Bak-independent apoptosis.

Souhayla El Maadidi, Laura Faletti, Birgit Berg, Christin Wenzl, Katrin Wieland, Zhijian J. Chen, Ulrich Maurer and Christoph Borner J Immunol published online 3 January 2014 http://www.jimmunol.org/content/early/2014/01/03/jimmun ol.1300842

Supplementary Material

http://www.jimmunol.org/content/suppl/2014/01/03/jimmunol.130084 2.DCSupplemental.html

Subscriptions

Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscriptions

Permissions Email Alerts

Submit copyright permission requests at: http://www.aai.org/ji/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/cgi/alerts/etoc

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 9650 Rockville Pike, Bethesda, MD 20814-3994. Copyright © 2014 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606.

Downloaded from http://www.jimmunol.org/ at UNIVERSITAETS-UND LANDESBIBLIOTHEK DUESSELDORF on January 7, 2014

This information is current as of January 7, 2014.

A Novel Mitochondrial MAVS/Caspase-8 Platform Links RNA Virus −Induced Innate Antiviral Signaling to Bax/Bak-Independent Apoptosis

Published January 3, 2014, doi:10.4049/jimmunol.1300842 The Journal of Immunology

A Novel Mitochondrial MAVS/Caspase-8 Platform Links RNA Virus–Induced Innate Antiviral Signaling to Bax/Bak-Independent Apoptosis

Semliki Forest virus (SFV) requires RNA replication and Bax/Bak for efficient apoptosis induction. However, cells lacking Bax/Bak continue to die in a caspase-dependent manner. In this study, we show in both mouse and human cells that this Bax/Bak-independent pathway involves dsRNA-induced innate immune signaling via mitochondrial antiviral signaling (MAVS) and caspase-8. Bax/Bakdeficient or Bcl-2– or Bcl-xL–overexpressing cells lacking MAVS or caspase-8 expression are resistant to SFV-induced apoptosis. The signaling pathway triggered by SFV does neither involve death receptors nor the classical MAVS effectors TNFR-associated factor-2, IRF-3/7, or IFN-b but the physical interaction of MAVS with caspase-8 on mitochondria in a FADD-independent manner. Consistently, caspase-8 and -3 activation are reduced in MAVS-deficient cells. Thus, after RNA virus infection MAVS does not only elicit a type I antiviral response but also recruits caspase-8 to mitochondria to mediate caspase-3 activation and apoptosis in a Bax/Bak-independent manner. The Journal of Immunology, 2014, 192: 000–000.

S

emliki Forest virus (SFV) is an enveloped, single-stranded, and positive-sense RNA virus belonging to the Alphavirus genus of the Togaviridae family. Its pathogenicity in humans and animals varies from asymptomatic to fatal, causing encephalitis or epidemic polyarthritis, depending on the virulence of the strain (1, 2). The virus has a broad host range, replicates to high titers, and induces apoptosis of numerous mammalian cells (3, 4). Importantly, its strong death- and type I IFN–inducing capacity has spurred the development of various SFV vectors that are currently used for *Institute of Molecular Medicine and Cell Research, Albert Ludwigs University Freiburg, D-79104 Freiburg, Germany; †Faculty of Biology, Albert Ludwigs University Freiburg, D-79104 Freiburg, Germany; ‡Department of Molecular Biology, Howard Hughes Medical Institute, University of Texas Southwestern Medical Center, Dallas, TX 75390; xSpemann Graduate School of Biology and Medicine, Albert Ludwigs University Freiburg, D-79104 Freiburg, Germany; and {Centre for Biological Signaling Studies, D-79104 Freiburg, Germany 1

Current address: greenovation Biotech, Freiburg, Germany.

2

Current address: U3Pharma, Martinsried, Germany.

Received for publication March 29, 2013. Accepted for publication November 25, 2013. This work was supported by Spemann Graduate School of Biology and Medicine Grant GSC-4 and Centre for Biological Signalling Studies Grant EXC-294 (to C.B. and U.M., both funded by the Excellence Initiative of the German Federal and State Governments, Germany). L.F. was supported by the Virtual Liver Network, sponsored by the German Federal Ministry of Education and Research, and Z.J.C. was supported by National Institutes of Health Grant AI-093967. Address correspondence and reprint requests to Dr. Christoph Borner, Institute of Molecular Medicine and Cell Research, Albert Ludwigs University Freiburg, Stefan Meier Strasse 17, D-79104 Freiburg, Germany. E-mail address: christoph.borner@ uniklinik-freiburg.de The online version of this article contains supplemental material. Abbreviations used in this article: DISC, death-inducing signaling complex; eIF2a, eukaryotic initiation factor 2 a; FasL, Fas ligand; FLIP, FADD-like IL-1 b–converting enzyme-inhibitory protein; HCV, hepatitis C virus; IFNAR, IFN-a/b receptor; MAVS, mitochondrial antiviral signaling; MDA-5, melanoma differentiation Ag-5; MEF, mouse embryonic fibroblast; MOI, multiplicity of infection; MOMP, mitochondrial outer membrane permeabilization; OAS, oligoadenylate synthetase; PARP, poly (ADP-ribose) polymerase; PI, propidium iodide; PKR, protein kinase R; PLA, proximity ligation assay; RIG-I, retinoic acid inducible gene-I; SFV, Semliki Forest virus; sh-Ctrl, scrambled control; shRNA, short hairpin RNA; TRAF, TNFR-associated factor; TX, Triton X-100; WT, wild-type. Copyright Ó 2014 by The American Association of Immunologists, Inc. 0022-1767/14/$16.00 www.jimmunol.org/cgi/doi/10.4049/jimmunol.1300842

anticancer therapy and vaccination (5). It is therefore crucial to elucidate the exact molecular mechanism by which SFV induces apoptosis in host cells. We previously showed that apoptosis induced by SFV is RNA replication dependent and involves the intrinsic mitochondrial signaling pathway, in particular Bak (4). Bak and Bax are required for mitochondrial outer membrane permeabilization (MOMP) and the subsequent release of cytochrome c, which then activates caspase3 via the Apaf-1/caspase-9 apoptosome (6). Effective MOMP depends on so-called BH3-only proteins that sense the apoptotic stimulus and either directly bind to and activate Bax/Bak or interact with the Bcl-2–like survival factors Bcl-2, Bcl-xL, or Mcl-1 to release Bax/Bak from inhibitory constraints (6). Interestingly, cells infected with SFV or other alphaviruses such as Sindbis continue to die in an apoptotic manner when Bax/Bak are depleted (4) or when Bcl-2 is overexpressed (3, 7, 8). This behavior is typical for apoptosis induced by death receptor signaling (9). However, we were unable to inhibit SFV-induced apoptosis by blocking TNF-a, Fas ligand (FasL), TRAIL, and/or their receptors with neutralizing Abs (4). Nevertheless, caspase-8, a crucial mediator of death receptor signaling clearly was processed and activated in SFV-infected cells (4, 10), and previous studies showed that the caspase-8 inhibitors cytokine response modifier A or FADD-like IL-1 b–converting enzyme-inhibitory protein (FLIP) were able to interfere with alphavirus-induced apoptosis (11, 12). This pointed to a caspase-8–dependent but Bax/Bak- and death receptor–independent apoptosis signaling pathway triggered by SFV. RNA viruses induce an antiviral type I IFN response in infected host cells (13). After receptor-mediated endocytosis, the viruses release their genomic RNA into the cytoplasm where it replicates, producing dsRNA as a byproduct (14). Cytoplasmic viral dsRNA is sensed by a class of ubiquitous cytoplasmic RNA helicases, retinoic acid inducible gene-I (RIG-I) (15), and melanoma differentiation Ag-5 (MDA-5) (16), which trigger an antiviral signaling cascade via their common adaptor called mitochondrial antiviral signaling (MAVS) (also called IFN-b stimulator 1, virus-induced signaling adapter, or caspase activation and recruitment domain adaptor inducing IFN-b) (17–20). This leads to the production


Souhayla El Maadidi,*,† Laura Faletti,*,† Birgit Berg,*,†,1 Christin Wenzl,*,†,2 Katrin Wieland,* Zhijian J. Chen,‡ Ulrich Maurer,*,x,{ and Christoph Borner*,x,{

2

SFV APOPTOSIS BY MAVS/CASPASE-8 INDEPENDENT OF Bax/Bak

Materials and Methods Reagents and Abs Rabbit polyclonal anti–caspase-3 Abs recognizing the 32-kDa proform (9661) and the cleaved active 17-kDa form (9662), rabbit polyclonal anti– Bcl-xL (54H6), rabbit polyclonal anti-mouse, and human MAVS (4983 and 3993); and rabbit monoclonal anti–phospho-eIF2a (pS51, 3597) and rabbit polyclonal anti–poly(ADP-ribose) polymerase (PARP) (9542) were purchased from Cell Signaling Technology. Rat monoclonal anti–caspase-8 Ab (1G12) were from Alexis Biochemicals Enzo Life Sciences, mouse monoclonal anti–Bcl-2 (10C4) from Invitrogen, mouse monoclonal antiactin (clone C4) from BD Biosciences, mouse monoclonal anti-ATPase (7H10) from Molecular Probes, mouse monoclonal anti-dsRNA J2 from English and Scientific Consulting (14), mouse monoclonal anti-PKR and rabbit polyclonal anti-RNase L (H-300) from Santa Cruz Biotechnology, rat monoclonal anti-Fas (7C10) and mouse monoclonal anti-Na+/K+ ATPase a-1 (clone 464.6) from Millipore, and mouse monoclonal anticytochrome c (clone 6H2.B4), HRP-conjugated anti-rabbit, anti-rat, or anti-mouse secondary Abs from Jackson ImmunoResearch Laboratories. Propidium iodide (PI), BSA, Triton X-100 (TX), mouse monoclonal antiFLAG M2 Abs, and the 33 FLAG peptide were bought from SigmaAldrich. Z-VAD.fmk was obtained from MP Biomedicals, acrylamide and DTT from AppliChem, and PageRuler Prestained Protein Ladder from Thermo Scientific. His-GFP-Annexin-V was generated as described previously (36). FLAG-tagged FasL was purchased from Axxora. Alternatively, FasL was used as a multimerized, exosomal form (N2A FasL) secreted from Neuro2A cells stably transfected with a mouse FasL expression vector and provided by A. Fontana (University Clinic of Zurich, Zurich, Switzerland) (37). It was quantified and used for apoptosis assays as described previously (38). The mouse monoclonal anti-FADD Ab (clone 7A2) was provided by A. Strasser (Walter and Eliza Hall Institute, Parkville, VIC, Australia).

