Fitoterapia 92 (2014) 230–237
Contents lists available at ScienceDirect
Fitoterapia journal homepage: www.elsevier.com/locate/fitote
Berberine metabolites could induce low density lipoprotein receptor up-regulation to exert lipid-lowering effects in human hepatoma cells Yan Zhou a,c,1, Shijie Cao b,1, Ying Wang a, Peixiang Xu a, Jiankun Yan b, Wen Bin a, Feng Qiu b,⁎, Ning Kang a,⁎⁎ a b c
Department of Biochemistry and Molecular Biology, Shenyang Pharmaceutical University, 103 Wenhua Road, Shenyang 110016, PR China Department of Natural Products Chemistry, Shenyang Pharmaceutical University, 103 Wenhua Road, Shenyang 110016, PR China Department of Neurology, Xuzhou Medical College, 209 Tongshan Road, Xuzhou 221004, PR China
a r t i c l e
i n f o
Article history: Received 2 August 2013 Accepted in revised form 27 November 2013 Available online 7 December 2013 Keywords: Berberine Metabolites LDLR Lipid accumulation Human hepatoma cells
a b s t r a c t Berberine (BBR) is an isoquinoline alkaloid isolated from several Chinese herbal medicines, such as Coptis chinensis, Berberis aristata, and Coptis japonica. It exhibits a lipid-lowering effect by up-regulating the hepatic low density lipoprotein receptor (LDLR) expression. However, the plasma concentration of BBR is very low after oral administration for the reason that BBR is poorly absorbed and rapidly metabolized. Therefore, it is hard to explain the pharmacological effects of BBR in vivo. Here, RT-PCR, Western blotting and Oil Red O staining were used to investigate the effects of four BBR metabolites on LDLR expression and lipid accumulation in human hepatoma Hep G2 cells. Our results suggested that BBR increased the LDLR mRNA and protein levels in a time- and dose-dependent manner. Four metabolites of BBR, jatrorrhizine, columbamine, berberrubine and demethyleneberberine, were found to be able to up-regulate LDLR mRNA and protein expression. Moreover, almost all the metabolites had potent effects on inhibiting cellular lipid accumulation. These results suggest that both BBR and its metabolites exhibit lipid-lowering effects by up-regulating LDLR expression, and BBR and its metabolites might be the in vivo active forms of BBR produced after oral administration. This study provides information to help us understand the mechanisms underlying the hypolipidemic effects of BBR in vivo. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Despite considerable improvements in medical care over the past 25 years, cardiovascular disease remains a major public health challenge. It is the leading cause of death in ⁎ Correspondence to: F. Qiu, Department of Natural Products Chemistry, Shenyang Pharmaceutical University, 103 Wenhua Road, Shenyang 110016, PR China. Tel.: +86 24 23986463; fax: +86 23986463. ⁎⁎ Correspondence to: N. Kang, Department of Biochemistry and Molecular Biology, Shenyang Pharmaceutical University, 103 Wenhua Road, Shenyang 110016, PR China. Tel.: +86 24 23986435; fax: +86 24 23986463. E-mail addresses: [email protected] (F. Qiu), [email protected] (N. Kang). 1 Yan Zhou and Shijie Cao contributed equally to this work. 0367-326X/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.fitote.2013.11.010
Europe and USA and, in China, heart and cerebrovascular diseases are responsible for nearly 40% of all deaths [1–3]. Hypercholesterolaemia is characterized by high low density lipoprotein (LDL) plasma concentrations. The relationship between LDL-cholesterol and the risk of cardiovascular disease is well established and a reduction in LDL-cholesterol levels is a treatment goal and an indicator of the success of lipid-lowering therapies [4,5]. LDLR is a cell surface transmembrane protein that mediates the uptake of LDL and its degradation in lysosomes, which provides cells with cholesterol [6]. Some drugs are prescribed to lower LDL-cholesterol concentrations, and the most efficacious group are the statins [7]. Therefore, increased hepatic LDLR expression results in improved clearance of plasma LDL-cholesterol, which is
Y. Zhou et al. / Fitoterapia 92 (2014) 230–237
strongly associated with a decreased risk of cardiovascular diseases. Berberine (BBR) is an isoquinoline alkaloid isolated from several Chinese herbal medicines, such as Coptis chinensis, Berberis aristata, and Coptis japonica. It has been used in traditional oriental medicine for the treatment of gastroenteritis and secretory diarrhea [8]. Multiple pharmacological effects have been attributed to BBR and its related derivatives, such as antidiarrheic, antimicrobial, anticancer, antiinflammatory, and antiarrhythmic actions [9–13]. Recently, BBR was identified as a promising lipid-lowering drug, able to effectively up-regulate hepatic LDLR expression in liver cells and vascular cells, and it has been shown to decrease both serum triglycerides and cholesterol [14–16]. However, more and more investigations have revealed the limitations of BBR, including its low bioavailability and poor intestinal absorption [17,18]. The plasma concentration of BBR is very low after oral administration because BBR is poorly absorbed [19,20]. Intriguingly, BBR still exhibits a lipid-lowering effect even though it is rapidly transferred from the blood to the liver and bile and eliminated quickly. Zuo et al. [21] found that BBR was extensively metabolized in the body, and its metabolites maintained high plasma levels. Therefore, we speculated that the metabolites of BBR might be the main existing forms in the human body which would account for the pharmacological effects in vivo. In our previous work, we identified nine urinary metabolites of BBR in rats and humans [22]. Here, we examined four phase I metabolites of BBR involving their effects on LDLR up-regulation and lipid-lowering in human hepatoma Hep G2 cells which are considered suitable and convenient models for studying the regulation of hepatic
231
LDL-cholesterol metabolism [23–25]. The results of our investigations should be helpful in providing a better understanding of the mechanisms underlying the lipid-lowering properties of BBR in vivo. 2. Materials and methods 2.1. Chemicals Berberine chloride (purity N 99.5%) was supplied by the Northeast General Pharmaceutical Factory (Shenyang, China). Jatrorrhizine (M1) and columbamine (M2) were isolated from C. chinensis Franch [26]. Berberrubine (M3) was obtained by hydrolysis of 3,10-demethylpalmatine-10-O-sulfate with βglucuronidase, followed by extraction with chloroform [22]. Demethyleneberberine (M4) was prepared by structural modification of BBR [21]. The chemical structures of the four BBR metabolites are shown in Fig. 1. BBR and its metabolites were dissolved in dimethyl sulfoxide (DMSO) to obtain a stock solution, and the DMSO concentration was kept below 0.05% in all the cell cultures so that it had no detectable effect on cell growth. 2.2. Reagents Fetal bovine serum (FBS) was obtained from TBD Biotechnology Development (Tianjin, China) and RPMI-1640 medium was obtained from Gibco/BRL (Gaithersburg, MD, USA). Antibodies against LDLR, β-actin and horseradish peroxidaseconjugated secondary antibodies (goat-anti-rabbit and goatanti-mouse) were purchased from Santa Cruz Biotechnology
Fig. 1. Chemical structures of BBR and its metabolites (M1–M4).
232
Y. Zhou et al. / Fitoterapia 92 (2014) 230–237
(Santa Cruz, CA, USA). In addition, 3-(4, 5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide (MTT) was purchased from Sigma Chemical (St. Louis, MO, USA). An enhanced chemiluminescence (ECL) reagent was purchased from Thermo Scientific (Rockford, IL, USA). RNA isolation reagent and Oil Red O were purchased from Sigma-Aldrich (St. Louis, MO, USA). The RT reagent Kit and PCR reagent were obtained from TaKaRa (TaKaRa Biotechnology Co. Ltd. Dalian, China).
