J. Mol. Biol. (1990) 216, 911-926

Bacteriophage T7 D N A Packaging I. Plasmids Containing a T7 Replication Origin and the T7 Concatemer Junction are Packaged into Transducing Particles During Phage Infection Yeon-Bo Chungt and David C. Hinkle:~ Department of Biology, University of Rochester Rochester, N Y 14627, U.S.A. (Received 14 December 1989; accepted 13 August 1990) Bacteriophage T7 DNA is a linear duplex molecule with a 160 base-pair direct repeat (terminal redundancy) at its ends. During replication, large DNA concatemers are formed, which are multimers of the T7 genome linked head to tail through recombination at the terminal redundancy. We define the sequence that results from this recombination, a mature right end joined to the left end of T7 DNA, as the concatemer junction. To study the processing and packaging of T7 concatemers into phage particles, we have cloned the T7 concatemer junction into a plasmid vector. This plasmid is efficiently (at least 15 particles/ infected cell) packaged into transducing particles during a T7 infection. These transducing particles can be separated from T7 phage by sedimentation to equilibrium in CsCI. The packaged plasmid DNA is a linear concatemer of about 40 x 103 base-pairs with ends at the expected T7 DNA sequences. Thus, the T7 coneatemer junction sequence on the plasid is recognized for processing and packaging by the phage system. We have identified a T7 DNA replication origin near the right end of the T7 genome that is necessary for efficient plasmid packaging. The origin, which is associated with a T7 RNA polymerase promoter, causes amplification of the plasmid DNA during T7 infection. The amplified plasmid DNA sediments very rapidly and contains large concatemers, which are expected to be good substrates for the packaging reaction. When cloned in pBR322, a sequence containing only the mature right end of T7 DNA is sufficient for efficient packaging. Since this sequence does not contain DNA to the right of the site where a mature T7 right end is formed, it was expected that right ends would not form on this DNA. In fact, with this plasmid the right end does not form at the normal T7 sequence but is instead formed within the vector. Apparently, the T7 packaging system can also recognize a site in pBR322 DNA to produce an end for packaging. This site is not recognized solely by a "headful" mechanism, since there can be considerable variation in the amount of DNA packaged (32 x 103 to 42 x 103 base-pairs). Furthermore, deletion of this region from the vector DNA prevents packaging of the plasmid. The end that is formed in vector DNA is somewhat heterogeneous. About one-third of the ends are at a unique site (nucleotide 1712 of pBR322), which is followed by the sequence 5'-ATCTGT-3'. This sequence is also found adjacent to the cut made in a T7 DNA coneatemer to produce a normal T7 right end.

I" Present address: Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, MA 02115, U.S.A. Author to whom all correspondence should be addressed. § Abbreviations used: bp, base-pair(s); kb, 103 base-pairs; t.f.u., transductant-forming units; OR, origin of replication; p.f.u., plaque-forming units.

1. Introduction

The bacteriophage T7 genome, a linear 39,936 bp~ DNA molecule (Dunn & Studier, 1983), replicates as a linear monomer during early stages of infection (Dressier et al., 1972). In later stages, large concatemers are formed, which are multimers of the T7 0022-2836/90/240911-16 $03.00]0

911 © 1990 AcademicPress Limited

912

Y.-B. Chung and D. C. Hinkle

genome linked head to tail through some recombination event involving the 160 bp terminally redundant sequences (Kelly & Thomas, 1969; Serwer, 1974; Langman et al., 1978). Formation ~of concatemers solves the problem for replication of the extreme 3' ends of template DNA (Watson, 1972). The coneatemers then serve as the substrate for the processing and packaging reactions in whidh the DNA is cut to the mature length and encapsidated to form virus particles~ The eoncatemer intermediate is formed during infection by a large variety of double-stranded DNA bacteriophages, but several different mechanisms are used to cut the concatemers into mature viral DNA (for a review, see Black, 1989). In phage T4, a headful mechanism is employed in which packaging is initiated at a random cut and is terminated after packaging 102 ~o of the genome, creating randomly permuted, terminally redundant mature DNA. In phages P1 and P22, a modified headful mechanism is employed in which packaging is initiated at a specific sequence (pac) but then proceeds along the concatemer in a processive headful packaging reaction to produce permuted, terminally redundant mature DNA. Phages 2 and T7 both process their concatemers to produce mature DNA with unique ends. In 9l DNA, the ends have 12 base, single-stranded 5' protruding complementary sequences that are produced from staggered nicks made by 2 terminase at a specific sequence (cos) on the concatemer. In T7, the unique ends are fully double-stranded and unless half of the coneatemer DNA is discarded in the packaging reaction, some mechanism is required to duplicate the terminal redundancy. An early model (Kelly & Thomas, 1969; Watson, 1972) proposes that T7 concatemers are processed by the introduction of nicks at each end of the terminal redundancy, which can then be replicated by strand displacement DNA synthesis. However, there is now evidence that at least the mature right ends are formed by a doublestranded break (White & Richardson, 1987) and alternative models for processing have been proposed in which the DNA cutting reactions t h a t form the mature ends are not directly coupled to the replication of the terminal repeats (White & Richardson, 1987; Chung et al., 1990, accompanying paper). To obtain information about which T7 DNA sequences are required for DNA packaging, we developed a plasmid packaging system analogous to the eosmid system developed for phage 2 (Collins & Hohn, 1978; Umene et al., 1978). Plasmids carrying certain T7 DNA sequences are efficiently packaged into transducing particles during phage infection. For efficient packaging, the plasmids must contain a T7 DNA replication origin in addition to sequences where the mature T7 ends are formed. The plasmids are amplified during T7 infection and from large concatemers that are presumably excellent substrates for the packaging reaction. The packaged DNA is a linear plasmid concatemer of about 40 kb with ends at the expected T7 DNA sequences. We also identify a site on the vector pBR322 DNA