Cells The insect cell line Aedes albopictus was maintained at 28˚C in L15 medium (Life Technologies) supplemented with 10% FCS and 4% Difco Bacto phosphate tryptose broth. SV40-transformed and primary MEFs, baby hamster kidney cells (BHK-21), and Vero, HeLa, and HEK293 cells

were grown in high-glucose DMEM (4.5 g/l glucose) supplemented with 10% FCS. MEFs were obtained from different sources (see Acknowledgments); the other cells were purchased from American Tissue Cell Collection.

SFV production and titration The virulent SFV prototype strain L10 was used in this study. Adherent mosquito A. albopictus cells were infected with 20 multiplicity of infection (MOI) SFV in L15 medium supplemented with 10% FCS and 4% Difco Bacto phosphate tryptose broth. After incubating at 28˚C for 24 h, the viral supernatant was harvested, centrifuged at 3000 3 g for 10 min, and stored at 280˚C. Virus titers from the culture medium of infected MEFs (10 MOI) were determined by the plaque assay. Briefly, monolayers of Vero cells with .90% confluency were infected with 10-fold serial dilutions of virus in high-glucose DMEM supplemented with 2% FCS and 20 mM HEPES at 37˚C for 90 min. The inoculum was removed and replaced with an overlay of 0.4% noble agar (Difco; BD Diagnostics). After 48-h incubation at 37˚C, the agar was removed, the monolayer was stained with 1% crystal violet, and the plaques were counted.

Cell death assays SV40-transformed MEFs, human HeLa or HEK293 cells were infected with 10 MOI SFV at 80% confluence while shaking in DMEM plus 0.5% FCS. After 1 h at 37˚C, viral infection was stopped, and the cells were incubated in DMEM plus 10% FCS until processed for further experiments. Alternatively, the cells were treated with 50 ng/ml FasL from the supernatant of Neuro 2A cells (37) or 100 ng/ml Flag-FasL cross-linked with anti-Flag Ab M2 as previously reported (39) or irradiated with UV light (100 J/m2) in a UV Stratalinker. Apoptosis was quantified by His-GFP-annexin-V/PI FACS analysis, and caspase-3/-7 activity was measured by the DEVDase assay as described previously (36). Fluorescence was detected in the Fluoroskan Ascent equipment (Thermo Labsystems), and the relative fluorescence units were normalized to the protein concentration.

Total protein extraction and subcellular fractionation For total extracts, cells were directly lysed in buffer A (25 mM HEPES KOH [pH 7.4], 2 mM MgCl2, and 2 mM EGTA) containing 1% TX and protease inhibitors, and the lysate was left on ice for 20 min before spinning down at 4˚C and 13,000 rpm for 5 min. The supernatant contained the cytosolic and TX-soluble membrane proteins. For subcellular fractionation into cytosol and crude mitochondria, the cells were pelleted, resupended in Mannitol-Sucrose-HEPES buffer (210 mM mannitol, 70 mM sucrose, 20 mM HEPES [pH 7.5], 1 mM EDTA, and complete protease inhibitors), and incubated on ice for 30 min. Afterward, the cells were lysed using a syringe with a 23- to 27-gauge needle until 50% of the cells were broken (trypan blue positive). The nuclei were removed by centrifugation at 500 3 g, and a crude mitochondria (heavy membrane) fraction was obtained by an additional centrifugation step at 13,000 3 g. The mitochondrial fraction was washed twice in Mannitol-Sucrose-HEPES buffer and then resuspended in buffer A containing 1% SDS. The postmitochondrial supernatant was centrifuged at 100,000 3 g, 4˚C for 60 min. The resulting supernatant contains the cytosolic proteins. For the isolation of high-purity plasma membrane protein fractions, we used the Qproteome Plasma Membrane Protein kit of Qiagen, according to the protocol of the manufacturer. Protein concentrations were determined by the Bradford assay.

SDS-PAGE and Western blot analysis Equal amounts of protein were separated on reducing or nonreducing 15% SDS-PAGE and transferred to nitrocellulose membranes. The membranes were blocked in 13 PBS supplemented with 5% milk and 0.05% Tween 20 and incubated with primary Abs (see supplemental information) at 4˚C overnight. After three washings in PBS, secondary HRP-conjugated Abs were added and the membranes incubated at room temperature for 90 min. Proteins were visualized with the ECL SuperSignal West Pico Chemiluminescent Substrate system (Pierce).

Immunoprecipitations To study the MAVS death-inducing signaling complex (DISC), 500 ml (1 mg) TX-solubilized mitochondrial membrane extract from WT, Bax/Bak2/2, MAVS2/2, or Bax/Bak2/2;sh-MAVS MEFs infected with SFV for 0–14 h or treated with Flag-FasL/anti-Flag M2 for 0–12 h was precleared with 100 ml 50% slurry protein G–Sepharose 4 Fast Flow recombinant protein G beads (GE Healthcare Bio-Sciences) on a turning wheel at 4˚C for 1 h. After the supernatants were incubated with 5 ml polyclonal rabbit anti-MAVS on ice


of type I IFNs (IFN-a/b) via NF-kB and IRF-3/-7 transcription factors (13). IFN-a/b then induce, via a common cell surface IFNa/b receptor (IFNAR) and the JAK-STAT signaling pathway, the expression of IFN-inducible, dsRNA-activated protein kinase R (PKR) and 29-59-oligoadenylate synthetase (2-5-OAS) (21, 22). Both enzymes are strongly activated by dsRNA (23, 24). Although PKR blocks protein synthesis by phosphorylating eukaryotic initiation factor 2 a (eIF2a), the 29-59-oligoadenylates generated by OAS activate the latent endonuclease RNase L to degrade viral RNAs (24). Although overexpression of PKR was shown to induce apoptosis (25, 26) and PKR2/2 mouse embryonic fibroblasts (MEFs) were resistant to cell death induced by dsRNA and LPS (27), the role of PKR in the context of RNA virus–induced apoptosis has remained enigmatic (23). In fact, in response to SFV, PKR suppressed viral production and enhanced the type I IFN response rather than inducing apoptosis as PKR2/2 cultures died even faster than wildtype (WT) controls (28). Also, the role of 2-5-OAS in alphavirusinduced apoptosis has remained unclear (29). By contrast, recent studies have implicated MAVS in apoptosis induction by Sendai virus, dengue virus, and reovirus (30–33), by dsRNA/polyinosinicpolycytidylic acid transfection (34), and by cell detachment–induced apoptosis (anoikis) (35). However, the mechanism by which MAVS performs this function and how it links to Bax/Bax activation has remained elusive. In this study, we show that SFV requires MDA-5 and MAVS but not TNFR-associated factor (TRAF)-2, IRF-3/7, IFN-b, IFNAR, PKR, or RNase L for apoptosis induction. This proapoptotic pathway runs independently of Bax/Bak-induced MOMP and involves a SFV-induced recruitment of caspase-8 to MAVS on mitochondria where caspase-8 is activated and required to cleave and activate caspase-3.

The Journal of Immunology

Immunofluorescence MEFs were permeabilized with 0.2% TX for 4 min, washed in 13 PBS, and blocked in 0.05% saponin and 1% BSA for 10 min. The cells were then incubated for 45 min with mouse anti-cytochrome c (1:50) and rabbit anticleaved caspase-3 (1:200), followed by secondary anti-mouse Alexa 488 and anti-rabbit Alexa 546 Abs, diluted 1:200 in blocking buffer for 1 h. For some analysis, the anti-dsRNA Ab was used at a dilution of 1:200. The coverslips were washed in PBS and mounted in Mowiol containing DAPI (Molecular Probes) to stain the cell nuclei. Confocal microscopy was carried out with a laser scanning microscope (LSM 710; Carl Zeiss).

Proximity ligation assay The in situ proximity ligation assay (PLA) is a method recently developed by OLink Bioscience (Uppsala, Sweden) to detect intracellular protein– protein interactions (in-cell colocalization or coimmunoprecipitation). The interaction signal is enhanced by rolling circle amplification of the annealed probes and finally visualized by adding fluorescent oligonucleotides. In this study, the Duolink II Red starter kit was used. A total of 5 3 104 mock or SFV-infected WT MEFs were cytospun at 1200 rpm for 10 min (Shandon Cytospin 4) onto microscopy slides in a defined 6-mm circular area. Cells were fixed in 100 ml 4% paraformaldehyde for 7 min at room temperature, washed twice in 13 PBS, and permeabilized with 0.1% TX for 10 min at 37˚C. After incubating in 40 ml blocking solution provided by the kit, the cells were exposed to rabbit anti-MAVS (or rabbit anti–Bcl-xL as negative control) and rat anti–caspase-8 primary Abs (diluted 1:100 each) or buffer only (negative control) at 37˚C for 2 h. The samples were washed, incubated with the anti-rabbit and anti-rat secondary Abs (PLA probes) from the kit, and amplified as described in the Duolink II protocol. After washing in 0.01% buffer B, the samples were air-dried, mounted, sealed, and subjected to Axiovert fluorescence microscopy. Images were captured with the help of the AxioVision Rel. 4.8 software.