30 cycles of 94 °C 30 s, 58 °C 30 s, 72 °C 40 s, and finally 72 °C 7 min. PCR products were analyzed by 2% agarose gel electrophoresis using TBE buffer. The bands were photographed using image Quant 300 (GE Healthcare, USA). Densitometric analysis of the bands was performed by Image J software (National Institutes of Health, USA). The expression of the GAPDH housekeeping gene was used to normalize the PCR reaction.
2.3. Cell culture 2.6. Western blot analysis Human hepatoma Hep G2 cells were obtained from American Type Culture Collection (ATCC, Manassas, VA, USA). The cells were cultured in RPMI-1640 medium, containing penicillin (100 U/mL), streptomycin (100 mg/mL), and 10% FBS at 37 °C with 5% CO2 in a humidified atmosphere. The cells used in the experiments were in the exponential phase of growth. 2.4. Cell viability assay Cell viability of BBR and M1–M4 on Hep G2 cells was measured by MTT assay. Hep G2 cells were seeded onto 96-well culture plates at a density of 6 × 104 cells/well and treated with the indicated concentrations of BBR and M1–M4 for 24 h. After reagent treatment for 24 h, the cells were washed once with PBS (Phosphate buffer solution). Subsequently, MTT was then added at a final concentration of 0.5 μg/mL, and the cells were further incubated for 2.5 h at 37 °C. The medium was removed, and the formazan crystals were dissolved in DMSO (150 μL). The optical density (OD) was measured at 492 nm using an ELISA microplate reader. The percentage cell viability was calculated as follows:
Hep G2 cells were incubated with BBR or its metabolites for 24 h. Both adherent and floating cells were collected and frozen at −80 °C. Western blot analysis was performed as follows: the cell pellets were resuspended in lysis buffer consisting of 50 mM Hepes (pH 7.4), 1% Triton-X 100, 2 mM sodium orthovanadate, 100 mM sodium fluoride, 1 mM edetic acid, 1 mM PMSF, 10 mg/L aprotinin, and 10 mg/L leupeptin and lysed at 4 °C for 30 min. Then, the cells were centrifuged at 12,000 ×g for 10 min. The Bradford Method was used to determine the protein concentration. The proteins were separated by 8% SDS polyacrylamide gel electrophoresis and then electrophoretically transferred to PVDF membranes (Millipore, USA). The membranes were blocked with 5% skimmed milk for 2 h, and incubated with primary polyclonal antibodies at 4 °C overnight. The proteins were visualized by using suitable IgG conjugated with peroxidase. Immunoreactive protein was detected with the ECL kit. The levels of LDLR protein were obtained by densitometric scanning.
2.7. Oil Red O staining Cell viabilityð% Þ h i ¼ A492;Sample −A492;Blank = A492;Control −A492;Blank 100:
2.5. RNA extraction and reverse transcription-polymerase chain reaction analysis Total RNA from Hep G2 cells was isolated using TRI Reagent (Sigma, USA) and RNA was extracted according to the manufacturer's instructions. The RNA concentration was determined by a spectrophotometer (GE Healthcare, USA) at A260 and the purity accepted as suitable if the ratio of A260/ A280 ranged from 1.8 to 2.0. Then, using the RT reagent kit, cDNA was synthesized from 500 ng RNA at 85 °C for 15 min followed by 95 °C for 5 min. Specific primers for amplification of LDLR and glyceraldehyd-3-phosphate dehydrogenase (GAPDH) were designed based on the sequence of these two genes available from GenBank sequence data. The primers used in the study are listed in Table 1. PCR was performed with the following program: 94 °C 4 min, then followed by
To measure cellular neutral lipid droplet accumulation, Hep G2 cells (3 × 105) were cultured in 6-well plates (Corning Costar, NY, USA) in RPMI-1640 culture medium for 24 h, and then treated with 15 μM BBR and its metabolites for 24 h. After treatment, the cells were washed with PBS twice and fixed with 10% formalin for 60 min. After fixation, the cells were washed and dyed with 60% Oil Red O staining working buffer for 1 h at room temperature. After dyeing, the cells were washed with ultrapure water, and counterstaining of the nuclei was carried out with Mayer's hematoxylin. The staining pattern was observed using a phase contrast microscope (Motic, USA). To quantitate the Oil Red O content levels, isopropanol was added to each sample followed by shaking at room temperature for 5 min, and then the samples were read spectrophotometrically at 490 nm using a plate reader (BioTek ELx800, USA). The level of lipid in the control group was defined as 100%, and the amount of lipid from the tested compound-treated groups was plotted relative to that value.
2.8. Statistical analysis Table 1 Primer sequences of target genes for RT-PCR analysis. Gene name
Forward primer (5′ to 3′)
Reverse primer (5′ to 3′)
LDLR GAPDH
CAGCAGGCGTACCAACGCAC TGCACCACCAACTGCTTAG
GCGATCAGGTGAAGTTGGC GACGCAGGGATGATGTTC
All results were confirmed in at least three separate experiments. Data were expressed as the means ± S.D. They were analyzed with the Student's t-test at a *P b 0.05 level of statistical significance to evaluate differences between groups.
Y. Zhou et al. / Fitoterapia 92 (2014) 230–237
3. Results 3.1. Effects of BBR and its metabolites on viability of Hep G2 cells To determine the cytotoxic effect, the viabilities of Hep G2 cells treated with increasing concentrations of BBR were measured by MTT assay. As shown in Fig. 2A, the viabilities of the cells treated with 0–15 μM of BBR for 24 h were not significantly different from that of the control group. These results demonstrated that BBR up to 15 μM could be used to treat Hep G2 cells without the concern about cytotoxic effects under the current experimental conditions. To investigate the cellular toxicity of the other test compounds, 15 μM samples were applied to Hep G2 cells for 24 h as described. The BBR metabolites did not show any cellular toxicity up to a concentration of 15 μM (Fig. 2B) and so we conducted the subsequent experiments using 15 μM of all the test compounds including BBR. 3.2. Effects of BBR on LDLR expression in Hep G2 cells Abundant evidence has indicated that BBR has a lipidlowering effect by up-regulating hepatic LDLR [14,24,27]. Therefore, we investigated whether BBR affected the LDLR expression in our model. To check the effect of BBR on the LDLR mRNA level, the amount of LDLR mRNA in Hep G2 cells treated with increasing concentrations of BBR was determined. As expected, BBR treatment dose-dependently increased the LDLR mRNA expression (Fig. 3A). The levels of LDLR mRNA reached a maximal level as 1.5-fold higher than
233
the control, when the concentration of BBR was 15 μM. Furthermore, to find the optimum incubation time, we treated Hep G2 cells with BBR for different periods. The time-course experiment also revealed that BBR increased the LDLR mRNA in a time-dependent manner. After 12 h and 24 h, the levels of LDLR mRNA were up-regulated by nearly 1.3-fold and 1.4-fold, respectively (Fig. 3B). To investigate whether BBR increased the LDLR protein level, the expression of LDLR protein in Hep G2 cells was evaluated by Western blot analysis. The BBR-treated group showed a dose-dependent increase in the expression of LDLR protein (Fig. 3C). The histogram showed a 60% increase of LDLR protein in cells treated with 15 μM BBR, while there was a 50% and 33% increase in LDLR protein expression when treated with 20 and 25 μM BBR, respectively. It was also apparent that the level of LDLR protein reached a peak that was 1.42-fold higher than the control at 24 h (Fig. 3D). Driven by the above-mentioned results, we therefore treated Hep G2 cells with 15 μM doses of drugs at 24 h in the following experiments. 3.3. Effects of BBR metabolites on LDLR expression in Hep G2 cells Next, M1–M4 were used to examine their effects on LDLR expression. Hep G2 cells were treated with each of the metabolites for 24 h, and the cellular mRNA was extracted to measure the intracellular LDLR expression by RT-PCR. As shown in Fig. 4A, all of the four metabolites increased the LDLR mRNA expression 1.34-fold, 1.24-fold, 1.61-fold and 1.41-fold respectively. M3 was more active than BBR and M1 and M4 had similar effects on LDLR mRNA expression compared with BBR, and they were all more effective than the control. To examine the changes in the LDLR protein level in Hep G2 cells treated with the four metabolites of BBR, we studied the expression of LDLR protein by Western blot analysis. As shown in Fig. 4B, the level of LDLR expression following treatment with BBR increased by more than 38% compared with the control group. M1 exhibited a similar activity on LDLR protein expression to that of BBR treatment, and M2, M3 and M4 significantly increased the LDLR protein level by 50, 60 and 53%, respectively. 3.4. Effects of BBR metabolites on cellular lipid accumulation in Hep G2 cells
Fig. 2. Effects of BBR and its metabolites on Hep G2 cells viability. Various concentrations of BBR (0–20 μM) (A) and 15 μM M1–M4 (B) were treated on Hep G2 cell for 24 h. Cell viability was measured by MTT assay. Data are presented as means ± S.D. for triplicate experiments.