where a "right" end can be formed efficiently, but less precisely, on the packaged plasmid DNA. In an accompanying paper (Chung & Hinkle, 1990) we use this plasmid transduction assay to define in more detail the T7 sequences that are required for the formation of mature right and left ends. Hashimoto & Fujisawa (1988) have briefly described a similar plasmid packaging system for T7 and the closely related phage T3. 2. Materials and Methods (a) Construction of plasmids carrying fragments of T7 DNA The right and left ends of the T7 genome are shown in Fig. 1. Fragments from this DNA, as indicated in the diagram, were inserted into the plasmid vector pBR322 (Bolivar et al., 1977) or its derivative pBRN/Sm, using standard recombinant DNA techniques (Maniatis et al., 1982). The vector pBRN/Sm (obtained from K. Yamamoto, University of California, San Francisco) was constructed by replacing the NruI-PvuII fragment of pBR322 with a SacI linker (Haltiner et al., 1985) and replacing the HindlII-BamHI fragment with a short polylinker (HindIII, XbaI, BglII, PstI, SalI, BamHI). A 2.9 kb ClaI fragment from the extreme right end of the T7 genome (Fig. 1) was inserted into the BamHI site of pBR322 (pDM63) and pBRN/Sm (pDM65) using BamHI linkers. In both pDM63 and pDM65, the T7 fragment was inserted in the counter-clockwise (co) orientation. To construct pDM75, the 956 bp TaqI-BamHI fragment was isolated from one of these constructs and inserted between the unique ClaI and BamHI sites in pBR322, pDM83 was constructed from pDM75 by deleting downstream T7 sequences from nucleotide 39,936 to nucleotide 39,362 by digestion with Bal31 nuclease from the BamHI site, insertion of a new BamHI linker, and recloning the deleted EcoRI-BamHI fragment between the EcoRI and BamHI sites of pBR322. The left end of the T7 genome was isolated as a 441 bp fragment from a partial DraI digest and inserted into the BamHI site of pBR322 using BamHI linkers. In pDM73, the fragment is inserted in the negative orientation and only the DraI end is attached to a BamHI linker, but no T7 sequences were lost in the cloning. This fragment contains the T7 RNA polymerase promoter ~)OL, which is apparently associated with an origin of DNA replication (Tamanoi et al., 1980) but, unlike plasmids containing (~OR, pDM73 is not amplified during T7 infection, suggesting that the replication origin is not active on the cloned DNA fragment (unpublished results). pPD1 was constructed by joining the T7 fragments from pDM75 and pDM73 through the KpnI site located in the terminal redundancy. During this subcloning, a 13 bp deletion was produced that removed nucleotides 233 through 245 of the T7 sequence. This deletion, which is not present in pDM73, was probably caused by reciprocal recombination between adjacent copies of the 7 bp repeated sequence motif present at the ends of the T7 genome. It produces a change in the sequence of the - 10 region of the A0 promoter that may reduce promoter activity. We have found this deletion, or similar deletions that might also affect this promoter, in other constructs with this T7 fragment, suggesting that promoter activity may be selected against in at least certain plasmid constructs. During construction, the plasmids were maintained in a recA- Escherichia eoli K-12 derivative (usually

Bacteriophage T7 D N A Packaoing. I DH5a, Bethesda Research Laboratories) but the plasmids were transformed into E. coli B (from F. W. Studier), the traditional host for bacteriophage T7, for the studies described here. (b) Media and buffers Cells were grown in LB medium containing, per liter, l0 g of Bacto tryptone, 5 g of yeast extract and 10 g of NaCl and, for cells with plasmids, 0"1 mg ampicillin/ml. Agarose gel electrophoresis was carried out in TBE buffer (90 mM-Tris base, 90 mM-boric acid, 2"5 mM-EDTA) containing 0"5/~g ethidium bromide/ml. TE buffer is 10 mM-Tris" HC1 (pH 7'5), 0"1 mM-EDTA. (c) Preparation of int.racellular DNA Cells were grown with vigorous a~itation in a gyratory shaker at 30°C to a density of 4 × 10~ cells/ml and infected with T7 at a multiplicity of 5 to I0 phage/cell. Samples (5 ml) were removed at intervals, added to an equal volume of ice-cold killing solution (2% (w/v) phenol, 8 mM-EDTA, 75% (w/v) ethanol, 0"02 M-sodium acetate buffer, pH 5"3) and cells were collected by centrifugation and nucleic acids extracted as described by Paetkau et al. (1977). (d) One step growth experiments Cells were grown at 37°C to a density of 2 x l0 s cells]ml and infected with T7 at a multiplicity of 5 to 10 phage/cell. Just prior to infection, a sample from the culture was assayed for viable cells by plating on LB agar plates with and without 0"l mg ampicillin/ml to assure that all of the cells contained plasmid. With certain T7 plasmids, but not those described here, we found that the plasmids arc frequently lost from the cells during growth in broth with ampicillin. At 4 rain after infection, a sample from the culture was diluted in LB medium saturated with chloroform and titered for unabsorbed phage, which were typically 1% of the input. After cell lysis, usually at 20 to 30 rain after infection, another sample from the culture was diluted in LB medium saturated with chloroform and titered for phage on E. coli B or for plasmid-transdueing particles. To titer transducing particles, a sample of appropriately diluted lysate was mixed with 2 ml of soft agar containing 0"1 ml of a fresh overnight culture of E. coli SRB9 (K-12hsr-, tsnB- (rpoC319)