RNA interference and Bcl-xL or Bcl-2 overexpression Lentiviral short hairpin RNAs (shRNAs) to knock down mouse PKR, RNase L, FADD, or mouse/human caspase-8 or MAVS were obtained from Sigma Open Labs. As a control, scrambled shRNAs were used (mouse Ctrl SHC002 or human Ctrl SHC007 luciferase). To produce lentiviruses, 70–80% confluent HEK293T cells were transfected with a combination of 1.5 mg pMD2. G encoding the viral envelope, 3 mg pSPAX2 packaging plasmid, and 5 mg lentiviral vector encoding the shRNA of interest, using the SuperFect transfection reagent (Qiagen). After 3 d of culturing in 5 mM sodium butyrate, the lentivirus-containing medium was removed and passed through a 0.45-mm filter. A total of 2 3 105 WT or Bax/Bak2/2 MEFs or HeLa cells were infected with 400 ml shRNA lentirviral supernatants in the presence of 5 mg/ml polybrene (Sigma-Aldrich) and centrifuged at 2000 rpm at room temperature for 10 min. One to 3 h postinfection, the cells were washed with PBS, cultured in full media for at least 18 h, and then selected with puromycin (Sigma-Aldrich) for stable expression of the shRNA construct of interest. For Bcl-xL or Bcl-2 overexpression, 1 3 106 WT or caspase-82/2 MEFs or HeLa or HEK293 cells were transfected with 5 mg human Bcl-xL/ pcDNA3 or mouse Bcl-2/pcDNA3 plasmids (Invitrogen) using the SuperFect transfection reagent, respectively. After 24 h, the cells were put in selection media containing G418 (PAA) and cultured for 5 d to obtain a mixed population of cells stably overexpressing Bcl-xL or Bcl-2. Lentiviral shRNA sequences were as follows: mouse MAVS, 59-CCAGTGCTGATCTATTAGGAA-39; human MAVS, 59-CCGGATGTGGATGTTGTAGAGATTCCTCGAGGAATCTCTACAACATCCACATTTTTTG-39; mouse caspase-8, 59-ACGACTGCACTGCAAATGAAA-39; human caspase-8, 59-CCGGGCCTTGATGTTATTCCAGAGACTCGAGTCTCTGGAATAACATCAAGGCTTTT-39; FADD1, 59-CCACACTTGGAGCCCAATAAAC-39; FADD2, 59-CGAGCGCGTGAGCAAACGAAA-39; FADD3, 59-CCCAGGAATCTGTGAGCAAGA-39; PKR, 59-GGAGACTTCTGAACAAGAGCAG-39; RNase L, 59-

CCGGCGGGAAGGCATAAACATA-39; scrambled mouse SHC002, 59CAACAAGATGAAGAGCACCAA-39; and scrambled human SHC007, 59CCGGCGCTGAGTACTTCGAAATGTCCTCGAGGACATTTCGAAGTACTCAGCGTTTTT-39.

RNA extraction and RT-PCR Total RNA was isolated from mock- or SFV-infected WT or knockout MEFs by the Qiagen RNA easy Mini Kit, according to the manufacturer’s protocol (Qiagen). Five micrograms of total RNA was reverse transcribed into cDNA using the Invitrogen Superscript First Strand Synthesis Kit (Invitrogen) and the therein provided random hexamer primers as described by the manufacturer. To digest the leftover RNA, 1 ml RNase H was added and incubated at 37˚C for 20 min. Two microliters of the reverse transcriptase–generated cDNA samples was mixed with 18 ml PCR mix containing 1 ml of each forward and reverse primer for the candidate gene (10 mM stock) and the Hotstar meteor Taq polymerase. As a negative control, H2O was used, and for normalization, the housekeeping gene actin was coamplified. After 35 cycles of amplification in a Thermal Cycler PTC-225 (MJ Research Biozym), the PCR products were supplemented with 63 Orange Loading Dye and subjected to 2% agarose gel electrophoresis. PCR products were visualized under the UV light. The primers for RT-PCR were as follows: b-actin (forward), 59-TGGCGCTTTTGACTCAGGAT-39; b-actin (reverse), 59-AGCCCTGGCTGCCTCAAC-39; IFN-b (forward), 59-CATCAACTATAAGCAGCTCCA-39; and IFN-b (reverse), 59-TTCAAGTGGAGAGCAGTTGAG-39. The primers for genotyping were as follows: RIG-I (forward), 59-GCATCATCTCTCAGCTGATGAAGGAG A-39; RIG-I (reverse), 59-CCTTACACTTTAGGACCCATAGTGG-39; MDA-5 (forward), 59-CTCTTCTAAGCGTTCCCTGGCTAGTGT-39; MDA-5 (reverse), 59-CTTGGGAAACAGCTCAGTAAAACTG-39; MAVS (forward), 59-TAGCTGTGAGGCAGGACAGGTAAGG-39; and MAVS (reverse), 59-AGCCAAGATTCTAGAAGCTGAGAA-39.

Statistics Statistical significance (p values) was analyzed by a two-tailed Student t test. Data are the means of at least three experiments 6 SEM.

Results SFV infection triggers dsRNA production, cytochrome c release, and caspase-8 and -3 activation We first monitored the kinetics of SFV-induced apoptosis signaling in MEFs. Between 4 and 8 h postinfection with 10 MOI SFV, we detected dsRNA production (Fig. 1A) concomitant with the release of cytochrome c from mitochondria into the cytosol (Fig. 1A, 1C). From 8 h on, caspase-8 and caspase-3 were cleaved into their fully processed, active forms in the cytosol (Fig. 1C). Moreover, cells that had released cytochrome c costained with an Ab against active caspase-3 and showed nuclear condensation/fragmentation typical of apoptosis (Fig. 1A, white arrows). Interestingly, during this time, low amounts of procaspase-8 and -3 seemed to translocate to mitochondria (Fig. 1C, right panels, also see Fig. 6A, 6B). Thus, SFV triggers rapid dsRNA production associated with MOMP and subsequent caspase-3 activation and apoptosis induction. SFV infection launches both Bax/Bak-dependent and -independent signaling pathways to activate caspase-3 and apoptosis MOMP is executed by the pore-forming Bcl-2 family members Bax and Bak (6). We therefore studied SFV-induced apoptosis in Bax/ Bak single- and double-knockout MEFs. As expected, SFV-infected Bax/Bak2/2 MEFs retained cytochrome c in mitochondria in a punctate pattern. However, they still displayed active caspase-3 immunostaining (Fig. 1B, white arrows), caspase-3 processing (Fig. 1D) and activation (Fig. 1E, left graph), PARP cleavage (Fig. 1D), as well as apoptosis induction (Fig. 1E, right graph), although at reduced levels as compared with WT cells (Fig. 1E). Moreover, this Bax/Bak-independent apoptosis was effectively blocked by the general caspase inhibitor Z-VAD.fmk (Fig. 2C, right graph), indicating that SFV activates a Bax/Bak-independent pathway of caspase-3 activation and apoptosis. As expected, although UVinduced apoptosis was entirely Bax/Bak-dependent (Fig. 1E,


for 1 h, 50 ml 50% protein G–Sepharose beads was added, and the mixture was rotated at 4˚C for 2 h. All beads were centrifuged at 8200 3 g, 4˚C for 3 min and washed three times with lysis buffer, and immune complexes were eluted by boiling in Laemmli buffer. The eluted samples were run on nonreducing SDS-PAGE and subjected to anti-MAVS, anti–caspase-8, or anti-FADD Western blot analysis. To study the Fas DISC, 500 ml (500 mg) TX-solubilized plasma membrane extract from WT MEFs was directly incubated with 50 ml 50% protein G–Sepharose beads on a shaker at 4˚C for 2 h to pull down the Flag-FasL-Fas receptor complex performed by anti-Flag cross-linking. After the beads were centrifuged and washed, the complex was eluted by 50 ml 33 Flag peptide. The eluted sample was run on nonreducing SDS-PAGE and subjected to anti-Fas, anti–caspase-8, and anti-FADD Western blot analysis.

3

4

SFV APOPTOSIS BY MAVS/CASPASE-8 INDEPENDENT OF Bax/Bak right graph), FasL triggered caspase-3 and PARP cleavage (Figs. 1D, 2A) and caspase-3 activation (Fig. 1E, left graph) to similar extents in WT and Bax/Bak2/2 cells because it did not require the intrinsic mitochondrial pathway in MEFs (type I signaling) (9). Caspase-8 is required for SFV-induced caspase-3 activation and apoptosis in the absence of Bax/Bak or when Bcl-xL or Bcl-2 are overexpressed

FIGURE 1. SFV provokes dsRNA formation and induces apoptosis by Bax/Bak-dependent cytochrome c release and caspase-3 activation as well as independently of Bax/Bak and cytochrome c release but still involving caspase-3. (A and B) Anti-dsRNA (red), cytochrome c (green), and cleaved caspase-3 (red) immunofluorescence analysis of SV40-transformed WT (A) and WT and Bax/Bak2/2 (B) MEFs infected with SFV for 0–8 h. Nuclei were stained with DAPI (blue). Original magnification 3400. In (A), the middle and lower panels show the same cells, whereas the cells in the upper panel were different but taken at the same hour postinfection

(hpi). Active caspase-3 colocalizes with diffuse (A) or punctate, mitochondrial (B) cytochrome c (see arrows). (C) Anti-cytochrome c, caspase-8 (recognizing both the proform and the cleaved p18 form), caspase-3, and cleaved caspase-3 Western blots of cytosolic and mitochondrial fractions of MEFs at 0–14 hpi. (D) Anti–caspase-3, cleaved caspase-3, and PARP Western blots of total extracts of SV40-transformed WT, Bax2/2, Bak2/2, or Bax/Bak2/2 MEFs infected with SFV for 0–36 h (hpi). As controls for effective caspase-8 and -3 processing and PARP cleavage, MEFs were treated with 50 ng/ml FasL (Neuro 2A supernatant) for 6 h. Anti-ATPase and -actin Western blots served as controls for equal loading of mitochondrial or cytosolic proteins, respectively. Molecular weight markers are shown on the right. (E) Cytosolic caspase-3/-7 (DEVDase) activity assay (left graph) or annexin-V/PI FACS analysis (right graph) of SV40-transformed WT or Bax/Bak2/2 MEFs infected with SFV for 0–36 h (hpi), treated with 50 ng/ ml FasL for 6 h, or exposed to 100 J/m2 UV light (UV) for 24 h. Data in (E) are the means of at least three independent experiments 6 SEM. The p values are the following: Bax/Bak2/2 versus WT cells, caspase-3/-7: p = 0.01 for SFV 6 h; p , 0.001 for SFV 10, 14, and 24 h. Bax/Bak2/2 versus WT cells, apoptosis: p , 0.001 for SFV 14, 24, and 36 h and UV; for all n = 4.