As indicated above, BBR and its metabolites increased the expression of LDLR in Hep G2 cells. To assess the physiological impact of BBR and its metabolites on cellular lipid content, we stained neutral lipids in Hep G2 cells with Oil Red O reagent after a 24 h treatment with the test compounds (Fig. 5). After staining with Oil Red O, many red stained lipid droplets were detected in the untreated control group. All the experimental groups showed an intracellular lipid content that was significantly reduced following treatment with the test compounds (Fig. 5A). For quantitative analysis of the neutral lipid content, the absorbance of Oil Red O eluted solution was measured at 490 nm. The absorbance of Oil Red O corresponded to the results of the cellular morphological changes (Fig. 5B). The lipid content of the control sample was
234
Y. Zhou et al. / Fitoterapia 92 (2014) 230–237
Fig. 3. Up-regulation of LDLR expression by BBR in Hep G2 cells. (A) Effect of increasing concentrations of BBR on the amount of LDLR mRNA. (B) Effect of 15 μM BBR on the amount of LDLR mRNA over time. (C) Effect of increasing concentrations of BBR on the LDLR protein expression. (D) Effect of 15 μM BBR on the LDLR protein expression over time. The results are shown as means ± S.D. of three independent experiments.
defined as 100% for the comparison with that of the samples treated with BBR and its metabolites. As shown in Fig. 5B, the lipid content was reduced by about 10% after M1 or M2 treatment. It was reduced by around 20% after treatment with M3, and this effect was similar to that of the BBR treated group. Notably, M4 was more effective than BBR in attenuating hepatic lipid accumulation, because it produced a 25% reduction in lipids compared with the control group. 4. Discussion BBR, a major active constituent of several Chinese herbal medicines, has multiple pharmacological effects, such as antimicrobial, antihyperglycemic, hypolipidemic and antineoplastic activities. Among these bioactivities, the lipid-lowering effect has
received much attention. Our data also shows that BBR effectively inhibits Hep G2 cellular lipid accumulation (Fig. 5). However, some pharmacokinetic studies have indicated that BBR has poor oral bioavailability [20,28]. In the concentrationtime course experiment in rats, the peak level of BBR reached 10 ng/mL at 2 h after p.o. administration, and it then underwent elimination within 12 h, then maintained a very low plasma concentration for 48 h [21]. The low blood concentration and low biological availability seemed to be a stumbling block for the selection of BBR as a promising lipid-lowering drug candidate for further evaluation. Interestingly, BBR still retained a lipid-lowering effect [14,29]. Why and how could this happen? It has been reported that the BBR concentration is quite low in plasma, but its metabolites remain at much higher concentrations for a long time. The AUC0-limt and concentration
Y. Zhou et al. / Fitoterapia 92 (2014) 230–237
Fig. 4. Effects of BBR metabolites on LDLR expression in Hep G2 cells. The cells were treated with 15 μM BBR and its metabolites for 24 h and the mRNA expression of LDLR and GAPDH was determined by RT-PCR (A). The protein expression of LDLR and β-Actin was detected by Western blotting (B). The results are shown as means ± S.D. of three independent experiments. *P b 0.05, compared with the untreated control.
peak values of the metabolites were much higher than those of BBR [21]. Accordingly, we presume that some biotransformed products may play an important role in the effectiveness of BBR. In this study, we prepared the phase I metabolites of BBR and examined their hypolipidemic activities in order to clarify the real effective forms in vivo. The cell viability assay is a key step for the study of lipidlowering activities. The MTT assays were used to discern whether the lipid-lowering effects of BBR and its metabolites on Hep G2 cells were attributable to cytotoxic effects. In this study, the cellular toxicity of BBR was dose-dependent and no adverse effects on cell proliferation were detected up to 15 μM. We also confirmed that the 15 μM samples of BBR metabolites used in this study were safe (Fig. 2). The findings of Kong showed that BBR could be considered as a new hypolipidemic drug with a mechanism of action distinct from that of statins [14]. Both Kong and Lee
235
demonstrated that BBR exhibited a cholesterol-lowering effect by upregulating LDLR expression [14,24]. To verify this bioactivity and find the best experimental conditions, we tested the effect of BBR on LDLR mRNA and protein levels in Hep G2 cells. Consistent with those reports, our results also showed that BBR increased the expression of LDLR mRNA and protein in Hep G2 cells in a time- and dose-dependent manner (Fig. 3). Up to now, studies of BBR metabolites have concentrated more on metabolite identification and structural analysis. However, the hypolipidemic effects of BBR metabolites and their related mechanisms have only been reported rarely. Our recent study demonstrated that BBR and its metabolites exhibited triglyceride-lowering effects through activation of the AMPK signaling pathway [30]. In this study, each of the BBR metabolites was examined for its effects on the expression of LDLR in human hepatocytes. Our results showed that all four metabolites, M1–M4, could enhance the expression of LDLR both in regard to mRNA and the protein level (Fig. 4). The intracellular lipid content was also significantly reduced after liver cells were treated with the four metabolites (Fig. 5). Li et al. obtained the four major metabolites of BBR, berberrubine, thalifendine, demethyleneberberine and jatrorrhizine, by chemical synthesis. However, the results of their experiments showed that the LDLR mRNA was increased only by berberrubine or thalifendine with an activity of only 35% or 26% that of BBR, respectively, but not by demethyleneberberine and jatrorrhizine [31]. Moreover, we found that there were some differences in the results between the LDLR mRNA level and the protein level following treatment with the four metabolites of BBR. As previously reported, BBR-induced LDLR up-regulation involved a post-transcriptional mechanism through the 3′ untranslated region [14]. Our work showed that, in the case of the mRNA level, M3 was more active than M1 and M4, and had a similar activity to BBR while, regarding the protein level, all four metabolites were more active than BBR. Our results revealed that the regulation of LDLR expression probably also occurs at a posttranscriptional level. Further studies are needed to clarify the molecular mechanism of action of LDLR up-regulation induced by BBR metabolites. The cholesterol-lowering properties of BBR have been observed in human and animal studies [3,6], and the efficacy is comparable or greater than that produced by most current natural products [7–9]. In the present study, BBR and its metabolites were shown to enhance the expression of LDLR in Hep G2 cells. The LDLR pathway is the main route of hepatocellular cholesterol metabolism, and the expression of LDLR reflects the content of cellular cholesterol [32]. Consistent with the effects of BBR on LDLR expression, BBR markedly reduced the lipid content of Hep G2 cells (Fig. 5). In the course of our bioactive screening of BBR metabolites, we first investigated the effects of the test compounds on the intracellular lipid content. The results obtained showed that the intracellular lipid content was significantly reduced after treatment of the liver cells with BBR metabolites (Fig. 5). M3 and M4 produced strong inhibition of cellular lipid accumulation, which suggested that BBR metabolites might be potent lipid-lowering forms in vivo. In summary, the results obtained in the present study indicate that all four metabolites of BBR contribute to the up-regulation of LDLR and the inhibition of lipid accumulation in human hepatoma Hep G2 cells, and M3 and M4 are
236
Y. Zhou et al. / Fitoterapia 92 (2014) 230–237
Fig. 5. Inhibition of BBR and its metabolites on intracellular lipid accumulation in Hep G2 cells. Cells were treated with BBR and its metabolites (15 μM) for 24 h. (A) The cellular lipid depositions were observed under an inverted microscope with Oil Red O dye method (scale bar = 10 μm). (B) Stained lipid content was quantified by measuring absorbance. The results are shown as means ± S.D. of three independent experiments.*P b 0.05, compared with the untreated control.