913

Buehstein & Hinkle, 1982) and plated on LB agar containing 0"1 mg ampicillin/ml. The transductants formed colonies on these plates, which were counted after 15 to 20 h at 37°C. The tsnB mutation, which prevents growth of T7 phage, increases the sensitivity for detection of transducing particles in the presence of T7 phage (10 s phage]plate did not reduce the yield of transductants). In each experiment, a control without SRB9 was included to make certain that no ampicillin-resistant cells remained in the lysates. (e) Purification of phage and transducing particles Lysates (usually 400 ml) were prepared as described above, except that cells were infected at a density of about l09 cells]ml. The phage and transducing particles were concentrated by precipitation with polyethylene glycol (Yamamoto et al., 1970) and centrifugation through a CsCl step gradient (Studier, 1969). In some eases, the particles were further fractionated by sedimentation to equilibrium in a CsCl gradient. (f) DNA sequencing For routine sequencing of cloned DNA, Sanger's chain termination method (Sanger et at., 1977) was used according to Smith (1980) and Messing (1983) either after subcloning the appropriate fragment into an M13 phage vector or from an appropriate primer directly on the plasmid DNA (Chen & Seeburg, 1985). 3. R e s u l t s

(a) A plasmid containing the T7 concatemer junction

is e~ciently packaged into transducing particles during T7 infection To develop a plasmid model system for the s t u d y of T7 D N A c o n c a t e m e r processing a n d p a c k a g i n g we cloned the sequences where the m a t u r e T7 ends are formed into a plasmid vector. W e define these sequences, the T7 right end joined to the left end through recombination within the terminal redundancy, as the T7 concatemer junction ( L a n g m a n et al., 1978). I n p P D 1 , such a c o n c a t e m e r junction was constructed b y joining f r a g m e n t s f r o m the right a n d left ends of T7 D N A t h r o u g h a unique K p n I site

Table 1

Production of phage and transducing particles by T7 infection of E. coli B harboring plasmids with T7 D N A Construetiont

Burst]cell:I:

Plasmid

T7 nueleotides

Vector

pBR322 pPD1 pDM75 pDM83 pDM86 pDM75N/S pDM86N/S

None 38,981 38,981 38,981 38,931 38,981 38,981

pBR322 pBR322 pBR322 pBR322 pBR322 pBRN/Sm pBRN]Sm

~ 439 ~ 39,936 (160) ~ 39,362 ~ 39,645 --, 39,936 (160) ~ 39,645

Phage

Transducing particles

130 15 9 69 8 4 8

< 3 x 10- s 15 13 1-5 0"6 0"2 0"01

t The structures of pPD1, pDM75 and pDM83 are shown in Fig. 1. pDM86 was constructed as described for pDM83, pDM75N/S and pDM86N]S were constructed by moving the EcoRI-BamHI DNA fragment containing the T7 sequences from pDM75 or pDM86 into EcoRI-BamHI-digested pBRN/Sm. :~One-step growth experiments were carried out as described in Materials and Methods using E. coti B harboring the indieatecl plasmid.

Y.-B. Chung and D. C. Hinkle

914 pDMG5

pDM7S

i

I 37,000

38.000

f

~'] .............. tlmM

i , CIo roq

I

39,000 ..I

gig

39,936

................. ~OR 919.5

I

Taq

! pDMOS

TR AO COL

pPD1

i

pDM73

I

T7 right end

C/o Hin Eco , F

Ecol~

Polynnker

I#OO

_L J JTA??

I__J

1

T

ITR Kpn Dro Dro

T7 left end

pBR322

,"el am

vu

sVru,Soc

amp I E¢o

amp

pBR N IS m

I Eco

Vectors

C/a/ Toq

Born

fef" pER322

pDM75 Eco

C/el Toq

Barn tet"

pPDI

pBR322

ECO

g'~g:';"

TR AO*OL

C/a/Toq Barn tel"

pDM83

i.L~eo. I

=

pens==

E¢o

Figure 1. Construction of plasmids carrying sequences from the right and left ends of T7 DNA. Details are described in the text. located within the terminal redundancy (Fig. 1). The plasmid pPD1 was efficiently packaged into transducing particles during T7 infection (Table 1). We measure transduction by mixing the lysate with ampicillin-sensitive cells, spreading the mixture on LB agar plates containing ampicillin, and allowing colonies (transductants) to develop. With the vector pBR322, no transducing particles were detected ( < 3 x l 0 -5 t.f.u./cell) but the lysate from cells bearing pPD1 contained 15 t.f.u./cell. We will show below that the plasmid-transducing particles contain linear plasmid concatemers that are produced by T7-induced replication of the plasmid DNA from a T7 replication origin (OR, Fig. 1). During transduction, we assume that this DNA is injected into the recipient cell where plasmid circles are formed by reciprocal recombination. We have recovered plasmid DNA from several transductants and it appears to be identical (by restriction endonuclease analysis) to the original pPD1. In the experiment shown in Table 1, the transducing particles were formed at a multiplicity of

infection of about 10 phage/cell. The same yield of transducing particles per infected cell was obtained when the infection was carried out at low multiplicity (0.05: surviving uninfected cells were removed from the lysate by centrifugation or treatment with chloroform). We have measured the yield of phage from the cells containing these plasmids (Table 1). As reported previously, plasmids containing sequences from the right end of the T7 genome inhibit phage growth (Campbell et al., 1978; Stone et al., 1983). This inhibition requires the T7 promoter ¢ O R but is also affected in a complex way by adjacent sequences (Chung & Hinkle, 1990). The mechanism of inhibition is not understood but several factors may play a role. Some inhibition may result from competition by the plasmid DNA for phage DNA replication origins and DNA packaging sites. The synthesis of phage proteins, analyzed by SDS/polyacrylamide gel eleetrophoresis, appears to be normal (data not shown). To measure transduction we have usually used as