We assumed that caspase-8 was responsible for SFV-induced caspase-3 activation and apoptosis in Bax/Bak2/2 cells because it was processed/activated simultaneously with caspase-3 (Fig. 1C). We therefore downregulated caspase-8 in Bax/Bak2/2 MEFs by lentiviral shRNA transfer. Although we could not fully deplete caspase-8 with this technique (Fig. 2A, Supplemental Fig. 1A), SFV-infected Bax/Bak2/2;sh-Casp-8 MEFs lacked caspase-8 and caspase-3 processing and PARP cleavage (Fig. 2A) and cytosolic caspase-3/-7 (DEVDase) activity (Fig. 2B, right graph, black columns). Moreover, these cells almost fully were protected against SFV-induced apoptosis as compared with Bax/Bak2/2;sh-Ctrl cells (Fig. 2C, right graph, black columns). By contrast, UV-induced apoptosis was not influenced by caspase-8 levels (Fig. 2C, right graph). In contrast, as expected, FasL was still able to use the remaining levels of caspase-8 in Bax/Bak2/2;sh-Casp-8 to directly activate caspase-3 via the type I signaling pathway, although to a lesser extent (Fig. 2A, 2B, right graph). Importantly, a partial requirement of caspase-8 for caspase-3 activation and apoptosis after SFV infection already was seen when caspase-8 was downregulated in WT MEFs (WT;sh-Casp-8) (Supplemental Figs. 1A, 2B, 2C, left graphs), indicating that SFV-triggered, caspase-8–mediated caspase-3 activation occurs in parallel to the classical Bax/ Bak-dependent pathway but the latter seems to be dominant. To exclude a clonal effect of the Bax/Bak2/2 MEFs and to confirm the caspase-8–mediated effect on caspase-3 activation by another strategy, we generated caspase-82/2 MEFs overexpressing Bcl-xL (Fig. 3A). As shown above for Bax/Bak2/2 cells, WT MEFs overexpressing Bcl-xL still showed caspase-3 processing (Fig. 3B) and cytosolic activity (Fig. 3C, left graph) as well as apoptosis induction (Fig. 3D, left graph) in response to SFV, although to a lower extent. Caspase-8 depletion partially diminished these parameters as well, but SFV could still trigger caspase-3 activation and apoptosis via Bax/Bak-mediated MOMP. By contrast, overexpression of Bcl-xL in caspase-82/2 MEFs abrogated SFV-induced caspase-3 processing and activation (Fig. 3B, 3C, right graph, black columns) and effectively saved the cells from apoptosis (Fig. 3D, right graph, black columns). As expected, UV-induced apoptosis


5

still occurred in caspase-82/2 cells but not when Bcl-xL was overexpressed (Fig. 3D), and FasL-induced caspase-3 activation entirely depended on caspase-8 but not on Bcl-xL overexpression (type I cells) (Fig. 3C). Similar results were obtained in two entirely different cellular systems, human HeLa and HEK293 cells. In this study, also stable overexpression of Bcl-2 (Supplemental Fig. 1B) could not prevent SFV-induced caspase-3 processing (Supplemental Fig. 1C), caspase-3 activation (Supplemental Fig. 1D, right graphs), and apoptosis (Supplemental Fig. 1E, right graphs), whereas the shRNA-mediated depletion of caspase-8 (Supplemental Fig. 1B) in these cells drastically diminished all these events (Supplemental Fig. 1C–E). Thus, our data clearly

show that SFV induces caspase-3 activation and apoptosis via both Bax/Bak-dependent and Bax/Bak-independent, caspase-8–dependent processes in MEFs, HeLa, and HEK293 cells. The antiviral signaling components PKR and RNase L are not required for SFV-induced apoptosis in WT and Bax/Bak2/2 cells We wondered by which signaling pathway SFV induced Bax/Bakindependent caspase-3 activation and apoptosis. Positive-sense ssRNA viruses activate innate antiviral signaling leading to type I IFN-a/b induction and subsequent virus inhibition via PKR and RNase L activation. Both PKR (23) and RNase L (29) have been suggested to sensitize cells for virus-induced apoptosis. We therefore


FIGURE 2. SFV-induced caspase-3 processing/activation and apoptosis in Bax/Bak2/2 MEFs is dependent on caspase-8. (A) Anti–caspase-8/cleaved caspase-8, caspase-3, cleaved caspase-3, and PARP Western blots of total extracts of SV40-transformed Bax/Bak2/2 MEFs stably expressing sh-Casp-8 or sh-Ctrl infected with SFV for 0–14 h (hour postinfection [hpi]) or treated with 50 ng/ml FasL for 6 h. Anti-actin immunoblots served as control for equal protein loading. Cytosolic caspase-3/-7 (DEVDase) activity assay (B) or annexin-V/PI FACS analysis (C) of SV40-transformed WT (left graphs) or Bax/Bak2/2 MEFs (right graphs) expressing sh-Casp-8 or sh-Ctrl (scrambled control), infected with SFV for 0–36 h (hpi), treated with 50 ng/ml FasL for 6 h or exposed to 100 J/m2 UV light (UV) for 24 h. In (C), Bax/ Bak2/2 MEFs also were treated with 100 mM Z-VAD.fmk (dotted bars). Data in (B, C) are the means of at least three independent experiments 6 SEM. The p values are the following: WT; sh-Casp-8 versus WT; sh-Ctrl cells (B): p = 0.02 for SFV 6 h and 10 h; p = 0.01 for SFV 14 and 24 h and FasL. Bax/Bak2/2; sh-Casp-8 versus Bax/Bak2/2; shCtrl cells (B): p , 0.001 for SFV 6, 10, 14, and 24 h; p = 0.003 for FasL. WT; sh-Casp-8 versus WT; sh-Ctrl cells (C): p = 0.01–0.005 for SFV 14, 24, and 36 h. Bax/Bak2/2; shCasp-8 and Bax/Bak2/2; Z-VAD.fmk versus Bax/Bak2/2; sh-Ctrl cells (C): p , 0.001 for SFV 24 and 36 h and UV; for all n = 4.

6


tested whether these enzymes also were involved in SFV-induced apoptosis. SV40-transformed PKR2/2, RNase L2/2, and PKR/ RNase L2/2 MEFs clearly lacked PKR and/or RNase L expression (Supplemental Fig. 2A), and SFV-induced eIF2a phosphorylation, critical for PKR-mediated protein synthesis inhibition, was inhibited effectively in the PKR/RNase L2/2 cells (Supplemental Fig. 2B). However, neither the absence of PKR or RNase L nor both had any delaying effect on SFV-induced apoptosis (Supplemental Fig. 2C). Because a proapoptotic effect of PKR and/or RNase L may only be revealed in the absence of the dominant Bax/ Bak-mediated signaling pathway, we knocked down PKR and/or RNase L expression in Bax/Bak2/2 MEFs by shRNA either completely (PKR) or by 90% (RNase L), respectively (Supplemental Fig. 2D). Despite that, the kinetics of SFV-induced apoptosis were indistinguishable between Bax/Bak2/2 cells expressing the scram-

bled control (sh-Ctrl), sh-PKR, sh-RNase L, or both sh-PKR and shRNase L (Supplemental Fig. 2E). This finding shows that neither PKR nor RNase L is required for Bax/Bak-dependent or -independent apoptosis induced by SFV. MAVS is crucial for both SFV-induced type I IFN induction and Bax/Bak-independent caspase-8 and caspase-3 activation and apoptosis To investigate whether the RIG-I/MDA-5 dsRNA sensing pathway was involved in SFV-induced apoptosis, we infected RIG-I2/2 and MDA-52/2 MEFs with SFV for up to 36 h (Supplemental Fig. 3A). Although the lack of RIG-I did not have any impact on the sensitivity of SFV-induced apoptosis, MDA-5 deficiency significantly delayed the death response at all time points (Supplemental Fig. 3B). As expected, neither helicase was involved in apoptosis


FIGURE 3. Bcl-xL overexpression effectively inhibits SFV-induced caspase-3 activation and apoptosis only when caspase-8 is deleted. (A) Anti–caspase-8 and Bcl-x Western blots showing the deletion of caspase-8 and the overexpression of Bcl-xL in SV40-transformed WT or caspase-82/2 MEFs. (B) Anti–caspase-3 and cleaved caspase-3 Western blots of total extracts of SV40-transformed WT or caspase82/2 MEFs overexpressing Bcl-xL or not infected with SFV for 0–36 h (hour postinfection [hpi]). Anti-actin immunoblots served as control for equal protein loading. Cytosolic caspase-3/-7 activity assay (C) or annexin-V/PI FACS analysis (D) of SV40-transformed WT (left graphs) or caspase-82/2 (right graphs) MEFs in the absence or presence of Bcl-xL overexpression, either infected with SFV for 0–24 h (hpi), treated with 50 ng/ml FasL for 6 h, or exposed to 100 J/m2 UV light (UV) for 24 h. Data in (C, D) are the means of at least three independent experiments 6 SEM. The p values are the following: WT + Bcl-xL versus WT cells (C): p = 0.03 for SFV 6 and 10 h; p = 0.01 for SFV 14 and 24 h. Casp-82/2 + Bcl-xL versus Casp-82/2 cells (C): p , 0.001 for SFV 6, 10, 14, and 24 h. WT + Bcl-xL versus WT cells (D): p = 0.01 for SFV 14 and 24 h; p = 0.03 for SFV 36 h; p , 0.001 for UV. Casp-82/2 + Bcl-xL versus Casp-82/2 cells (D): p , 0.001 for SFV 14, 24, and 36; for all n = 4.