the most effective. Accordingly, we propose that the main active forms of BBR after oral administration are BBR and its metabolites. Both BBR and its metabolites have lipid-lowering effects in vivo. Acknowledgments This work was supported by the National Natural Science Foundation of China (No. 20972098), the Foundation of Liaoning Educational Committee (Nos. 20060877 and LS2010160) and the Shenyang Talent Resource Development Special Funds (No. 2012021103019). References [1] European cardiovascular disease statistics. http://www.heartstats.org/ datapage.asp?id=7683; 2008.
[2] D'Agostino RB, Russell MW, Huse DM, Ellison RC, Silbershatz H, Wilson PW, et al. Primary and subsequent coronary risk appraisal: new results from the Framingham study. Am Heart J 2000;139(2):272–81. [3] Ministry of Health of the People's Republic of China. Death rate of 10 main diseases in certain region in 2009 (total); 2011 [Published on the Internet http://www.moh.gov.cn/publicfiles//business/htmlfiles/wsb/ index.htm]. [4] Jain KS, Kathiravan MK, Somani RS, Shishoo CJ. The biology and chemistry of hyperlipidemia. Bioorg Med Chem 2007;15(14):4674–99. [5] Executive Summary of the Third Report of the National Cholesterol Education Program (NCEP) Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (Adult Treatment Panel III). JAMA 2001;285:2486–97. [6] Maxfield FR, van Meer G. Cholesterol, the central lipid of mammalian cells. Curr Opin Cell Biol 2010;22(4):422–9. [7] Costet P. Molecular pathways and agents for lowering LDL-cholesterol in addition to statins. Pharmacol Ther 2010;126(3):263–78. [8] Chinese Pharmacopeia Committee. Pharmacopeia of People's Republic of China, 1. Beijing: Chemical Industry Press; 2005 213–4. [9] Taylor CT, Baird AW. Berberine inhibition of electrogenic ion transport in rat colon. Brit J Pharmacol 1995;116(6):2667–72. [10] Kaneda Y, Torii M, Tanaka T, Aikawa M. In vitro effects of berberine sulphate on the growth and structure of Entamoeba histolytica,
Y. Zhou et al. / Fitoterapia 92 (2014) 230–237
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[18] [19]
[20]
[21]
Giardia lamblia and Trichomonas vaginalis. Ann Trop Med Parasitol 1991;85(4):417–25. Iizuka N, Miyamoto K, Okita K, Tangoku A, Hayashi H, Yosino S, et al. Inhibitory effect of Coptidis Rhizoma and berberine on the proliferation of human esophageal cancer cell lines. Cancer Lett 2000;148(1):19–25. Ckless K, Schlottfeldt JL, Pasqual M, Moyna P, Henriques JAP, Wajner M. Inhibition of in-vitro lymphocyte transformation by the isoquinoline alkaloid berberine. J Pharm Pharmacol 1995;47(12A):1029–31. Sanchez-Chapula J. Increase in action potential duration and inhibition of the delayed rectifier outward current IK by berberine in cat ventricular myocytes. Brit J Pharmacol 1996;117(7):1427–34. Kong WJ, Wei J, Abidi P, Lin MH, Inaba S, Li C, et al. Berberine is a novel cholesterol-lowering drug working through a unique mechanism distinct from statins. Nat Med 2004;10(12):1344–51. Holy EW, Akhmedov A, Lüscher TF, Tanner FC. Berberine, a natural lipid-lowering drug, exerts prothrombotic effects on vascular cells. J Mol Cell Cardiol 2009;46(2):234–40. Yin J, Zhang HJ, Ye JP. Traditional Chinese medicine in treatment of metabolic syndrome. Endocr Metab Immune Disord Drug Targets 2008;8(2):99–111. Wang XL, Wang RF, Xing DM, Su H, Ma C, Ding Y, et al. Kinetic difference of berberine between hippocampus and plasma in rat after intravenous administration of Coptidis rhizoma extract. Life Sci 2005;77(24):3058–67. Pan GY, Wang GJ, Liu XD, Fawcett JP, Xie YY. The involvement of Pglycoprotein in berberine absorption. Pharmacol Toxicol 2002;91(4):193–7. Miyazaki H, Shirai E, Ishibashi M, Niizima K. Quantitative analysis of berberine in urine samples by chemical ionization mass fragmentography. J Chromatogr 1978;152:79–86. Chen CM, Chang HC. Determination of berberine in plasma, urine and bile by high-performance liquid chromatography. J Chromatogr B 1995;665:117–23. Zuo F, Nakamura N, Akao T, Hattori M. Pharmacokinetics of Berberine and its main metabolites in conventional and perm-free rats determined
[22]
[23]
[24]
[25]
[26] [27]
[28]
[29] [30]
[31]
[32]
237
by liquid chromatography/ion trap mass spectrometry. Drug Metab Dispos 2006;34(12):2064–72. Qiu F, Zhu ZY, Kang N, Piao SJ, Qin GY, Yao XS. Isolation and identification of urinary metabolites of berberine in rats and humans. Drug Metab Dispos 2008;36(11):2159–65. Issandou M, Guillard R, Boullay AB, Linhart V, Lopez-Perez E. Upregulation of low-density lipoprotein receptor in human hepatocytes is induced by sequestration of free cholesterol in the endosomal/ lysosomal compartment. Biochem Pharmacol 2004;67:2281–9. Lee S, Lim HJ, Park JH, Lee KS, Jang Y, Park HY. Berberine-induced LDLR up-regulation involves JNK pathway. Biochem Biophys Res Commun 2007;362:853–7. Li YH, Yang P, Kong WJ, Wang YX, Hu CQ, Zuo ZY, et al. Berberine analogues as a novel class of the low-density-lipoprotein receptor upregulators: synthesis, structure-activity relationships, and cholesterollowering efficacy. J Med Chem 2009;52:492–501. Li XG, Yang LG, Chen LX, Qiu F. Chemical constituents from the decoction of Coptis chinensis Franch. J Shenyang Pharm Univ 2012;29:193–8. Cameron J, Ranheim T, Kulseth MA, Leren TP, Berge KE. Berberine decreases PCSK9 expression in Hep G2 cells. Atherosclerosis 2008;201:266–73. Yu C, Zhang H, Ren JY, Pan JF, Hong YC, Ren JY, et al. Determination and preliminary studies of metabolism of berberine in human urine after oral administration. Chin J Clin Pharm 2000;16:36–9. Tsai PL, Tsai TH. Hepatobiliary excretion of berberine. Drug Metab Dispos 2004;32(4):405–12. Cao SJ, Zhou Y, Xu PX, Wang Y, Yan JK, Bin W, et al. Berberine metabolites exhibit triglyceride-lowering effects via activation of AMP-activated protein kinase in Hep G2 cells. J Ethnopharmacol 2013;149:576–82. Li Y, Ren G, Wang YX, Kong WJ, Yang P, Wang YM, et al. Bioactivities of berberine metabolites after transformation through CYP450 isoenzymes. J Transl Med 2011;9(1):62. Brown MS, Gold JL. A receptor-mediated pathway for cholesterol homeostasis. Science 1986;232:34–47.