Bacteriophage T7 D N A Packaging. I a recipient E. coli SRB9, an hsr- K-12 derivative carrying the tsnB (rpoC) mutation that inhibits the growth of T7 phage. These cells are lysed by T7 infection but, since few progeny phage are produced, transductants efficiently survive on plates containing at least l0 s phage. In the absence of large amounts of T7 phage, the efficiency of transduction is the same with other hsr- K-12 strains (Table 2). Transduction is reduced with hsr + recipients. This plasmid contains two recognition sites for the K-12 restriction endonuclease, and the packaged DNA is not expected to be methylated. In this case, the transducing particles were produced in E. coli B but the same result is obtained with particles produced in a K-12 stain. Since the host restriction-modification enzyme is inhibited early during T7 infection (Studier, 1975), the plasmid DNA produced during the T7 infection is not expected to be modified. Both T7 DNA and plasmid DNA that has been amplified by T7 infection are also poorly methylated by the E. coli DNA adenine methylase, as judged by digestion with restriction endonuclease that recognize only methylated or unmethylated GATC sequences (our unpublished results). It is not known whether this results because the bacterial methylase is unable to keep pace with the rapid rate of phage-induced DNA synthesis or whether the phage also specifically inhibits this activity. E. coli B strains are less efficient recipients in these plasmid transductions (Table 2). Since the plasmids do not contain a recognition site for the EcoB restriction endonuclease, this restriction system seems unlikely to be responsible for the reduced transduetion efficiency and an hsrmutation produced no increase in transduction. We do not know whether some additional restriction system is responsible for this tenfold difference in transduction efficiency or whether s o m e - o t h e r aspect of transduction is deficient in E. coli B. The efficiency of T7 plating is the same for B and K-12 strains. It is possible that the reciprocal recombination required to form a circular plasmid from the linear plasmid concatemer is less efficient in E. coli B than in E. coli K-12. E. coli K-12 recA mutants, which are expected to be deficient in this recombination, are very poor recipients for transduction (JM109; Table 2). (b) Plasmids containing a T7 D N A replication origin are amplified during T7 infection The high number of transducing particles produced from cells bearing pPD1 suggested that the plasmid DNA must be amplified during T7 infection. A putative origin for T7 DNA replication (OR; Fig 1) has been identified near the right end of the T7 genome (Studier & Rosenberg, 1981; Rabkin & Richardson, 1988). We have confirmed that plasraids carrying this region of T7 DNA are amplified during T7 infection (Fig. 2). This amplification is most apparent when the intracellular DNA is digested with a restriction endonuclease (ScaI cuts

0

ori

915 Undigested I 0 20 3 0

Sc~; I0 2 0

O

30

.~

S.C." ~

.

.;-

~

.

.

,...,;

.:

~

~.:

~-~, ~ .

Figure 2. Amplification of plasmid DNA by T7 infection. Intracellular DNA from E. coli B harboring pDM65 was prepared immediately (0 rain) and at 10, 20 and 30 rain after T7 infection at 30°C as described in Materials and Methods. DNA samples corresponding to 4 x l0 T cells were electrophoresed on a 0"8% agarose gel before and after digestion with 8caI. The gel was blotted as described by Southern (1975) and hybridized with nick-translated pBR322 DNA (Rigby et al., 1977). ScaI digestion of pDM65 DNA produces a 4-2 kb fragment containing 2"4 kb of pBR322 sequence and an 1"5 kb fragment containing 0"5 kb of pBR322 sequence; ori, origin of electrophoresis; s.c., position of supercoiled pDM65 plasmid DNA.

this plasmid at 2 sites) prior to agarose gel electrophoresis and Southern blot analysis (Southern, 1975). Without digestion, most of the amplified DNA is retained at the origin and is probably poorly transferred" to t h e nitrocellulose membrane. ~ DNA replication intermediates are also retained at

916

Y.-B. Chung and D. C. Hinkle Table 2 Competence of various E. coil strains for the transduction

Strain

Genotype

SRB9 WA802 C600 JM107

WA802 argH+ rif s rpoC319(ts~B) K-12 supE44 hsr~ hsm~ mete K-12 supE44 endA1 gyrA96 thi hsdR17 supE44 relA1 ),A(lac-proAB) IF' traD36proAB /acIqZAM15] JM107 fecal

JMl09 B WA837

Competence

Be hsr~ h~n~ gal- met-

Reference

1 1 _ 100 S) that moved to the CsCl shelf at the bottom of the gradient (fraction 1) and was retained at the origin during electrophoresis. Digestion of this DNA with BglI, which cuts the plasmid at three sites to produce fragments of 2"70 kb, 2"32 kb and 0.23 kb, indicates that primarily plasmid DNA sequences are present in this fraction (Fig. 3). When the DNA in this fraction was examined in the electron microscope, large tangled structures were observed (Fig. 4) that resemble the "flower" structure formed by T7 DNA concatemers (Paetkau et al., 1977). Although the DNA is too tangled to be analyzed in much detail,

multiple forks can be seen and contour lengths of at least 5 #m ( > 15 kb) can be followed. We conclude that the amplified plasmid DNA is present in large concatemers. These may be formed by "rolling circle" DNA replication or by extensive recombination between replicating plasmid DNA molecules. By 20 minutes after infection, a significant fraction of the amplified plasmid had been processed into smaller molecules that sediment with mature T7 DNA (fraction 13, about 30 S) and move with mature T7 DNA (40 kb) during electrophoresis (Fig. 3(c) and (d)}. This suggests that the processing and packaging of the amplified plasmid DNA is extremely efficient. As suggested previously (Studier & Rosenberg, 1981; Rabkin & Richardson, 1988), the right origin of DNA replication appears to be associated with the T7 RNA polymerase promoter located before gene 19'5 at nucleotides 39,201 to 39,233 on the T7 genome. We have cloned a series of T7 fragments deleted with Bal31 and tested them for T7-indueed amplification (data not shown). Deletions from the left that extend into the T7 promoter (for example, to nucleotide 39,228) abolish origin activity while those outside the promoter (for example, to 39,169 or 39,199) are fully active. Deletions from the right

Y.-B. Chung and D. C. Hinide

918 8O

.°.-,.58

8,

40 30 20

1'50

I0

1.42

1-46

80

t

¢~ 60

g

2 f~

1"54

40

3o

1.50

20

1-46

0

::

_11.42

. . . . . . . . . . .

