Proc. Nati. Acad. Sci. USA Vol. 89, pp. 6075-6079, July 1992 Medical Sciences
f8-Amyloid precursor protein cleavage by a membranebound protease SANGRAM S. SISODIA* Department of Pathology and the Neuropathology Laboratory, The Johns Hopkins University School of Medicine, Baltimore, MD 21205
Communicated by M. Daniel Lane, April 6, 1992
ABSTRACT The principal component of amyloid plaques in Alzheimer disease is .3-amyloid protein, an -4-kDa peptide derived from amyloid precursor proteins. Previous studies have established that amyloid precursor proteins are secreted after proteolytic cleavage within the (3-amyloid peptide. The present investigation documents that, in cultured cells, amyloid precursor protein is cleaved on the plasma membrane by a membrane-bound endoprotease and that the specificity of peptide bond hydrolysis is largely independent of the primary sequence of the precursor. The principal determinants of cleavage appear to be an a-helical conformation and the distance (12-13 residues) of the hydrolyzed bond from membrane.
cleavage site are cleaved efficiently. Amid the apparent lack of sequence specificity, the primary determinants for proteolysis appear to be an a-helical conformation and the distance (12-13 amino acids) of the hydrolyzed bond from the membrane. MATERIALS AND METHODS Transfection, Cell Labeling, Immunoprecipitation, and Immunoblotting. Details of these methods have been described (17). Briefly, COS-1 cells were transfected by the CaPO4 coprecipitation technique with supercoiled plasmid DNA. Approximately 40 hr after transfection, cells were metabolically labeled with [35S]methionine for 2.5-4 hr. For analysis of newly synthesized proteins, cells were labeled for 10 min with [35S]methionine and were chased for 20 min in unlabeled methionine. For immunoprecipitation, labeled cells were lysed in buffer containing detergents and protease inhibitors, and solubilized APP-related molecules were immunoprecipitated with APP-specific polyclonal antiserum. Immunoprecipitates or aliquots of conditioned medium were subjected to SDS/PAGE and were visualized after fluorographic enhancement and exposure of x-ray film. Stable Cell Lines. For generation of permanent cell lines, Chinese hamster ovary (CHO) cells were cotransfected with 1 ,Ag of circular plasmid DNA and 0.1 ,ug of pSV2neo (21), which harbors a gene encoding resistance to the neomycin analog G418, by the CaPO4 coprecipitation technique. Exogenous APPs in G418-resistant cell lines were assayed by immunoblot analysis of cell extracts with an APP-specific antibody, 22C11 (14). Plasmid Constructions. p770SP, p7706M, and p77011M. Plasmids p7706M and p77011M were constructed essentially as described for the construction of p770SP (17). Briefly, exonuclease III was used to generate 3' deletions of the APP-770 cDNA that resulted in truncations of C-terminal regions of the encoded polypeptide. Truncated cDNA was fused to a vector fragment encoding substance P to create p7706M and p77011M, which encoded the entire APP-770 extracellular domain and either 6 or 11 residues of the transmembrane helix, respectively. The sequence at the fusion site was verified by double-stranded sequencing of plasmid templates (22). p770DXB. p770 was digested with Xho I and Bgl II, and the ends were filled with Klenow DNA polymerase and deoxynucleotide triphosphates. The large (-5 kilobases) vector fragment was gel isolated and self-ligated to create p770DXB, which encodes an in-frame fusion between residues 380 and 665 of APP-770. Mutagenesis. For generation of mutations at Lys-13, Leu12, Val-11, or Phe-10, plasmid p770 (17) was incubated in
Alzheimer disease is a progressive neurodegenerative disorder that affects a significant percentage of elderly individuals. The classic neuropathological features of Alzheimer disease include senile plaques, composed of neurites and extracellular amyloid deposits, and intracellular neurofibrillary tangles in the hippocampus and cerebral cortex (1-4). The principal component of plaques is the ,3-amyloid protein (AP3) (5, 6), an -4-kDa peptide derived from larger amyloid precursor proteins (APPs) (7, 8). APPs are integral membrane glycoproteins of 695, 714, 751, and 770 amino acids (8-11); the two larger isoforms contain a domain homologous to the Kunitz family of protease inhibitors (12, 13). The 39- to 43-residue AP peptide is composed of 