The Journal of Immunology induced by an unrelated death stimulus such as UV (Supplemental Fig. 3B). Because both RIG-I and MDA-5 mediate antiviral signaling through MAVS, we analyzed SFV-induced apoptosis sensitivity in primary and SV40-transformed MAVS2/2 MEFs. Both cell lines clearly lacked MAVS expression (Supplemental Fig. 3C) and did not show any IFN-b induction in response to SFV (Supplemental Fig. 3D). This confirms that MAVS is the major mediator of type I IFN expression after SFV infection.

Similar to MDA-52/2 cells, both primary and SV40-transformed MAVS2/2 MEFs were significantly delayed in SFV-induced apoptosis (Fig. 4A) and showed diminished caspase-3 activities as compared with WT cells at all time points postinfection (Fig. 4B). However, the lack of MAVS did not affect UV-induced apoptosis or FasL-induced caspase-3 activation, respectively (Fig. 4A, 4B). Moreover, the kinetic of cytochrome c release was similar between MAVS2/2 and WT (MAVS+/+) cells (Fig. 4C, 4D), indicating that


FIGURE 4. MAVS deficiency delays SFV-induced caspase-8 and -3 processing/activation and apoptosis but has no effect on cytochrome c release. Annexin-V/PI FACS analysis (A) or cytosolic caspase-3/-7 activity assay (B) of SV40-transformed or primary MAVS+/+ and MAVS2/2 MEFs, infected with SFV for 0–36 h (hour postinfection [hpi]), treated with 50 ng/ml FasL for 6 h, or exposed to 100 J/m2 UV light (UV) for 24 h. (C) Anti-cytochrome c Western blots of mitochondrial and cytosolic extracts of primary MAVS+/+ and MAVS2/2 MEFs infected with SFV for 0–14 h. (D) Anti-cytochrome c (green) and cleaved caspase-3 (red, white arrows) immunofluorescence analysis of primary MAVS+/+ and MAVS2/2 MEFs, mock-, or SFV-infected for 8 h. Original magnification 3400. (E) Anti–caspase-8/cleaved caspase-8, caspase-3, and cleaved caspase-3 Western blots of total extracts of primary MAVS+/+ and MAVS2/2 MEFs infected with SFV for 0– 14 h or treated with 50 ng/ml FasL for 6 h. Anti-ATPase and actin immunoblots served as controls for equal protein loading. Data in (A, B) are the means of at least three independent experiments 6 SEM. The p values are the following: Values MAVS2/2 versus MAVS+/+ cells (A): p = 0.01–0.02 for SFV 14, 24, and 36 h; not significant for SFV 36 h transformed. MAVS2/2 versus MAVS+/+ cells (B): p = 0.01–0.03 for SFV 6, 12, 14, and 24 h; for all n = 3.

7

8


FIGURE 5. SFV-induced, Bax/Bak-independent caspase-3 activation and apoptosis are mediated by MAVS. (A) AntiMAVS Western blot showing efficient knockdown of MAVS expression (sh-MAVS) in SFV-infected, SV40-transformed Bax/Bak2/2 MEFs as compared with the sh-Ctrl. A total extract of MAVS2/2 MEFs is shown as a control. Annexin-V/PI FACS analysis (B) and cytosolic caspase-3/-7 activity assay (C) of SV40-transformed Bax/Bak2/2 MEFs stably expressing a scrambled sh-Ctrl or sh-MAVS, infected with SFV for 0–36 h (hour postinfection [hpi]), treated with 50 ng/ml FasL for 6 h, or exposed to 100 J/m2 UV light (UV) for 24 h. (D) Anti– caspase-8/cleaved caspase-8, caspase-3, cleaved caspase-3, and PARP Western blots of total extracts of sh-Ctrl and sh-MAVS Bax/Bak2/2 MEFs infected with SFV for 0–36 h. Anti-actin immunoblots served as control for equal protein loading. Data in (B, C) are the means of at least three independent experiments 6 SEM. The p values are the following: Bax/Bak2/2; sh-MAVS versus Bax/Bak2/2; sh-Ctrl (B): p = 0.02 for SFV 14 h; p , 0.001 for SFV 24 and 36 h. Bax/Bak2/2; sh-MAVS versus Bax/Bak2/2; sh-Ctrl (C): p , 0.001 for SFV 6, 12, 14, and 24 h; for all n = 4.

(Supplemental Fig. 4E), and apoptosis (Supplemental Fig. 4F). These data demonstrate that MAVS mediates SFV-induced caspase8 and caspase-3 activation and apoptosis in the absence of Bax/Bak in three independent cellular systems. SFV, but not FasL triggers Bax/Bak-independent, MAVSdependent mitochondrial translocation of caspase-8 and the formation of a novel MAVS/caspase-8 DISC that does not contain FADD We envisaged the possibility that MAVS may activate caspase-8 by recruiting it from the cytosol to mitochondria. Although mitochondriaassociated caspase-8 has been reported (40, 41), its predominant sequestration and complex formation occurs at activated death receptors in the plasma membrane. Formation of this complex, called DISC, requires the adaptor FADD, which binds to the cytoplasmic side of activated death receptors via a death domain and to caspase-8 via a death effector domain (9). We therefore compared the formation of the classical caspase-8/FADD DISC at the plasma membrane in response to FasL treatment to a possible formation of a novel MAVS/caspase-8 DISC on mitochondria after SFV infection. In addition, we wanted to know whether the mitochondrial MAVS/caspase-8 DISC also could be formed in response to FasL. As previously reported, MAVS constitutively localizes to mitochondria and shows a double-band pattern on SDS-PAGE (Fig. 6A). Fas, in contrast, is known to be a cell surface receptor on the plasma membrane (9). Next, we determined the change of subcellular distribution of caspase-8 in response to either SFV infection or


MAVS regulated an apoptotic pathway different from Bax/Bakmediated MOMP. Indeed, as shown in Fig. 4E, MAVS seemed to control caspase-8–mediated caspase-3 processing and activation in response to SFV because both the appearance of the active p18 caspase-8 and p17 caspase-3 fragments were delayed significantly in MAVS2/2 MEFs. Again, no effect on the generation of these fragments was noted in response to FasL. Because it is known that MAVS triggers an antiviral IFN-b response, we examined whether apoptosis signaling by MAVS was through the downstream adaptor protein TRAF-2, the transcriptional IFN-b inducers IRF-3 and IRF-7, IFN-b itself, or its receptor IFNAR. However, MEFs deficient in these mediators did not display any reduction of SFVinduced apoptosis (Supplemental Fig. 3E). Because we suspected that MAVS-mediated caspase-8 activation occurred independently of the Bax/Bak signaling pathway, we downregulated MAVS by shRNA in Bax/Bak2/2 MEFs. The drastic reduction of MAVS protein levels (Fig. 5A, Supplemental Fig. 4A, left blot) almost completely ablated SFV-induced caspase-3 activation and apoptosis in Bax/Bak2/2 cells (Fig. 5B, 5C). Concomitantly, caspase-8 and caspase-3 processing as well as PARP cleavage, which still occurred in the Bax/Bak doubly deficient cells, were entirely ablated when MAVS was downregulated (Fig. 5D). Similar results were obtained in HeLa and HEK293 cells overexpressing Bcl-2. The effective downregulation of MAVS by shRNA (Supplemental Fig. 4A, middle and right blots) prevented SFV-induced caspase-8 (Supplemental Fig. 4C) and caspase-3 (Supplemental Figs. 4B, 4D) processing, caspase-3 activation


FIGURE 6. SFV but not FasL triggers mitochondrial translocation of caspase-8 with MAVS in a Bax/Bak-independent manner. (A) Anti-MAVS and caspase-8 Western blots of mitochondria (containing Bax/Bak) from SV40-transformed MAVS+/+ and MAVS2/2 MEFs (left blot) as well as from Bax/Bak2/2 MEFs stably expressing sh-MAVS or sh-Ctrl (right blot), infected with SFV for 0–24 h (hour postinfection [hpi]). (B) Anti–caspase-8 Western blots of cytosolic (Cyt), plasma membrane (PM), or mitochondrial (Mito) fractions of WT MEFs, either treated with 100 ng/ml Flag-FasL and anti-Flag Ab or infected with SFV for 0–8 h. A total of 250 ng Flag–FasL was cross-linked with 250 ng anti-Flag Ab. Anti-actin (43 kDa), anti-Na+/K+ ATPase a-1 (112 kDa), and antiATPase (50 kDa) immunoblots served as controls for equal protein loading of Cyt, PM, and Mito fractions, respectively.

performed a PLA on mock and SFV-infected MEFs. No interaction between MAVS and caspase-8 could be detected in mock-infected cells or when only secondary Abs were used for the PLA (Fig. 7D, right pictures). In addition, caspase-8 did not interact with an irrelevant protein such as Bcl-xL (Fig. 7D, middle pictures). However, at 8 h postinfection, anti-MAVS and anti–caspase-8 incubation revealed amplified red fluorescence signals (Fig. 7D, left pictures) indicative of a close proximity of endogenous MAVS and caspase-8 after viral infection. To confirm that FADD did not play any role in caspase-8 activation in the mitochondrial MAVS DISC, we downregulated FADD by shRNA in Bax/Bak2/2 MEFs. As shown in Fig. 8A–C, despite a successful knockdown of FADD, the kinetics of SFV-induced caspase-3 activation and apoptosis in Bax/Bak2/2;sh-FADD cells were indistinguishable from the scrambled Bax/Bak2/2;sh-Ctrl cells. By contrast, as expected, FADD depletion completely inhibited FasL-induced caspase-3 activation and apoptosis (Fig. 8B, 8C). Taken together, our findings suggest that although Fas induced a caspase-8/FADD DISC on the plasma membrane, SFV triggered a novel MAVS/caspase-8 DISC on mitochondria that does not include FADD but leads to caspsae-8 activation and downstream processing of caspase-3 independent of Bax/Bak.