(d) Purification of transducing particles on a

80

(c) 6O

1.58 I "54

5O

40

1.50

30 1.46

20 I0 0

DNA (pDM75) was packaged with the same efficiency as the plasmid containing the concatemer junction (pPD1). This plasmid contains no T7 sequences to the right of the site where the mature T7 right end is formed (Fig. 1), so it was expected to be deficient in formation of this end. As described below, the efficient packaging of pDM75 DNA results because the vector itself contains a DNA sequence, located around position 1700 in the pBR322 sequence, at which a right end can be formed for the packaged DNA. In plasmids that are missing this region of pBR322 (pDM75N/S and pDM86N/S), constructs in the vector pBRN/Sm (Fig. 1), which contains a deletion from 972 (NruI) to 2207 (PvuII), the formation of transducing particles is only about 2~/o of that obtained with the pBR322 constructs (Table I).

1.42 I0 Fraction

20

Figure 5. Fraetionation of phage ([]) and transducing particles (4b) on a CsCI equilibrium gradient. Phage and transducing particles were purified from T7-infected cells carrying the plasmids (a) pPD1, (b) pDM75 or (c) pDM83 as described in Materials and Methods. Centrifugation was in a Beckman SW60 rotor at 30,000 revs/min at 4°C for 20 h in a CsCl solution of density 1.5 g/ml. Fractions (0-2 ml) were collected from the bottom of the tube and assayed for phage and transducing particles as described in Materials and Methods. Density (O) was obtained from the refractive index. The total yield of phage and transducing particles, respectively, was: (a)8-7x10 li and 5"2x lOll; (b) 3-4x lOII and 2-8x lOH; (c) 1"1 x lO12 and 4"6 x 101°.

up to at least nucleotide 39,362, about 130 nucleotides downstream from the promoter, are also active but we have not determined precisely the minimum fragment required for origin activity. (c) Only the origin and T7 right end sequences

are required for e~cient packaging Plasmids that contain a T7 concatemer junction without a replication origin produce few, if any, transducing particles ( < 1 x 10 -3 t.f.u./cell) during T7 infection (Chung & Hinkle, 1990). Plasmids that contain the origin but none of the sequences from the ends of T7 DNA (Table 1, pDM83 and pDM86) give an intermediate burst of transducing particles (0-6 to 1-5 t.f.u./cell). An unexpected finding was that a plasmid containing only the right end of T7

CsCl density gradient The phage and plasmid-transducing particles present in lysates were fractionated by sedimentation to equilibrium in CsC1 (Fig. 5). The two plasmids that are efficiently packaged into transducing particles, pPD1 and pDM75, produced two peaks of transducing activity, each less dense than T7 phage, indicating that the particles contained less than the 40 kb present in the virus. With pDM83 (containing no concatemer junction sequences), which is packaged at about 10~o of the efficiency of the other two ptasmids, a single peak of transducing activity was obtained, banding at the same density as the phage particles, although in a slightly broader distribution. The DNA from these particles was analyzed by field-inversion agarose gel electrophoresis (Fig. 6). The samples from pPD1 and pDM75 showed three major bands of DNA, ~ 4 0 kb DNA in fractions 6 and 7, ~ 36 kb DNA plasmid 7-mer) in fractions 9 and 10 and ~31 kb DNA (plasmid 6-met) in fractions 13 and 14. A small amount of intermediatesized DNA can be seen in fraction 12. The --40 kb DNA is mostly from T7 phage but a very small amount of plasmid DNA (plasmid 8-mer) can be seen in this fraction if the phage DNA is removed by digestion with HpaI (data not shown). In the samples from pDM83, only ~ 4 0 kb DNA is seen. A small amount of plasmid DNA of this size is seen when the T7 DNA is removed by digestion with HpaI (data not shown). The amount of DNA present in each gradient fraction is approximately proportional to the number of plaque-forming units (p.f.u.) or transduetant-forming units (t.f.u.) in that fraction. The specific biological activity of the purified particles was typically 2 x l011 t.f.u./ml per A26o unit for the pPD1 and pDM75 transducing particles and 3 x x 1011 p.f.u./ml per A26o unit for the T7 phage. These values indicate that 20 to 30~o of the particles are biologically active (Davison & Freifelder, 1962). Since only 20 to 30% of the p.f.u, and t.f.u. present in lysates were recovered in the purified fractions, it seems likely that some inactivation

Bacteriophage T7 DNA Packaging. I

919

pPDI I

I

I

I

5

I

I

I

I

lo

I

I

I

I

15

I

I

iv

"40kb 28.4

kb

21,3 kb

pD M"?5

I

I i

I s

I

I I

[ Io

I

t

I

I

Is

i

I

I

I M

i

40 kb 28,4kb

pDM83 M

I

I

I I 5

I

I

I

t

1o I

I

I

~s

I

I

~ M

~40kb • 2 8 - 4 kb 21-3 k b

Figure 6. Field-inversion gel electrophoresis packaged plasmid DNA. A 1/~1 sample from each fraction of the CsCI •gradients shown in Fig. 5 was mixed with 20 #1 of agarose gel loading buffer (5 ml glycerol, 0"5 g Sarkosyl, 0"2 ml 0"5 M-EDTA, and 3 ml of 5 × TBE buffer to make 10 ml) and heated at 65°C for 10 rain before loading on a 1% agarose gel. Electrophoresis was carried out at 5 V/cm at 4°C with field-inversion (3 s forward and 1 s backward) for 20 h (Carle" et al., 1986). Molecular weight markers in lanes M are a mixture of undigested (10 ng), Sau3A-digested (30 ng) and BglII-digested (20 ng) T7 DNA.

occurs during purification. The fraction of particles that are biologically active in lysates may be close to unity.