28 residues of the extracellular domain and 11-15 residues of the adjacent transmembrane domain of APP. Biochemical studies in cultured cells reveal that APPs mature rapidly through a constitutive secretory pathway and acquire N- and O-linked carbohydrates and tyrosine sulfate and phosphate during transit (14, 15). In addition, C-terminally truncated APP derivatives are secreted into the conditioned medium (14). The presence of C-terminally truncated APPs in the cerebrospinal fluid indicates that similar pathways may be used in vivo (14, 16). In previous efforts, we used molecular biological approaches to demonstrate that APPs were cleaved within the AP domain (17). Biochemical analysis of termini of membrane-retained and secreted molecules revealed that, in cultured mammalian cells, APP is cleaved between residues 16 (lysine) and 17 (leucine) of the AP3 sequence (18-20). In concert, these studies indicated that AP3 cannot be generated as an intact fragment as a result of this proteolytic event but, rather, is derived by an alternative processing pathway(s) of APP. In the present analysis, the cellular site(s) of APP cleavage and the structural specificities of the protease that liberate soluble APP derivatives are examined. This study documents that APP is a substrate when bound to the external side of the plasma membrane. The proteolytic activity exhibits a relaxed sequence specificity; membrane-bound precursors harboring widely differing primary sequences at or neighboring the
Abbreviations: A8, ,B-amyloid protein; APP, amyloid precursor protein. *To whom reprint requests should be addressed at: Neuropathology Laboratory, The Johns Hopkins University School of Medicine, 558 Ross Research Building, 720 Rutland Avenue, Baltimore, MD 21205-2196.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact. 6075
6076
PCR with "antisense" primer as2, CCGCTCGAGCTGTTTCTTCTTCAGCATC, complementary to the sequence encoding four residues of the APP cytoplasmic domain and adjacent transmembrane regions, and either of the following oligonucleotides: s30, CCGCTCGAGGGATATGAAGTTCATCATCAAVVVTTGGTGTTCT (V = A, G, or C), which encodes APP-770 residues 679-690 and is multiply degenerate at codon 687 (Lys-13); s32, CCGCTCGAGGGATATGAAGTTCATCATCAAAAAVVVGTGTTCTTTGC, which encodes APP-770 residues 679-692 and is multiply degenerate at codon 688 (Leu-12); s32, CCGCTCGAGGGATATGAAGTTCATCATCAAAAATTGVVVTTCTTTGCAGAAGATG, which encodes APP-770 residues 679694 and is multiply degenerate at codon 689 (Val-li); or s33,
CCGCTCGAGGGATATGAAGTTCATCATCAAAAATTGGTGVVVTTTGCAGAAGATG, which encodes APP770 residues 679-694 and is multiply degenerate at codon 690 (Phe-10), respectively. For synthesis of p770A15 and p770A15+i, plasmid p770 and antisense primer as2 (see above) were incubated in a PCR with either s34, CCGCTCGAGCATCAAAAATTGGTGTTCTTTGCAG, which encodes APP-770 residues 685-692; or s35, CCGCTCGAGCATCATCAAAAATTGGTGTTCTTTGTTACCAACGCAGAAGATG, which encodes APP-770 residues 685-695 and includes an insertion, Val-Thr-Asp. PCR products were digested with Xho I, purified by PAGE, and ligated to Xho I-digested and alkaline phosphatase-treated plasmid p770A (17). The sequence of inserted fragments was verified by double-stranded sequencing of plasmid templates (22). Surface Labeling. For surface-labeling studies, a stable CHO cell line, C7DXB, which overexpresses 770DXB polypeptides, was analyzed. Approximately 5 x 106 C7DXB cells in suspension culture were washed and surface labeled (4°C) in Hanks' balanced salt solution (HBSS) containing 1 mCi of 125I (1 Ci = 37 GBq) and Iodo-Gen reagent (Pierce). Cells were then washed with cold HBSS and placed in suspension medium prewarmed to 37°C. Aliquots of =106 cells were removed immediately or at various times thereafter, and APP-related polypeptides in cell lysates and medium at each time point were immunoprecipitated with APP-speciflic rabbit polyclonal antibody RGP-3. RGP-3 was elicited against a synthetic peptide corresponding to APP residues 45-62. For cell-surface crosslinking studies, monolayer cells were labeled with [35S]methionine, washed in cold phosphatebuffered saline (PBS), and subsequently incubated at 4°C in BS3 (Pierce), a membrane-impermeable crosslinking agent, prepared in PBS at 0.5 mg/ml. Cells were washed and then lysed, and APP-related polypeptides were immunoprecipitated and analyzed as described above.