Contents lists available at ScienceDirect
Fitoterapia journal homepage: www.elsevier.com/locate/fitote
Berberine metabolites could induce low density lipoprotein receptor up-regulation to exert lipid-lowering effects in human hepatoma cells Yan Zhou a,c,1, Shijie Cao b,1, Ying Wang a, Peixiang Xu a, Jiankun Yan b, Wen Bin a, Feng Qiu b,⁎, Ning Kang a,⁎⁎ a b c
Department of Biochemistry and Molecular Biology, Shenyang Pharmaceutical University, 103 Wenhua Road, Shenyang 110016, PR China Department of Natural Products Chemistry, Shenyang Pharmaceutical University, 103 Wenhua Road, Shenyang 110016, PR China Department of Neurology, Xuzhou Medical College, 209 Tongshan Road, Xuzhou 221004, PR China
a r t i c l e
i n f o
Article history: Received 2 August 2013 Accepted in revised form 27 November 2013 Available online 7 December 2013 Keywords: Berberine Metabolites LDLR Lipid accumulation Human hepatoma cells
a b s t r a c t Berberine (BBR) is an isoquinoline alkaloid isolated from several Chinese herbal medicines, such as Coptis chinensis, Berberis aristata, and Coptis japonica. It exhibits a lipid-lowering effect by up-regulating the hepatic low density lipoprotein receptor (LDLR) expression. However, the plasma concentration of BBR is very low after oral administration for the reason that BBR is poorly absorbed and rapidly metabolized. Therefore, it is hard to explain the pharmacological effects of BBR in vivo. Here, RT-PCR, Western blotting and Oil Red O staining were used to investigate the effects of four BBR metabolites on LDLR expression and lipid accumulation in human hepatoma Hep G2 cells. Our results suggested that BBR increased the LDLR mRNA and protein levels in a time- and dose-dependent manner. Four metabolites of BBR, jatrorrhizine, columbamine, berberrubine and demethyleneberberine, were found to be able to up-regulate LDLR mRNA and protein expression. Moreover, almost all the metabolites had potent effects on inhibiting cellular lipid accumulation. These results suggest that both BBR and its metabolites exhibit lipid-lowering effects by up-regulating LDLR expression, and BBR and its metabolites might be the in vivo active forms of BBR produced after oral administration. This study provides information to help us understand the mechanisms underlying the hypolipidemic effects of BBR in vivo. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Despite considerable improvements in medical care over the past 25 years, cardiovascular disease remains a major public health challenge. It is the leading cause of death in ⁎ Correspondence to: F. Qiu, Department of Natural Products Chemistry, Shenyang Pharmaceutical University, 103 Wenhua Road, Shenyang 110016, PR China. Tel.: +86 24 23986463; fax: +86 23986463. ⁎⁎ Correspondence to: N. Kang, Department of Biochemistry and Molecular Biology, Shenyang Pharmaceutical University, 103 Wenhua Road, Shenyang 110016, PR China. Tel.: +86 24 23986435; fax: +86 24 23986463. E-mail addresses: [email protected] (F. Qiu), [email protected] (N. Kang). 1 Yan Zhou and Shijie Cao contributed equally to this work. 0367-326X/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.fitote.2013.11.010
Europe and USA and, in China, heart and cerebrovascular diseases are responsible for nearly 40% of all deaths [1–3]. Hypercholesterolaemia is characterized by high low density lipoprotein (LDL) plasma concentrations. The relationship between LDL-cholesterol and the risk of cardiovascular disease is well established and a reduction in LDL-cholesterol levels is a treatment goal and an indicator of the success of lipid-lowering therapies [4,5]. LDLR is a cell surface transmembrane protein that mediates the uptake of LDL and its degradation in lysosomes, which provides cells with cholesterol [6]. Some drugs are prescribed to lower LDL-cholesterol concentrations, and the most efficacious group are the statins [7]. Therefore, increased hepatic LDLR expression results in improved clearance of plasma LDL-cholesterol, which is
Y. Zhou et al. / Fitoterapia 92 (2014) 230–237
strongly associated with a decreased risk of cardiovascular diseases. Berberine (BBR) is an isoquinoline alkaloid isolated from several Chinese herbal medicines, such as Coptis chinensis, Berberis aristata, and Coptis japonica. It has been used in traditional oriental medicine for the treatment of gastroenteritis and secretory diarrhea [8]. Multiple pharmacological effects have been attributed to BBR and its related derivatives, such as antidiarrheic, antimicrobial, anticancer, antiinflammatory, and antiarrhythmic actions [9–13]. Recently, BBR was identified as a promising lipid-lowering drug, able to effectively up-regulate hepatic LDLR expression in liver cells and vascular cells, and it has been shown to decrease both serum triglycerides and cholesterol [14–16]. However, more and more investigations have revealed the limitations of BBR, including its low bioavailability and poor intestinal absorption [17,18]. The plasma concentration of BBR is very low after oral administration because BBR is poorly absorbed [19,20]. Intriguingly, BBR still exhibits a lipid-lowering effect even though it is rapidly transferred from the blood to the liver and bile and eliminated quickly. Zuo et al. [21] found that BBR was extensively metabolized in the body, and its metabolites maintained high plasma levels. Therefore, we speculated that the metabolites of BBR might be the main existing forms in the human body which would account for the pharmacological effects in vivo. In our previous work, we identified nine urinary metabolites of BBR in rats and humans [22]. Here, we examined four phase I metabolites of BBR involving their effects on LDLR up-regulation and lipid-lowering in human hepatoma Hep G2 cells which are considered suitable and convenient models for studying the regulation of hepatic
231
LDL-cholesterol metabolism [23–25]. The results of our investigations should be helpful in providing a better understanding of the mechanisms underlying the lipid-lowering properties of BBR in vivo. 2. Materials and methods 2.1. Chemicals Berberine chloride (purity N 99.5%) was supplied by the Northeast General Pharmaceutical Factory (Shenyang, China). Jatrorrhizine (M1) and columbamine (M2) were isolated from C. chinensis Franch [26]. Berberrubine (M3) was obtained by hydrolysis of 3,10-demethylpalmatine-10-O-sulfate with βglucuronidase, followed by extraction with chloroform [22]. Demethyleneberberine (M4) was prepared by structural modification of BBR [21]. The chemical structures of the four BBR metabolites are shown in Fig. 1. BBR and its metabolites were dissolved in dimethyl sulfoxide (DMSO) to obtain a stock solution, and the DMSO concentration was kept below 0.05% in all the cell cultures so that it had no detectable effect on cell growth. 2.2. Reagents Fetal bovine serum (FBS) was obtained from TBD Biotechnology Development (Tianjin, China) and RPMI-1640 medium was obtained from Gibco/BRL (Gaithersburg, MD, USA). Antibodies against LDLR, β-actin and horseradish peroxidaseconjugated secondary antibodies (goat-anti-rabbit and goatanti-mouse) were purchased from Santa Cruz Biotechnology
Fig. 1. Chemical structures of BBR and its metabolites (M1–M4).
232
Y. Zhou et al. / Fitoterapia 92 (2014) 230–237
(Santa Cruz, CA, USA). In addition, 3-(4, 5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide (MTT) was purchased from Sigma Chemical (St. Louis, MO, USA). An enhanced chemiluminescence (ECL) reagent was purchased from Thermo Scientific (Rockford, IL, USA). RNA isolation reagent and Oil Red O were purchased from Sigma-Aldrich (St. Louis, MO, USA). The RT reagent Kit and PCR reagent were obtained from TaKaRa (TaKaRa Biotechnology Co. Ltd. Dalian, China).