(e) Analysis of the ends of the packaged plasmid DN A To determine where the ends of the packaged plasmid DNA are formed, we analyzed the DNA isolated from the purified transducing particles by digestion with various restriction endonucleases. An example of such an experiment is shown in Figure 7. DNA from the particles produced from pPD1 (concatemer junction) and pDM75 (right end) was

digested with PstI and PvuI, enzymes that cut each plasmid at a single site. In each digest, a large band of unit length plasmid is observed as expected for digestion of a tandemly repeated plasmid concatemer. In addition, two weaker bands are observed that present fragments from each end of the DNA molecule. For pPD1, the size of these end fragments is as expected for ends formed in the concatemer junction sequence at the sites used to form the right and left ends of T7 DNA. The PstI digestion produces fragments of about 3"7 kb (left end) and 1"7 kb (right end}, and the PvuI digestion produces fragments o f about 3"8 kb (left e n d ) a n d 1"6 kb

920

Y.-B. Chung and D. C. Hinkle pD M75 PsfZ

pPDI

P$#I

PsfZ

pD M83 Pvu]

Ps f I

M

~,-

L.E. R.E.¢

P vu][

4kb L.E.

2kb

Ikb R.E.

2 kb -II~

L.E.

(o)

i kb-~* Packaged r ight end

Packaged left end vu . ( PPsi IJ

pPDI

Pvu

RE-TR-LE

I p~' d 15-6

OR ,~----3.8

3"7 •

pDM75

pOM83

-- ~

3.3

~¢1.6~"

~

5"3

~ ~ 1 "7~"

Pvu

I P$! I

RE-TR

I

OR

PVU

)p"ll -5-6

"4"-----3"5

~

5:0

~

3-O---IP,

"4------3.4

~-~

3-0

~-

3.1-'-~

I

Pvu , I PSf II

t 4 " 4 Multiple ends ~ 4 4 ~

I OR

(b)

Pvu. I Pst I~ I

i 8 ~

2-4 --e,.

~_

2.5-4~

Figure 7. Restriction digestion of packaged plasmid DNA. (a) The transducing particles from pPD1 and pDM75 (fractions 9 and l0 from the gradient shown in Fig. 5) were desalted on a Sephadex G-50 column and extracted with phenol. A sample (5 gl) from each DNA was digested with PstI or PvuI and fractionated by eleetrophoresis on a 0"8o agarose gel. DNA bands were visualized by ethidium bromide fluoresence under ultraviolet light. (b) The transducing particles from pDM83, together with T7 phage, were recovered from the peak fraction of the gradient shown in Fig. 5, desalted, extracted with phenol and digested with HpaI, which cuts T7 DNA but not the packaged plasmid DNA. The packaged plasmid DNA (about 40 kb) was separated from the T7 DNA fragments by agarose gel electrophoresis and the 5' ends of this DNA were labeled with T4 polynucleotide kinase and [7-a2p]ATP (Maxam & Gilbert, 1980), and digested with PstI or PvuI. After electrophoresis, the dried agarose gel was subjected to autoradiography. L.E. and R.E. mark restriction fragments from the left and the right end of the packaged DNA. The size markers (M) are from H1~aI-digested T7 DNA (see the legend to Fig. 3). (c) The diagram shows the proposed structure of the packaged plasmid DNAs. The sizes (kb) of the fragments generated by digestion with PstI or PvuI are shown between the arrows. The multiple left ends of the packaged pDM83 DNA are not shown at specific locations.

Bacteriophage T7 DNA Packaging. I A

•

i~'--

921

C

".i'~i

,

16~

4--106

/i

38981 !~,~ L.E.

39936

39882 I

__

! 23

!

i

pBR322

376 413

6e-I~ Left end fragments

F

---" (106)

M

- - - " -

(163)

H

R.S°

(200)

1712 I 1644

I

I

1668

1681

!

pBR322

,4-~. Right end fragments H

(o)

(31) M

(44) (8e)

(b)

Figure 8. Denaturing polyaerylamide gel electrophoresis of end-labeled pDM75 DNA. (a) Packaged pDM75 DNA was prepared as described in the legend to Fig. 7 and the 5' ends of the DNA were labeled with T4 polynucleotide kinase and [7-32 P]ATP (Maxam & Gilbert, 1980) and digested with: lane A, HaeII; lane B, MboI; lane C, FokI. Electrophoresis was carried out on an 8% polyacrylamide gel with 8 M-urea as described by Maniatis eL al. (1982). Numbers indicate the fragment size in nucleotides, estimated by comparison with DNA sequencing reactions run on adjacent lanes (not shown). (b) The diagram shows the restriction map of the end-forming region of pDM75. The box represents cloned T7 DNA with terminal redundancy (filled box). The numbers above the box indicate T7 sequence and the other numbers are sequences from pBR322. The end fragments produced by each digestion are shown with bold lines and the fragment size (bp) is given in parentheses. F, FokI; M, MboI; H, HaeII.

(right end}. With pDM75, the left end is formed at the same site as with pPD1, but the right end fragments are about 1.3 kb larger than expected (3-0 kb and 3-1 kb}. This indicates t h a t the right end of the packaged pDM75 DNA is formed at a sequence in the vector, at about position 1700 of the pBR322 sequence. More accurate determination of the sizes of the larger restriction fragments was carried out in other experiments (data not shown}.