Discussion In this study, we show that SFV, a positive-sense ssRNA virus, stimulates the formation of a novel mitochondrial platform consisting of the innate immune signaling component MAVS and the initiator caspase-8. The purpose of this platform is to trigger caspase-3 activation and apoptosis in an entirely Bax/Bak- and death receptor/FADD–independent manner. The signaling pathway leading to this event is initiated by dsRNA, transiently formed during the RNA replication cycle of the virus. The dsRNA is immunodetected in the cytoplasm of infected cells before caspase-3


the cellular treatment with a Flag-tagged FasL cross-linked with anti-Flag Abs (39). Although the bulk of cytosolic p51 procaspase-8 rapidly redistributed to the plasma membrane after Flag-FasL treatment and was processed into its active p43 form (Fig. 6B, top blot), a minor portion of procaspase-8 accumulated on mitochondria in response to SFV infection where it was slightly processed as well (Fig. 6A, 6B, lower blot). No caspase-8 was detected on mitochondria after FasL treatment, and SFV did not recruit any caspase8 to the plasma membrane (Fig. 6B). Importantly, the mitochondrial translocation of caspase-8 in response to SFV was dependent on MAVS but independent of Bax/Bak, because it did not occur in MAVS2/2 or Bax/Bak2/2;sh-MAVS but still in Bax/Bak2/2;shCtrl MEFs (Fig. 6A). Moreover, it perfectly coincided with the time of SFV-induced caspase-8 and caspase-3 processing (Fig. 1C). This indicates that MAVS may attract caspase-8 to mitochondria once it gets activated by the dsRNA-induced innate antiviral signaling of SFV. This process is Bax/Bak-independent and cannot be mimicked by FasL. Indeed, when we immunoprecipitated MAVS from the mitochondria of SFV-infected MEFs, we found that both full-length and partially cleaved caspase-8 gradually associated with MAVS with time of infection (Fig. 7A, 7C, right blots). Again, this interaction was dependent on MAVS but independent of Bax/Bak (Fig. 7A). Surprisingly, no FADD was found in these MAVS immunoprecipitations, despite the fact that caspase-8 was even partially processed to the active p43 form (cleaved Casp-8) (Fig. 7A, 7C, right blots). Conversely, after cells were treated with Flag-FasL crosslinking, MAVS did not pull down caspase-8 from a mitochondrial fraction (Fig. 7C, left blots), whereas, expectedly, the plasma membrane Fas DISC immunoprecipitated with anti-Flag Abs contained caspase-8 and FADD (Fig. 7B). Because immunoprecipitations of membrane proteins may produce artifacts because of the detergent and salt conditions chosen, we

9

10



FIGURE 7. SFV but not FasL induces caspase-8/ MAVS association (MAVS DISC) on mitochondria in the absence of FADD and independent of Bax/Bak. (A) Anti-MAVS and caspase-8 Western blots of anti-MAVS immunoprecipitations from mitochondrial extracts of MAVS+/+ and MAVS2/2 cells (containing Bax/Bak, left blots) or sh-Ctrl and sh-MAVS Bax/Bak2/2 cells (right blots) infected with SFV for 0–14 h. IgL and asterisk mark cross-reactive L and H chains, respectively. (B) Anti-Fas, caspase-8, and FADD Western blots of 33 FLAG peptide-eluted anti-Flag immunoprecipitations from plasma membrane extracts of WT MEFs treated with Flag-FasL and anti-Flag Ab (250 ng each) for 0– 12 h. (C) Anti-MAVS, anti–caspase-8, and anti-FADD Western blots of anti-MAVS immunoprecipitations from mitochondrial extracts of WT MEFs either treated with Flag-FasL/anti-Flag for 0–12 h (left blots) or infected with SFV for 0–24 h (hour postinfection [hpi]) (right blots). (D) PLA of endogenous MAVS and caspase-8 in mock and SFV-infected (8 hpi) MEFs, using rabbit polyclonal anti-MAVS (or rabbit polyclonal anti–Bcl-x as negative control) and mouse monoclonal anti–caspase8 primary Abs and the respective anti-rabbit and antimouse PLA probes or the PLA probes alone as control (only secondary Ab). Original magnification 3400. CL Casp-8, Cleaved p43 caspase-8; FL Casp-8, full-length p51 procaspase-8.

activation, and cells deficient for MAVS or MDA-5, the preferred cytoplasmic receptor for dsRNA produced by positive-strand RNA viruses, are partially protected from SFV-induced apoptosis. Importantly, Bax/Bak2/2 cells dying in a MAVS/caspase-8–dependent manner do not switch to an alternative death mode such as necroptosis because they still show apoptotic features such as nuclear fragmentation and caspase-3 activation, and they are not protected by the necroptosis inhibitor necrostatin-1 (data not shown). More-

over, it is known that caspase-8 inhibits rather than activates necroptosis (9). We propose that the MAVS- and caspase-8–dependent apoptosis signaling pathway runs in parallel with the canonical Bax/Bakregulated MOMP pathway for the following reasons: 1) SFVinfected Bax/Bak2/2 and Bcl-xL overexpressing MEFs and Bcl-2 overexpressing HEK293 and HeLa cells still show significant caspase-3 activation and apoptosis induction suggesting the existence


11

of another caspase-dependent pathway unaffected by MOMP. 2) Although caspase-82/2 and MAVS2/2 MEFs are retarded in cell death, they are not saved from SFV-induced caspase-3 activation and apoptosis. 3) Effective death protection is only achieved when MAVS or caspase-8 are depleted in Bax/Bak2/2 or Bcl-xL overexpressing MEFs or Bcl-2 overexpressing HEK293 or HeLa cells. Our finding therefore reveals that RNA viruses such as SFV can still kill their target cells via a MAVS/caspase-8 pathway when the major MOMP pathway is perturbed. This may be relevant for eliminating cells in which Bax or Bak are defective or Bcl-2 survival factors are overexpressed such as in cancer or autoimmune cells (6). Indeed, we previously reported that Bcl-2 overexpressing cells are effectively killed by SFV because Bcl-2 is cleaved by caspase-3 at its unstructured loop region, generating a N-terminally truncated Bcl-2 that even exhibits proapoptotic activity (3). In this study, we now show that the MAVS/caspase-8 pathway activates caspase-3 under these conditions, bypassing the Bcl-2 block. Hence, Bcl-2 overexpressing tumors may be selective targets for anticancer therapy using SFV-related viral vectors or dsRNA derivatives, an approach that has been initiated recently (5, 8, 42, 43). These agents also may be combined with currently used BH3 mimetics or Bcl-2 inhibitors such as ABT737 (6) to increase the efficacy of tumor killing via both Bax/Bak- and MAVS/caspase-8–dependent pathways. MAVS is required for effective antiviral responses to RNA viruses via the induction of type I IFNs (IFN-a/b) (17–20), and we confirm this function in our study for SFV. Moreover, MAVS was suggested to mediate apoptosis from its mitochondrial site of action, but it has remained elusive how it collaborates with the classical Bax/Bak-mediated MOMP pathway on this organelle and then activates effector caspases-3/-7 in the cytosol. Sendai virus, dengue virus, and reovirus were reported to use the same downstream signaling components of MAVS for apoptosis and IFN-b production, in particular the transcription factor IRF-3 (30–34). Although in one case IRF-3 triggered MOMP and caspase-3 through transcriptional induction of the proapoptotic BH3-only proteins Puma and Noxa (34), in the other case, it seemed to directly interact and activate Bax (32). We cannot confirm these IRF-3–dependent mechanisms because SFV triggered apoptosis entirely independent of the MAVS downstream signaling components TRAF-2, IRF-3, IRF-7, IFN-b, or the common IFNAR. It

also did not involve components activated by the IFNAR signaling such as PKR or RNaseL, which are additional targets of dsRNA previously implicated in RNA virus-induced apoptosis (23, 29). Rather, the MAVS-mediated apoptotic pathway induced by SFV was independent of Bax/Bak and any type I IFN signaling components downstream of MAVS but required caspase-8. Caspase-8 is an obligatory component of death receptor signaling and its activation requires a protein platform called the DISC (9). Could caspase-8 also be involved in other signaling pathways forming other DISCs? We confirm that FasL induces the translocation of most of cytosolic procaspase-8 to the FasR on the plasma membrane where it gets processed and activated. SFV infection, in contrast, triggers the association of a minor part of procaspase-8 with mitochondria where it is also processed and activated but by forming a DISC with MAVS. The opposite effects, FasL triggering a MAVS DISC or SFV promoting a Fas DISC cannot be seen, indicating that the two protein complexes form under different apoptotic circumstances. Caspase-8 has indeed been found on mitochondria (40, 41) and also reported to form protein complexes with Bap31/Bap29 on the endoplasmic reticulum (44) and with Atg5 and p62 on autophagosomes (45). Moreover, caspase-8 recently has been implicated in Bax/Bakindependent apoptosis induced by glucose deprivation (46). Finally, caspase-8 formed an atypical death complex with TLR3, which stimulates a type I IFN response via TRIF, TRAF-6, and receptor-interacting protein 1 that is independent of RIG-I/MDA-5 and MAVS, mainly in response to extracellular dsRNA released during viral infections (13, 47). With regard to MAVS signaling, caspase-8 was found to be cleaved and activated in response to dsRNA and required for NF-kB activation and IFN-b production (48). Moreover, FLIP, an inhibitor of caspase-8, suppressed these events, and FLIP2/2 cells were more susceptible to dsRNA-induced apoptosis (49). Most strikingly, caspase-8 seemed to interact with MAVS on mitochondria in response to DAP-3–mediated anoikis (35). However, MAVS depletion diminished cell death only by 10–20%, and it was unclear how MAVS could be activated by a stimulus unrelated to dsRNA and whether caspase-8 activation and its association with MAVS were required for anoikis. Thus, our study clearly shows that both MAVS and caspase-8 are required for SFV-induced apoptosis, that their association on mitochondria is induced after SFV infection, and that this process does not need the


FIGURE 8. SFV-induced, Bax/Bak-independent caspase-3 activation and apoptosis do not require FADD. (A) Anti-FADD Western blot, showing efficient knockdown of FADD expression in SFV-infected SV40-transformed Bax/Bak2/2 MEFs as compared with the sh-Ctrl using three different FADD shRNAs (sh-FADD1, shFADD2, and sh-FADD3). A total extract of FADD2/2 MEFs is shown for comparison. Anti-actin immunoblots served as control for equal protein loading. Annexin-V/ PI FACS analysis (B) and cytosolic caspase-3/-7 activity assay (C) of SV40-transformed Bax/Bak2/2 MEFs stably expressing a scrambled sh-Ctrl or sh-FADD1, infected with SFV for 0–36 h (hour postinfection [hpi]) or treated with 50 ng/ml FasL for 6 h. Note that FADD depletion did not inhibit caspase-3 activation and apoptosis induced by SFV but by FasL. Data in (B, C) are the means of at least three independent experiments 6 SEM. The p values are the following: Bax/Bak2/2; sh-FADD1 versus Bax/Bak2/2; sh-Ctrl (C, D): not significant for SFV 14, 24, and 36 h; p , 0.001 for FasL, n = 4.