30 cycles of 94 °C 30 s, 58 °C 30 s, 72 °C 40 s, and finally 72 °C 7 min. PCR products were analyzed by 2% agarose gel electrophoresis using TBE buffer. The bands were photographed using image Quant 300 (GE Healthcare, USA). Densitometric analysis of the bands was performed by Image J software (National Institutes of Health, USA). The expression of the GAPDH housekeeping gene was used to normalize the PCR reaction.
2.3. Cell culture 2.6. Western blot analysis Human hepatoma Hep G2 cells were obtained from American Type Culture Collection (ATCC, Manassas, VA, USA). The cells were cultured in RPMI-1640 medium, containing penicillin (100 U/mL), streptomycin (100 mg/mL), and 10% FBS at 37 °C with 5% CO2 in a humidified atmosphere. The cells used in the experiments were in the exponential phase of growth. 2.4. Cell viability assay Cell viability of BBR and M1–M4 on Hep G2 cells was measured by MTT assay. Hep G2 cells were seeded onto 96-well culture plates at a density of 6 × 104 cells/well and treated with the indicated concentrations of BBR and M1–M4 for 24 h. After reagent treatment for 24 h, the cells were washed once with PBS (Phosphate buffer solution). Subsequently, MTT was then added at a final concentration of 0.5 μg/mL, and the cells were further incubated for 2.5 h at 37 °C. The medium was removed, and the formazan crystals were dissolved in DMSO (150 μL). The optical density (OD) was measured at 492 nm using an ELISA microplate reader. The percentage cell viability was calculated as follows:
Hep G2 cells were incubated with BBR or its metabolites for 24 h. Both adherent and floating cells were collected and frozen at −80 °C. Western blot analysis was performed as follows: the cell pellets were resuspended in lysis buffer consisting of 50 mM Hepes (pH 7.4), 1% Triton-X 100, 2 mM sodium orthovanadate, 100 mM sodium fluoride, 1 mM edetic acid, 1 mM PMSF, 10 mg/L aprotinin, and 10 mg/L leupeptin and lysed at 4 °C for 30 min. Then, the cells were centrifuged at 12,000 ×g for 10 min. The Bradford Method was used to determine the protein concentration. The proteins were separated by 8% SDS polyacrylamide gel electrophoresis and then electrophoretically transferred to PVDF membranes (Millipore, USA). The membranes were blocked with 5% skimmed milk for 2 h, and incubated with primary polyclonal antibodies at 4 °C overnight. The proteins were visualized by using suitable IgG conjugated with peroxidase. Immunoreactive protein was detected with the ECL kit. The levels of LDLR protein were obtained by densitometric scanning.
2.7. Oil Red O staining Cell viabilityð% Þ h i ¼ A492;Sample −A492;Blank = A492;Control −A492;Blank 100:
2.5. RNA extraction and reverse transcription-polymerase chain reaction analysis Total RNA from Hep G2 cells was isolated using TRI Reagent (Sigma, USA) and RNA was extracted according to the manufacturer's instructions. The RNA concentration was determined by a spectrophotometer (GE Healthcare, USA) at A260 and the purity accepted as suitable if the ratio of A260/ A280 ranged from 1.8 to 2.0. Then, using the RT reagent kit, cDNA was synthesized from 500 ng RNA at 85 °C for 15 min followed by 95 °C for 5 min. Specific primers for amplification of LDLR and glyceraldehyd-3-phosphate dehydrogenase (GAPDH) were designed based on the sequence of these two genes available from GenBank sequence data. The primers used in the study are listed in Table 1. PCR was performed with the following program: 94 °C 4 min, then followed by
To measure cellular neutral lipid droplet accumulation, Hep G2 cells (3 × 105) were cultured in 6-well plates (Corning Costar, NY, USA) in RPMI-1640 culture medium for 24 h, and then treated with 15 μM BBR and its metabolites for 24 h. After treatment, the cells were washed with PBS twice and fixed with 10% formalin for 60 min. After fixation, the cells were washed and dyed with 60% Oil Red O staining working buffer for 1 h at room temperature. After dyeing, the cells were washed with ultrapure water, and counterstaining of the nuclei was carried out with Mayer's hematoxylin. The staining pattern was observed using a phase contrast microscope (Motic, USA). To quantitate the Oil Red O content levels, isopropanol was added to each sample followed by shaking at room temperature for 5 min, and then the samples were read spectrophotometrically at 490 nm using a plate reader (BioTek ELx800, USA). The level of lipid in the control group was defined as 100%, and the amount of lipid from the tested compound-treated groups was plotted relative to that value.
2.8. Statistical analysis Table 1 Primer sequences of target genes for RT-PCR analysis. Gene name
Forward primer (5′ to 3′)
Reverse primer (5′ to 3′)
LDLR GAPDH
CAGCAGGCGTACCAACGCAC TGCACCACCAACTGCTTAG
GCGATCAGGTGAAGTTGGC GACGCAGGGATGATGTTC
All results were confirmed in at least three separate experiments. Data were expressed as the means ± S.D. They were analyzed with the Student's t-test at a *P b 0.05 level of statistical significance to evaluate differences between groups.
Y. Zhou et al. / Fitoterapia 92 (2014) 230–237
3. Results 3.1. Effects of BBR and its metabolites on viability of Hep G2 cells To determine the cytotoxic effect, the viabilities of Hep G2 cells treated with increasing concentrations of BBR were measured by MTT assay. As shown in Fig. 2A, the viabilities of the cells treated with 0–15 μM of BBR for 24 h were not significantly different from that of the control group. These results demonstrated that BBR up to 15 μM could be used to treat Hep G2 cells without the concern about cytotoxic effects under the current experimental conditions. To investigate the cellular toxicity of the other test compounds, 15 μM samples were applied to Hep G2 cells for 24 h as described. The BBR metabolites did not show any cellular toxicity up to a concentration of 15 μM (Fig. 2B) and so we conducted the subsequent experiments using 15 μM of all the test compounds including BBR. 3.2. Effects of BBR on LDLR expression in Hep G2 cells Abundant evidence has indicated that BBR has a lipidlowering effect by up-regulating hepatic LDLR [14,24,27]. Therefore, we investigated whether BBR affected the LDLR expression in our model. To check the effect of BBR on the LDLR mRNA level, the amount of LDLR mRNA in Hep G2 cells treated with increasing concentrations of BBR was determined. As expected, BBR treatment dose-dependently increased the LDLR mRNA expression (Fig. 3A). The levels of LDLR mRNA reached a maximal level as 1.5-fold higher than
233
the control, when the concentration of BBR was 15 μM. Furthermore, to find the optimum incubation time, we treated Hep G2 cells with BBR for different periods. The time-course experiment also revealed that BBR increased the LDLR mRNA in a time-dependent manner. After 12 h and 24 h, the levels of LDLR mRNA were up-regulated by nearly 1.3-fold and 1.4-fold, respectively (Fig. 3B). To investigate whether BBR increased the LDLR protein level, the expression of LDLR protein in Hep G2 cells was evaluated by Western blot analysis. The BBR-treated group showed a dose-dependent increase in the expression of LDLR protein (Fig. 3C). The histogram showed a 60% increase of LDLR protein in cells treated with 15 μM BBR, while there was a 50% and 33% increase in LDLR protein expression when treated with 20 and 25 μM BBR, respectively. It was also apparent that the level of LDLR protein reached a peak that was 1.42-fold higher than the control at 24 h (Fig. 3D). Driven by the above-mentioned results, we therefore treated Hep G2 cells with 15 μM doses of drugs at 24 h in the following experiments. 3.3. Effects of BBR metabolites on LDLR expression in Hep G2 cells Next, M1–M4 were used to examine their effects on LDLR expression. Hep G2 cells were treated with each of the metabolites for 24 h, and the cellular mRNA was extracted to measure the intracellular LDLR expression by RT-PCR. As shown in Fig. 4A, all of the four metabolites increased the LDLR mRNA expression 1.34-fold, 1.24-fold, 1.61-fold and 1.41-fold respectively. M3 was more active than BBR and M1 and M4 had similar effects on LDLR mRNA expression compared with BBR, and they were all more effective than the control. To examine the changes in the LDLR protein level in Hep G2 cells treated with the four metabolites of BBR, we studied the expression of LDLR protein by Western blot analysis. As shown in Fig. 4B, the level of LDLR expression following treatment with BBR increased by more than 38% compared with the control group. M1 exhibited a similar activity on LDLR protein expression to that of BBR treatment, and M2, M3 and M4 significantly increased the LDLR protein level by 50, 60 and 53%, respectively. 3.4. Effects of BBR metabolites on cellular lipid accumulation in Hep G2 cells
Fig. 2. Effects of BBR and its metabolites on Hep G2 cells viability. Various concentrations of BBR (0–20 μM) (A) and 15 μM M1–M4 (B) were treated on Hep G2 cell for 24 h. Cell viability was measured by MTT assay. Data are presented as means ± S.D. for triplicate experiments.