We have also examined the ends of the poorly packaged pDM83 DNA (Fig. 7(b)), a plasmid that contains the T7 DNA replication origin but none of the sequences from the T7 concatemer junctiofi. Since these transducing particles were not separated from the T7 phage on the density gradient, the plasmid DNA was purified by agarose gel electrophoresis after digesting the contaminating T7 DNA with HpaI. Our initial analysis revealed a right end

922

Y.-B. Chung and D. C. Hinkle

T7

pPD1

R.E°

L.E.

R.E.

N GATC

NGATC

NGATC

L.E. NGATC

N~ ,g'.;..

•:::

Bottom

a b

TTTAGGTCCGTACACTGTGAGA GTGTCTCTCTGTGTCCCT

D

le

Top

(a)

formed at the site in the vector DNA used with pDM75, but no specific bands from the left end could be seen. To increase the sensitivity of the analysis the 5' ends of the DNA were labeled with 32p using polynucleotide kinase. From this analysis, in addition to the major right end position at about 1700 in the pBR322 sequence, a minor right end band that is about 300 bp larger is also visible. This minor right end must be formed near position 2000 in the pBR322 sequence. Five left end bands are also visible. These are defined as left ends because in each case the PvuI digest produces a fragment that is 0-1 kb larger than in the PstI digest. From the sizes of these fragments, we estimate that the left

ends are formed at positions 1700, 2160, 2460, 2560 and 2810 on the pBR322 sequence. The 32P-labeled band at 4"4 kb is unit length plasmid DNA (the internal fragment), which must be labeled at singlestrand breaks. The proposed structures of packaged plasmid DNAs are summarized in Figure 7(c). To characterize further the end formed in pDM75 at position 1700 in the pBR322 sequence, we labeled the 5' ends of the packaged DNA with 32p and analyzed the small fragments produced by digestion with HaeII (lane A), MboI (lane B) and FokI (lane C) by etectrophoresis on a denaturing polyacrylamide gel (Fig. 8). A left end formed at the exact sequence used in T7 DNA would produce

Bacteriophage T7 D N A Packaging. I Right end N

G

923 Left end

A

T

C

E

_

N

G

A

T

C

~ aGGG

_

_51~G~G

_ GI~,G G'I

.c.r,G

_ GGG"IG

_

p,c

Figure 9. DNA sequence at the ends of packaged plasmid DNA. Packaged plasmid DNA was prepared as described in the legend to Fig. 7 and 53/lg of DNA was digested for 5 min at room temperature in a 60-#1 reaction containing 25 to 50 units of exonuclease III {Smith, 1980). The reaction was stopped by extraction with phenol and the DNA was precipitated with ethanol and resuspended in 100 #l of TE buffer. For the sequencing, 15 #! of exonuclease IILtreated DNA was used for one set of 4 chain termination reactions as described by Smith (1980). After the chase, the samples were digested with the appropriate restriction enzyme, to generate 2 families of radioactive DNA fragments each with a unique 5' end, and analyzed by electrophoresis on a 6% polyacrylamide gel containing 8 M-urea (Maniatis et al., 1982). G, A, T and C are lanes containing reactions with the indicated dideoxynucleotides. N is for no dideoxynucleotides. E is a lane containing 5' end-labeled DNA (prepared as described in the legend to Fig. 8) digested with the appropriate restriction enzyme. (a) Phage T7 and pPDI packaged DNA was digested with KpnI after the sequencing reactions to form a 37 bp left end (L.E.) and a 123 bp right end (R.E.) fragment. Samples for the right end were electrophoresed for 120 min and those for the left for 60 min at 1800 V. The sequence from the (a) left and (b) right ends of T7 DNA is shown as read from bottom (5') to top (3'). (b) pDM75-packaged DNA was digested with AvaI to form a right end fragment of about 290 bp or with BamHI to form a left end fragment of 160 bp. Samples for the right end were electrophoresed about 4 h and those for the left end for about 2 h at 1800 V.

fragments of 200, 163 and 106 bp in the three digestions, and a unique band size consistent with this expectation is seen in each digestion. The right end of the packaged pDM75 DNA is more heterogeneous. A cluster of bands centered around 68, 44 and 31 bp (mostly off the end of the gel in the experiment shown in Fig. 8) is seen in each of the three digests. This indicates t h a t the end formed in pBR322 DNA is more heterogeneous t h a n the end formed at a poorer T7 sequence. (f) Sequence at the ends of the packaged D N A To sequence the ends of the packaged plasmid DNA molecules, we carried out the e x p e r i m e n t shown in Figure 9. The procedure involves limited digestion of the purified DNA with exonuclease I I I to generate single-stranded ends t h a t are substrates

for DNA potymerase. DNA synthesis is carried out in four sequencing reactions (each containing a d d N T P ) and a fifth reaction t h a t contains no d d N T P was included to determine where the multiple ends of the template are located. Before analysis on a denaturing polyacrylamide gel, the samples are digested with a restriction endonuclease to generate a unique 5' end on the radioactive D N A product. The restriction endonuclease is chosen such t h a t only sequences from one end of the DNA molecule are present in the resolving range of the gel for each experiment. As expected, the right and left ends of the pack-' aged pPD1 DNA appear to have sequences identical to those found in m a t u r e T7 D N A (Fig. 9(a)}. Although the reactions without d d N T P (N) show a few e x t r a bands in the reactions a t the right ends of both the pPD1 and the T7 DNA, these p r o b a b l y

924

Y.-B. Chun9 and D. C. Hinkle that about 50% of the ends are formed at position 1712 with other ends at positions 1720 and 1727. The sequence 5'-ATCTGT-3' follows immediately the right end formed on T7 coneatemers and is also adjacent to the major end formed at position 1712 in pBR322 (Fig. 11). The sequences 5'-CTGTG-3' and 5'-CCT-3' are located to the left of both ends, although not in exactly the same position. . . . . .

