Puri KD. Inhibition of phosphoinositide 3-kinase delta attenuates allergic airway inflammation and hyperresponsiveness in murine asthma model. FASEB J 2006; 20:45565; PMID:16507763; http://dx.doi.org/10.1096/fj.05-5045com 49. McMillan SJ, Bishop B, Townsend MJ, McKenzie AN, Lloyd CM. The absence of interleukin 9 does not affect the development of allergeninduced pulmonary inflammation nor airway hyperreactivity. J Exp Med 2002; 195:51-7; PMID:11781365; http://dx.doi.org/10.1084/ jem.20011732 50. Xanthou, G. Alissafi T, Semitekolou M, Simoes DC, Economidou E, Gaga M, Lambrecht BN, Lloyd CM, Panoutsakopoulou V. Osteopontin has a crucial role in allergic airway disease through regulation of dendritic cell subsets. Nat Med 2007; 13:570-8; PMID:17435770; http://dx.doi.org/10.1038/nm1580