As indicated above, BBR and its metabolites increased the expression of LDLR in Hep G2 cells. To assess the physiological impact of BBR and its metabolites on cellular lipid content, we stained neutral lipids in Hep G2 cells with Oil Red O reagent after a 24 h treatment with the test compounds (Fig. 5). After staining with Oil Red O, many red stained lipid droplets were detected in the untreated control group. All the experimental groups showed an intracellular lipid content that was significantly reduced following treatment with the test compounds (Fig. 5A). For quantitative analysis of the neutral lipid content, the absorbance of Oil Red O eluted solution was measured at 490 nm. The absorbance of Oil Red O corresponded to the results of the cellular morphological changes (Fig. 5B). The lipid content of the control sample was
234
Y. Zhou et al. / Fitoterapia 92 (2014) 230–237
Fig. 3. Up-regulation of LDLR expression by BBR in Hep G2 cells. (A) Effect of increasing concentrations of BBR on the amount of LDLR mRNA. (B) Effect of 15 μM BBR on the amount of LDLR mRNA over time. (C) Effect of increasing concentrations of BBR on the LDLR protein expression. (D) Effect of 15 μM BBR on the LDLR protein expression over time. The results are shown as means ± S.D. of three independent experiments.
defined as 100% for the comparison with that of the samples treated with BBR and its metabolites. As shown in Fig. 5B, the lipid content was reduced by about 10% after M1 or M2 treatment. It was reduced by around 20% after treatment with M3, and this effect was similar to that of the BBR treated group. Notably, M4 was more effective than BBR in attenuating hepatic lipid accumulation, because it produced a 25% reduction in lipids compared with the control group. 4. Discussion BBR, a major active constituent of several Chinese herbal medicines, has multiple pharmacological effects, such as antimicrobial, antihyperglycemic, hypolipidemic and antineoplastic activities. Among these bioactivities, the lipid-lowering effect has
received much attention. Our data also shows that BBR effectively inhibits Hep G2 cellular lipid accumulation (Fig. 5). However, some pharmacokinetic studies have indicated that BBR has poor oral bioavailability [20,28]. In the concentrationtime course experiment in rats, the peak level of BBR reached 10 ng/mL at 2 h after p.o. administration, and it then underwent elimination within 12 h, then maintained a very low plasma concentration for 48 h [21]. The low blood concentration and low biological availability seemed to be a stumbling block for the selection of BBR as a promising lipid-lowering drug candidate for further evaluation. Interestingly, BBR still retained a lipid-lowering effect [14,29]. Why and how could this happen? It has been reported that the BBR concentration is quite low in plasma, but its metabolites remain at much higher concentrations for a long time. The AUC0-limt and concentration
Y. Zhou et al. / Fitoterapia 92 (2014) 230–237
Fig. 4. Effects of BBR metabolites on LDLR expression in Hep G2 cells. The cells were treated with 15 μM BBR and its metabolites for 24 h and the mRNA expression of LDLR and GAPDH was determined by RT-PCR (A). The protein expression of LDLR and β-Actin was detected by Western blotting (B). The results are shown as means ± S.D. of three independent experiments. *P b 0.05, compared with the untreated control.
peak values of the metabolites were much higher than those of BBR [21]. Accordingly, we presume that some biotransformed products may play an important role in the effectiveness of BBR. In this study, we prepared the phase I metabolites of BBR and examined their hypolipidemic activities in order to clarify the real effective forms in vivo. The cell viability assay is a key step for the study of lipidlowering activities. The MTT assays were used to discern whether the lipid-lowering effects of BBR and its metabolites on Hep G2 cells were attributable to cytotoxic effects. In this study, the cellular toxicity of BBR was dose-dependent and no adverse effects on cell proliferation were detected up to 15 μM. We also confirmed that the 15 μM samples of BBR metabolites used in this study were safe (Fig. 2). The findings of Kong showed that BBR could be considered as a new hypolipidemic drug with a mechanism of action distinct from that of statins [14]. Both Kong and Lee
235
demonstrated that BBR exhibited a cholesterol-lowering effect by upregulating LDLR expression [14,24]. To verify this bioactivity and find the best experimental conditions, we tested the effect of BBR on LDLR mRNA and protein levels in Hep G2 cells. Consistent with those reports, our results also showed that BBR increased the expression of LDLR mRNA and protein in Hep G2 cells in a time- and dose-dependent manner (Fig. 3). Up to now, studies of BBR metabolites have concentrated more on metabolite identification and structural analysis. However, the hypolipidemic effects of BBR metabolites and their related mechanisms have only been reported rarely. Our recent study demonstrated that BBR and its metabolites exhibited triglyceride-lowering effects through activation of the AMPK signaling pathway [30]. In this study, each of the BBR metabolites was examined for its effects on the expression of LDLR in human hepatocytes. Our results showed that all four metabolites, M1–M4, could enhance the expression of LDLR both in regard to mRNA and the protein level (Fig. 4). The intracellular lipid content was also significantly reduced after liver cells were treated with the four metabolites (Fig. 5). Li et al. obtained the four major metabolites of BBR, berberrubine, thalifendine, demethyleneberberine and jatrorrhizine, by chemical synthesis. However, the results of their experiments showed that the LDLR mRNA was increased only by berberrubine or thalifendine with an activity of only 35% or 26% that of BBR, respectively, but not by demethyleneberberine and jatrorrhizine [31]. Moreover, we found that there were some differences in the results between the LDLR mRNA level and the protein level following treatment with the four metabolites of BBR. As previously reported, BBR-induced LDLR up-regulation involved a post-transcriptional mechanism through the 3′ untranslated region [14]. Our work showed that, in the case of the mRNA level, M3 was more active than M1 and M4, and had a similar activity to BBR while, regarding the protein level, all four metabolites were more active than BBR. Our results revealed that the regulation of LDLR expression probably also occurs at a posttranscriptional level. Further studies are needed to clarify the molecular mechanism of action of LDLR up-regulation induced by BBR metabolites. The cholesterol-lowering properties of BBR have been observed in human and animal studies [3,6], and the efficacy is comparable or greater than that produced by most current natural products [7–9]. In the present study, BBR and its metabolites were shown to enhance the expression of LDLR in Hep G2 cells. The LDLR pathway is the main route of hepatocellular cholesterol metabolism, and the expression of LDLR reflects the content of cellular cholesterol [32]. Consistent with the effects of BBR on LDLR expression, BBR markedly reduced the lipid content of Hep G2 cells (Fig. 5). In the course of our bioactive screening of BBR metabolites, we first investigated the effects of the test compounds on the intracellular lipid content. The results obtained showed that the intracellular lipid content was significantly reduced after treatment of the liver cells with BBR metabolites (Fig. 5). M3 and M4 produced strong inhibition of cellular lipid accumulation, which suggested that BBR metabolites might be potent lipid-lowering forms in vivo. In summary, the results obtained in the present study indicate that all four metabolites of BBR contribute to the up-regulation of LDLR and the inhibition of lipid accumulation in human hepatoma Hep G2 cells, and M3 and M4 are
236
Y. Zhou et al. / Fitoterapia 92 (2014) 230–237
Fig. 5. Inhibition of BBR and its metabolites on intracellular lipid accumulation in Hep G2 cells. Cells were treated with BBR and its metabolites (15 μM) for 24 h. (A) The cellular lipid depositions were observed under an inverted microscope with Oil Red O dye method (scale bar = 10 μm). (B) Stained lipid content was quantified by measuring absorbance. The results are shown as means ± S.D. of three independent experiments.*P b 0.05, compared with the untreated control.