12


Acknowledgments We thank Hiroki Kato (Osaka, Japan) for the RIG-I2/2 and MDA-52/2 MEFs; Robert H. Silverman (Cleveland, OH) for the PKR2/2, RNase-L2/2, and PKR/RNase-L2/2 MEFs; Ian Gentle (Freiburg, Germany) for the caspase-82/2 MEFs; Georg Ha¨cker (Freiburg, Germany) for the TRAF22/2, IRF-32/2, and IRF-3/72/2 MEFs; Friedemann Weber (Marburg, Germany) for the anti-dsRNA Ab and the IFNb2/2 and IFNAR2/2 MEFs; Andreas Strasser, (Walter and Eliza Hall Institute, Parkville, VIC, Australia) for the anti-FADD Ab, the Bax2/2, Bak2/2, and Bax/Bak2/2 as well as the FADD2/2 MEFs; Cristina Munõz-Pinedo (Barcelona, Spain) for the Bax/Bak2/2;sh-Ctrl and Bax/Bak2/2;sh-Casp-8 MEFs; and Gabriel Nunez (Ann Arbor, MI) for the human Bcl-xL cDNA.

Disclosures The authors have no financial conflicts of interest.

References 1. Strauss, J. H., and E. G. Strauss. 1994. The alphaviruses: gene expression, replication, and evolution. Microbiol. Rev. 58: 491–562.

2. Fazakerley, J. K. 2002. Pathogenesis of Semliki Forest virus encephalitis. J. Neurovirol. 8(Suppl. 2): 66–74. 3. Grandgirard, D., E. Studer, L. Monney, T. Belser, I. Fellay, C. Borner, and M. R. Michel. 1998. Alphaviruses induce apoptosis in Bcl-2-overexpressing cells: evidence for a caspase-mediated, proteolytic inactivation of Bcl-2. EMBO J. 17: 1268–1278. 4. Urban, C., C. Rheˆme, S. Maerz, B. Berg, R. Pick, R. Nitschke, and C. Borner. 2008. Apoptosis induced by Semliki Forest virus is RNA replication dependent and mediated via Bak. Cell Death Differ. 15: 1396–1407. 5. Quetglas, J. I., M. Ruiz-Guillen, A. Aranda, E. Casales, J. Bezunartea, and C. Smerdou. 2010. Alphavirus vectors for cancer therapy. Virus Res. 153: 179–196. 6. Strasser, A., S. Cory, and J. M. Adams. 2011. Deciphering the rules of programmed cell death to improve therapy of cancer and other diseases. EMBO J. 30: 3667–3683. 7. Ubol, S., P. C. Tucker, D. E. Griffin, and J. M. Hardwick. 1994. Neurovirulent strains of Alphavirus induce apoptosis in bcl-2‑expressing cells: role of a single amino acid change in the E2 glycoprotein. Proc. Natl. Acad. Sci. USA 91: 5202–5206. 8. Murphy, A. M., B. J. Sheahan, and G. J. Atkins. 2001. Induction of apoptosis in BCL-2‑expressing rat prostate cancer cells using the Semliki Forest virus vector. Int. J. Cancer 94: 572–578. 9. Dickens, L. S., I. R. Powley, M. A. Hughes, and M. MacFarlane. 2012. The ‘complexities’ of life and death: death receptor signalling platforms. Exp. Cell Res. 318: 1269–1277. 10. Barry, G., R. Fragkoudis, M. C. Ferguson, A. Lulla, A. Merits, A. Kohl, and J. K. Fazakerley. 2010. Semliki forest virus-induced endoplasmic reticulum stress accelerates apoptotic death of mammalian cells. J. Virol. 84: 7369–7377. 11. Nava, V. E., A. Rosen, M. A. Veliuona, R. J. Clem, B. Levine, and J. M. Hardwick. 1998. Sindbis virus induces apoptosis through a caspasedependent, CrmA-sensitive pathway. J. Virol. 72: 452–459. 12. Sarid, R., T. Ben-Moshe, G. Kazimirsky, S. Weisberg, E. Appel, D. Kobiler, S. Lustig, and C. Brodie. 2001. vFLIP protects PC-12 cells from apoptosis induced by Sindbis virus: implications for the role of TNF-a. Cell Death Differ. 8: 1224‑1231. 13. Takeuchi, O., and S. Akira. 2009. Innate immunity to virus infection. Immunol. Rev. 227: 75–86. 14. Weber, F., V. Wagner, S. B. Rasmussen, R. Hartmann, and S. R. Paludan. 2006. Double-stranded RNA is produced by positive-strand RNA viruses and DNA viruses but not in detectable amounts by negative-strand RNA viruses. J. Virol. 80: 5059–5064. 15. Yoneyama, M., M. Kikuchi, T. Natsukawa, N. Shinobu, T. Imaizumi, M. Miyagishi, K. Taira, S. Akira, and T. Fujita. 2004. The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses. Nat. Immunol. 5: 730–737. 16. Kato, H., O. Takeuchi, S. Sato, M. Yoneyama, M. Yamamoto, K. Matsui, S. Uematsu, A. Jung, T. Kawai, K. J. Ishii, et al. 2006. Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature 441: 101–105. 17. Kawai, T., K. Takahashi, S. Sato, C. Coban, H. Kumar, H. Kato, K. J. Ishii, O. Takeuchi, and S. Akira. 2005. IPS-1, an adaptor triggering RIG-I‑ and Mda5mediated type I interferon induction. Nat. Immunol. 6: 981–988. 18. Meylan, E., J. Curran, K. Hofmann, D. Moradpour, M. Binder, R. Bartenschlager, and J. Tschopp. 2005. Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus. Nature 437: 1167–1172. 19. Seth, R. B., L. Sun, C. K. Ea, and Z. J. Chen. 2005. Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kB and IRF 3. Cell 122: 669–682. 20. Xu, L. G., Y. Y. Wang, K. J. Han, L. Y. Li, Z. Zhai, and H. B. Shu. 2005. VISA is an adapter protein required for virus-triggered IFN-b signaling. Mol. Cell 19: 727–740. 21. Der, S. D., A. Zhou, B. R. Williams, and R. H. Silverman. 1998. Identification of genes differentially regulated by interferon a, b, or g using oligonucleotide arrays. Proc. Natl. Acad. Sci. USA 95: 15623–15628. 22. Geiss, G., G. Jin, J. Guo, R. Bumgarner, M. G. Katze, and G. C. Sen. 2001. A comprehensive view of regulation of gene expression by double-stranded RNAmediated cell signaling. J. Biol. Chem. 276: 30178–30182. 23. Garcıá, M. A., E. F. Meurs, and M. Esteban. 2007. The dsRNA protein kinase PKR: virus and cell control. Biochimie 89: 799–811. 24. Hovanessian, A. G. 2007. On the discovery of interferon-inducible, doublestranded RNA activated enzymes: the 29-59oligoadenylate synthetases and the protein kinase PKR. Cytokine Growth Factor Rev. 18: 351–361. 25. Lee, S. B., and M. Esteban. 1994. The interferon-induced double-stranded RNAactivated protein kinase induces apoptosis. Virology 199: 491–496. 26. Srivastava, S. P., K. U. Kumar, and R. J. Kaufman. 1998. Phosphorylation of eukaryotic translation initiation factor 2 mediates apoptosis in response to activation of the double-stranded RNA-dependent protein kinase. J. Biol. Chem. 273: 2416–2423. 27. Der, S. D., Y. L. Yang, C. Weissmann, and B. R. Williams. 1997. A doublestranded RNA-activated protein kinase-dependent pathway mediating stressinduced apoptosis. Proc. Natl. Acad. Sci. USA 94: 3279–3283. 28. Barry, G., L. Breakwell, R. Fragkoudis, G. Attarzadeh-Yazdi, J. RodriguezAndres, A. Kohl, and J. K. Fazakerley. 2009. PKR acts early in infection to suppress Semliki Forest virus production and strongly enhances the type I interferon response. J. Gen. Virol. 90: 1382–1391. 29. Bisbal, C., and R. H. Silverman. 2007. Diverse functions of RNase L and implications in pathology. Biochimie 89: 789–798. 30. Holm, G. H., J. Zurney, V. Tumilasci, S. Leveille, P. Danthi, J. Hiscott, B. Sherry, and T. S. Dermody. 2007. Retinoic acid-inducible gene-I and interferon-b promoter stimulator-1 augment proapoptotic responses following mammalian reovirus infection via interferon regulatory factor-3. J. Biol. Chem. 282: 21953–21961.