5'-GTGGAACACCTACATCTGTATr'AACGAAGCGCTGG-3' • , 1710

1720

173

Figure 10. Distribution of right ends in packaged pDM75 DNA. Lane E from Fig. 9(b) (right end), containing the 5' end-labeled "right end" of the packaged pDM75 DNA, was traced with an LKB soft laser scanner. The tracing was aligned to the sequence of pBR322 using the information contained in the other sequencing lanes.

result from incomplete synthesis by the DNA polymerase, since they were not observed in an analysis of the (5'-32p)-labeled complementary strand. The reactions at the left end of the packaged pDM75 also show a unique end at the expected sequence (Fig. 9(b)). In contrast, the reactions at the right end of this DNA show evidence of the multiple ends formed at the pBR322 sequence. Several nucleotide positions are seen to have bands in all five DNA sequencing lanes, consistent with the multiple bands seen with the (5'-32p)-labeled DNA (Fig. 8(a) and lane E; Fig. 9(b)). Since the (5'-32p)-labeled DNA is the complementary strand to that seen in the ddNTP sequencing reactions, it is not expected to migrate exactly with its complement during electrophoresis. The (5'-32p)-labeled DNA appear to move slightly faster than their complements in these experiments. Because of the numerous positions at which ends cause stops in all of the sequencing reactions, it is difficult to read all parts of this sequence. But, ~ince the sequence of pBR322 is known (Sutcliffe, 1978), it is possible to determine where the major ends are formed. In Figure 10 we have aligned a tracing of the (5'-a2P)-labeled terminal fragments (lane E) with the sequence of the complementary strand. This analysis suggests

L.E, of 397e0 39780 T7 S..GTCCTTfA/~TATACC ATIAAAAATCTGA~GACTATCT~CAGTGTA ~A.~ pPD1 pDMY5 ~t R,E. of T7 pPD1

160

180

R.F- of 1700 1720 1740 pDM75 $'-CTA~I ~ ' I " C - ~ 0 ~ , ~ ¢ ~ A C A 1 L ' T f f f f f l " f ~ ~ T f ~ ' pDM83

Figure 11. Comparison of the sequences where ends of packaged DNA are formed. The arrowheads indicate the nucleotide at the end of the packaged DNA. Possible homologies between the sites where a right end is formed on T7 and pBR322 DNA are underlined.

4. Discussion (a) T 7-induced plasmid amplification T7 infection induces the rapid replication of recombinant plasmids carrying certain regions of the T7 genome (Studier & Rosenberg, 1981; Rabkin & Richardson, 1988). One such region is the primary origin of T7 replication, containing the T7 RNA polymerase promoters ¢ l . l A and e l . l B . Three other promoters, ¢6.5, ¢13 and ¢ O R also promote plasmid replication during infection and these are presumably secondary origins of phage DNA replication. Our plasmids contain ¢ O R , a promoter that appears to have the strongest origin activity in this plasmid system (our unpublished results; Rabkin & Richardson, 1988). There is no direct evidence that this promoter functions as a replication origin during phage DNA synthesis and it is possible that it is active only on plasmids. In this regard, it is interesting that Romano et al. (1981) found, in an in vitro system, that the ¢13 promoter could promote DNA synthesis on a supercoiled plasmid DNA but not on a linear molecule while the primary replication origin was active on both types of DNA molecules. However, the studies reported by Rabkin & Richardson (1988) indicate that ¢ O R is most active in plasmid replication in later stages of phage infection. It is possible that this origin is active only during the replication of T7 concatemers and would not have been seen in the electron microscopy studies of early replicative intermediates (Tamanoi et al., 1980). We have found that the product of T7-induced plasmid replication is a large complex structure containing plasmid concatemers. It seems likely that this structure is formed by rolling circle DNA replication, although we cannot rule out the possibility that it forms through extensive recombination. Cohen & Clark (1986) have found that large linear plasmid multimers accumulate in cells lacking the RecBCD nuclease (exonuclease V). This nuclease is inhibited during T7 infection (Wackernagel & Hermans, 1974) but in the T7-infected cell, the absence of exonuclease V activity is not sufficient for plasmid amplification, since only those plasmids carrying specific T7 "origin" sequences replicate (our unpublished results; Rabkin & Richardson, 1988). This may be because transcription by the bacterial RNA polymerase is shut off during the infection (Hesselbach & Nakada, 1977; DeWyngaert & Hinkle, 1979) so that plasmid replication from the ColE1 origin cannot continue. The rolling circle replication that leads to plasmid amplification may

925

Bacteriophage T 7 D N A Packaging. I

result from a break at a replication fork; for example, a nick in the displaced template for lagging strand synthesis. Plasmids that are not replicating, either from the ColE1 origin or from a T7 origin of replication, could not become templates for rolling circle amplification. (b) Packaging of plasmids during T7 infection The packaging of plasmid concatemers into transducing particles during infection has been observed with other phages, for example A (Umene et al., 1978), mu (Teifel-Greding, 1984) and T4 (Takahashi & Saito, 1982), but the number of transducing particles that are produced is generally quite small. The high efficiency of plasmid packaging in the T7 system (> l0 t.f.u./cell) results from the extensive plasmid amplification that occurs during T7 infection and plasmids without a T7 replication origin are packaged poorly (Chung & Hinkle, 1990). In their studies on plasmid packaging by phages T3 and T7, Hashimoto & Fujisawa (1988) also observed that sequences to the left of the concatemer junction are required for efficient plasmid packaging. Although they interpreted their results in terms of a site for protein binding, it seems likely that a replication origin also functions in the T3 system. Plasmid packaging in T3 was less efficient (_