the most effective. Accordingly, we propose that the main active forms of BBR after oral administration are BBR and its metabolites. Both BBR and its metabolites have lipid-lowering effects in vivo. Acknowledgments This work was supported by the National Natural Science Foundation of China (No. 20972098), the Foundation of Liaoning Educational Committee (Nos. 20060877 and LS2010160) and the Shenyang Talent Resource Development Special Funds (No. 2012021103019). References [1] European cardiovascular disease statistics. http://www.heartstats.org/ datapage.asp?id=7683; 2008.
[2] D'Agostino RB, Russell MW, Huse DM, Ellison RC, Silbershatz H, Wilson PW, et al. Primary and subsequent coronary risk appraisal: new results from the Framingham study. Am Heart J 2000;139(2):272–81. [3] Ministry of Health of the People's Republic of China. Death rate of 10 main diseases in certain region in 2009 (total); 2011 [Published on the Internet http://www.moh.gov.cn/publicfiles//business/htmlfiles/wsb/ index.htm]. [4] Jain KS, Kathiravan MK, Somani RS, Shishoo CJ. The biology and chemistry of hyperlipidemia. Bioorg Med Chem 2007;15(14):4674–99. [5] Executive Summary of the Third Report of the National Cholesterol Education Program (NCEP) Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (Adult Treatment Panel III). JAMA 2001;285:2486–97. [6] Maxfield FR, van Meer G. Cholesterol, the central lipid of mammalian cells. Curr Opin Cell Biol 2010;22(4):422–9. [7] Costet P. Molecular pathways and agents for lowering LDL-cholesterol in addition to statins. Pharmacol Ther 2010;126(3):263–78. [8] Chinese Pharmacopeia Committee. Pharmacopeia of People's Republic of China, 1. Beijing: Chemical Industry Press; 2005 213–4. [9] Taylor CT, Baird AW. Berberine inhibition of electrogenic ion transport in rat colon. Brit J Pharmacol 1995;116(6):2667–72. [10] Kaneda Y, Torii M, Tanaka T, Aikawa M. In vitro effects of berberine sulphate on the growth and structure of Entamoeba histolytica,
Y. Zhou et al. / Fitoterapia 92 (2014) 230–237
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[18] [19]
[20]
[21]
Giardia lamblia and Trichomonas vaginalis. Ann Trop Med Parasitol 1991;85(4):417–25. Iizuka N, Miyamoto K, Okita K, Tangoku A, Hayashi H, Yosino S, et al. Inhibitory effect of Coptidis Rhizoma and berberine on the proliferation of human esophageal cancer cell lines. Cancer Lett 2000;148(1):19–25. Ckless K, Schlottfeldt JL, Pasqual M, Moyna P, Henriques JAP, Wajner M. Inhibition of in-vitro lymphocyte transformation by the isoquinoline alkaloid berberine. J Pharm Pharmacol 1995;47(12A):1029–31. Sanchez-Chapula J. Increase in action potential duration and inhibition of the delayed rectifier outward current IK by berberine in cat ventricular myocytes. Brit J Pharmacol 1996;117(7):1427–34. Kong WJ, Wei J, Abidi P, Lin MH, Inaba S, Li C, et al. Berberine is a novel cholesterol-lowering drug working through a unique mechanism distinct from statins. Nat Med 2004;10(12):1344–51. Holy EW, Akhmedov A, Lüscher TF, Tanner FC. Berberine, a natural lipid-lowering drug, exerts prothrombotic effects on vascular cells. J Mol Cell Cardiol 2009;46(2):234–40. Yin J, Zhang HJ, Ye JP. Traditional Chinese medicine in treatment of metabolic syndrome. Endocr Metab Immune Disord Drug Targets 2008;8(2):99–111. Wang XL, Wang RF, Xing DM, Su H, Ma C, Ding Y, et al. Kinetic difference of berberine between hippocampus and plasma in rat after intravenous administration of Coptidis rhizoma extract. Life Sci 2005;77(24):3058–67. Pan GY, Wang GJ, Liu XD, Fawcett JP, Xie YY. The involvement of Pglycoprotein in berberine absorption. Pharmacol Toxicol 2002;91(4):193–7. Miyazaki H, Shirai E, Ishibashi M, Niizima K. Quantitative analysis of berberine in urine samples by chemical ionization mass fragmentography. J Chromatogr 1978;152:79–86. Chen CM, Chang HC. Determination of berberine in plasma, urine and bile by high-performance liquid chromatography. J Chromatogr B 1995;665:117–23. Zuo F, Nakamura N, Akao T, Hattori M. Pharmacokinetics of Berberine and its main metabolites in conventional and perm-free rats determined
[22]
[23]
[24]
[25]
[26] [27]
[28]
[29] [30]
[31]
[32]
237
by liquid chromatography/ion trap mass spectrometry. Drug Metab Dispos 2006;34(12):2064–72. Qiu F, Zhu ZY, Kang N, Piao SJ, Qin GY, Yao XS. Isolation and identification of urinary metabolites of berberine in rats and humans. Drug Metab Dispos 2008;36(11):2159–65. Issandou M, Guillard R, Boullay AB, Linhart V, Lopez-Perez E. Upregulation of low-density lipoprotein receptor in human hepatocytes is induced by sequestration of free cholesterol in the endosomal/ lysosomal compartment. Biochem Pharmacol 2004;67:2281–9. Lee S, Lim HJ, Park JH, Lee KS, Jang Y, Park HY. Berberine-induced LDLR up-regulation involves JNK pathway. Biochem Biophys Res Commun 2007;362:853–7. Li YH, Yang P, Kong WJ, Wang YX, Hu CQ, Zuo ZY, et al. Berberine analogues as a novel class of the low-density-lipoprotein receptor upregulators: synthesis, structure-activity relationships, and cholesterollowering efficacy. J Med Chem 2009;52:492–501. Li XG, Yang LG, Chen LX, Qiu F. Chemical constituents from the decoction of Coptis chinensis Franch. J Shenyang Pharm Univ 2012;29:193–8. Cameron J, Ranheim T, Kulseth MA, Leren TP, Berge KE. Berberine decreases PCSK9 expression in Hep G2 cells. Atherosclerosis 2008;201:266–73. Yu C, Zhang H, Ren JY, Pan JF, Hong YC, Ren JY, et al. Determination and preliminary studies of metabolism of berberine in human urine after oral administration. Chin J Clin Pharm 2000;16:36–9. Tsai PL, Tsai TH. Hepatobiliary excretion of berberine. Drug Metab Dispos 2004;32(4):405–12. Cao SJ, Zhou Y, Xu PX, Wang Y, Yan JK, Bin W, et al. Berberine metabolites exhibit triglyceride-lowering effects via activation of AMP-activated protein kinase in Hep G2 cells. J Ethnopharmacol 2013;149:576–82. Li Y, Ren G, Wang YX, Kong WJ, Yang P, Wang YM, et al. Bioactivities of berberine metabolites after transformation through CYP450 isoenzymes. J Transl Med 2011;9(1):62. Brown MS, Gold JL. A receptor-mediated pathway for cholesterol homeostasis. Science 1986;232:34–47.