Bax/Bak pathway. It also solves a long-term conundrum that Sindbis- or SFV-induced apoptosis could be delayed by the caspase8 inhibitors crmA and FLIP without involving death receptors (4, 11, 12). The pertinent question remains how caspase-8 is recruited to and activated by MAVS on mitochondria after SFV infection. A plausible activator may be FADD because it is an adaptor and activator for caspase-8 on the death receptor DISC (9). Previous studies suggested an association of FADD with caspase-8 and MAVS after DAP-3–induced anoikis (35) or upon co-overexpression (17). Moreover, FADD was proposed to mediate NF-kB activation and IFN-b induction by MAVS overexpression (17) and in response to dsRNA (48, 50). However, a role of FADD in dsRNA- or RNA virus–induced apoptosis has not yet been reported, and we did not find any apoptosis protection of Bax/Bak2/2 cells from SFV when FADD was completely downregulated, although caspase-8 depletion effectively saved them. We were also unable to coimmunoprecipitate FADD with endogenous MAVS in SFV-infected cells, although it perfectly associated with the Fas DISC upon FasL stimulation. Finally, in our hands, we have not seen a defect in IFNb induction by RNA viruses in the absence of FADD as suggested by Balachandran et al. (50) (Z.J. Chen, personal communication), indicating that FADD is unlikely to be a crucial MAVS adaptor, neither for IFN-b nor for apoptosis signaling. It is also difficult to explain how MAVS would interact with FADD because it contains a CARD, whereas FADD links proteins via death and death effector domains. We therefore suggest a yet unknown adaptor forming the MAVS/caspase-8 DISC on mitochondria in response to SFV. Interestingly, RNA viruses such as hepatitis C virus (HCV) or influenza virus target the MAVS signaling pathway to disable the host cell’s antiviral response. In the case of HCV, the nonstructural NS3/4A protein is a protease, which cleaves and inactivates MAVS (51). For influenza, the NS1 protein blocks the TRIM25 ubiquitin E3 ligase of RIG-I required for its optimal downstream signaling (52) and the PB1-F2 protein interferes with the RIG-I/MAVS complex (53). Because both HCV and influenza viruses induce only little host cell apoptosis, we speculate that they use inhibition of the herein described MAVS/caspase-8 apoptosis pathway as another strategy of immune evasion. Such strategy is known for DNA viruses such as adeno- or herpesviruses, which encode Bcl2–like homologs in their genomes to protect infected cells from apoptosis (54). A further investigation of the MAVS-mediated apoptosis pathway, in particular the identification of the components of the MAVS/caspase-8 DISC on mitochondria will shed more light on the mechanisms by which RNA viruses break antiviral immunity.


43. Cheng, Y. S., and F. Xu. 2010. Anticancer function of polyinosinic-polycytidylic acid. Cancer Biol. Ther. 10: 1219–1223. 44. Breckenridge, D. G., M. Nguyen, S. Kuppig, M. Reth, and G. C. Shore. 2002. The procaspase-8 isoform, procaspase-8L, recruited to the BAP31 complex at the endoplasmic reticulum. Proc. Natl. Acad. Sci. USA 99: 4331–4336. 45. Young, M. M., Y. Takahashi, O. Khan, S. Park, T. Hori, J. Yun, A. K. Sharma, S. Amin, C. D. Hu, J. Zhang, et al. 2012. Autophagosomal membrane serves as platform for intracellular death-inducing signaling complex (iDISC)-mediated caspase-8 activation and apoptosis. J. Biol. Chem. 287: 12455–12468. 46. Caro-Maldonado, A., S. W. G. Tait, S. Ramı´rez-Peinado, J.-E. Ricci, I. Fabregat, D. R. Green, and C. Munõz-Pinedo. 2010. Glucose deprivation induces an atypical form of apoptosis mediated by caspase-8 in Bax-, Bak-deficient cells. Cell Death Differ. 17: 1335–1344. 47. Estornes, Y., F. Toscano, F. Virard, G. Jacquemin, A. Pierrot, B. Vanbervliet, M. Bonnin, N. Lalaoui, P. Mercier-Gouy, Y. Pachećo, et al. 2012. dsRNA induces apoptosis through an atypical death complex associating TLR3 to caspase-8. Cell Death Differ. 19: 1482–1494. 48. Takahashi, K., T. Kawai, H. Kumar, S. Sato, S. Yonehara, and S. Akira. 2006. Roles of caspase-8 and caspase-10 in innate immune responses to doublestranded RNA. J. Immunol. 176: 4520–4524. 49. Handa, P., J. C. Tupper, K. D. Jordan, and J. M. Harlan. 2011. FLIP (Flice-like inhibitory protein) suppresses cytoplasmic double-stranded-RNA-induced apoptosis and NF-kB and IRF3-mediated signaling. Cell Commun. Signal. 9: 16 10.1186/1478-811X-9-16. 50. Balachandran, S., E. Thomas, and G. N. Barber. 2004. A FADD-dependent innate immune mechanism in mammalian cells. Nature 432: 401–405. 51. Li, X. D., L. Sun, R. B. Seth, G. Pineda, and Z. J. Chen. 2005. Hepatitis C virus protease NS3/4A cleaves mitochondrial antiviral signaling protein off the mitochondria to evade innate immunity. Proc. Natl. Acad. Sci. USA 102: 17717– 17722. 52. Rajsbaum, R., R. A. Albrecht, M. K. Wang, N. P. Maharaj, G. A. Versteeg, E. Nistal-Villań, A. Garcıá-Sastre, and M. U. Gack. 2012. Species-specific inhibition of RIG-I ubiquitination and IFN induction by the influenza A virus NS1 protein. PLoS Pathog. 8: e1003059. 53. Dudek, S. E., L. Wixler, C. Nordhoff, A. Nordmann, D. Anhlan, V. Wixler, and S. Ludwig. 2011. The influenza virus PB1-F2 protein has interferon antagonistic activity. Biol. Chem. 392: 1135–1144. 54. Postigo, A., and P. E. Ferrer. 2009. Viral inhibitors reveal overlapping themes in regulation of cell death and innate immunity. Microbes Infect. 11: 1071–1078.


31. Lei, Y., C. B. Moore, R. M. Liesman, B. P. O’Connor, D. T. Bergstralh, Z. J. Chen, R. J. Pickles, and J. P.-Y. Ting. 2009. MAVS-mediated apoptosis and its inhibition by viral proteins. PLoS One 4: e5466. 32. Chattopadhyay, S., J. T. Marques, M. Yamashita, K. L. Peters, K. Smith, A. Desai, B. R. G. Williams, and G. C. Sen. 2010. Viral apoptosis is induced by IRF-3-mediated activation of Bax. EMBO J. 29: 1762–1773. 33. Yu, C. Y., R. L. Chiang, T. H. Chang, C. L. Liao, and Y. L. Lin. 2010. The interferon stimulator mitochondrial antiviral signaling protein facilitates cell death by disrupting the mitochondrial membrane potential and by activating caspases. J. Virol. 84: 2421–2431. 34. Besch, R., H. Poeck, T. Hohenauer, D. Senft, G. Ha¨cker, C. Berking, V. Hornung, S. Endres, T. Ruzicka, S. Rothenfusser, and G. Hartmann. 2009. Proapoptotic signaling induced by RIG-I and MDA-5 results in type I interferon-independent apoptosis in human melanoma cells. J. Clin. Invest. 119: 2399–2411. 35. Li, H.-M., D. Fujikura, T. Harada, J. Uehara, T. Kawai, S. Akira, J. C. Reed, A. Iwai, and T. Miyazaki. 2009. IPS-1 is crucial for DAP3-mediated anoikis induction by caspase-8 activation. Cell Death Differ. 16: 1615–1621. 36. Egger, L., J. Schneider, C. Rheˆme, M. Tapernoux, J. Ha¨cki, and C. Borner. 2003. Serine proteases mediate apoptosis-like cell death and phagocytosis under caspase-inhibiting conditions. Cell Death Differ. 10: 1188–1203. 37. Shimizu, M., A. Fontana, Y. Takeda, H. Yagita, T. Yoshimoto, and A. Matsuzawa. 1999. Induction of antitumor immunity with Fas/APO-1 ligand (CD95L)transfected neuroblastoma neuro-2a cells. J. Immunol. 162: 7350–7357. 38. Walter, D., K. Schmich, S. Vogel, R. Pick, T. Kaufmann, F. C. Hochmuth, A. Haber, K. Neubert, S. McNelly, F. von Weizsa¨cker, et al. 2008. Switch from type II to I Fas/CD95 death signaling on in vitro culturing of primary hepatocytes. Hepatology 48: 1942–1953. 39. Croker, B. A., J. A. O’Donnell, C. J. Nowell, D. Metcalf, G. Dewson, K. J. Campbell, K. L. Rogers, Y. Hu, G. K. Smyth, J.-G. Zhang, et al. 2011. Fasmediated neutrophil apoptosis is accelerated by Bid, Bak, and Bax and inhibited by Bcl-2 and Mcl-1. Proc. Natl. Acad. Sci. USA 108: 13135–13140. 40. Qin, Z.-H., Y. Wang, K. K. Kikly, E. Sapp, K. B. Kegel, N. Aronin, and M. DiFiglia. 2001. Pro-caspase-8 is predominantly localized in mitochondria and released into cytoplasm upon apoptotic stimulation. J. Biol. Chem. 276: 8079–8086. 41. Schug, Z. T., F. Gonzalvez, R. H. Houtkooper, F. M. Vaz, and E. Gottlieb. 2011. BID is cleaved by caspase-8 within a native complex on the mitochondrial membrane. Cell Death Differ. 18: 538–548. 42. Ambrus, J. L., Sr., K. C. Chadha, A. Islam, S. Akhter, and J. L. Ambrus, Jr. 2006. Treatment of viral and neoplastic diseases with double-stranded RNA derivatives and other new agents. Exp. Biol. Med. (Maywood) 231: 1283–1286.

13

Apoptosis.

Regulation of Apoptosis by Inhibitors of Apoptosis (IAPs).

Mortalin, apoptosis, and neurodegeneration.

Studying Apoptosis in Drosophila.

Apoptosis, fibrosis and senescence.

Apoptosis and DNA methylation.

Alpha-blocker and apoptosis.

Mitochondrial alterations in apoptosis.

Arrestins in apoptosis.

Apoptosis in metanephric development.

EnABLing microprocessor for apoptosis.

Apoptosis, Up the Ante.

Carmustine induces platelet apoptosis.

Fluorescence Lifetime Imaging of Apoptosis.

Targeting apoptosis for anticancer therapy.

HIV-1 protease-induced apoptosis.

Molecular mechanisms of hepatic apoptosis.

Pathophysiological Significance of Hepatic Apoptosis.

Apoptosis in immune-mediated diseases.

Studying apoptosis in the Zebrafish.

Apoptosis deregulation in myeloproliferative neoplasms.

Dissecting apoptosis the omics way.

SGP-2, apoptosis, and aging.

Mitochondria and apoptosis: emerging concepts.