RESULTS Membrane Association of APP Is Required for Cleavage. To
address whether association with the plasma membrane is obligatory for APP cleavage, the fate of APP-770-related polypeptides containing deletions of the entire cytoplasmic region and segments of the transmembrane domain was analyzed. COS-1 cells were transfected with genes encoding APP-770 in which the last 56 (p77011M) or 61 (p7706M) amino acids of APP (including 13 or 18 amino acids of the transmembrane domain, respectively) and the entire cytoplasmic domain were replaced with a 16-amino acid epitope tag that contains the C terminus of neuropeptide substance P (23) (Fig. 1A). Hybrid 77011M and 7706M molecules were expected to mature through the secretory pathway as soluble (nonmembrane associated) polypeptides because the residual transmembrane sequences from APP-770 are too short to span the lipid bilayer and to serve as a membrane anchor. After biosynthetic labeling, both 7706M and 77011M polypeptides migrated at -105 kDa, a position appropriate for the
fi~ 97
Proc. Natl. Acad. Sci. USA 89 (1992)
Medical Sciences: Sisodia
A
-,
m
-200
^C 20B) ;; -20:)
_
-
-
*
1
2 -68 1 2 3 4 Ab SP APP SP
ism 1
Cetl
2
_ 3
4
Trans Sup
Stable Sup
5
Sup
FIG. 1. Membrane association is obligatory for cleavage. (A) Structure of hybrid APP-770-substance P polypeptides. Position of Lys-687, immediately N-terminal to the cleavage site, is shown. APP-770 residues 1-684 (stippled box); APP transmembrane region (hatched box); APP cytoplasmic region (open box); and substance P sequences (solid box) are shown. (B) Analysis of hybrid 77011M and 7706M polypeptides in transfected COS-1 cells. Lanes: 1 and 2, [35S]methionine-labeled immunoprecipitates from cell lysates transfected with p77011M and p7706M plasmids, respectively; 3-5, total radiolabeled conditioned medium from untransfected cells or from cells transfected with p77011M and p7706M, respectively. Arrowheads, secreted 77011M- and 7706M-related molecules. Size markers are in kDa. (C) Secreted 77011M- and 7706M-related molecules retain substance P epitope. Conditioned medium from COS-1 cells transfected with p77011M (lane 1) or p7706M (lane 2) was concentrated and then immunoblotted with substance P-specific monoclonal antibody NCI 34. SP, substance P antibody. (D) 7706M is not cleaved before secretion in stably transfected CHO cells. Conditioned medium from CHO cells stably transfected with p770SP (lanes 1 and 3) or p7706M (lanes 2 and 4) was immunoblotted with APP-specific monoclonal antibody 22C11 (lanes 1 and 2) or with substance P-specific antibody NCI 34 (lanes 3 and 4).
N-glycosylated precursor, and larger species of 115-135 kDa (Fig. 1B, lanes 1 and 2). As expected, the conditioned medium contained 77011M- and 7706M-related molecules of =135 kDa (lanes 4 and 5). Immunoblot analysis of conditioned medium with a monoclonal antibody that recognizes an epitope at the C terminus of substance P revealed retention of substance P epitopes in secreted forms of 7706M and 77011M and proved that these polypeptides are not cleaved (Fig. 1C, lanes 1 and 2). A parallel analysis of conditioned medium from CHO cells stably transfected with p7706M also revealed that secreted 7706M molecules are full length (Fig. 1D, lane 4), whereas membrane-anchored substrates-i.e., 770SP (Fig. 1A)-in which the C-terminal 17 amino acids of APP are replaced with substance P sequences are cleaved efficiently (Fig. 1D, lane 3). These studies strongly suggest that APPs are cleaved only as a membrane-bound substrate by one or more membrane-associated proteases. APP Is Cleaved on the Plasma Membrane. Earlier studies in cultured cells documented the presence of full-length APP on the plasma membrane (14). Accordingly, the fate of APP molecules still bound to the plasma membrane was addressed. For this analysis, CHO cells were stably transfected with p770DXB, a plasmid that encodes APP-770 deleted of 285 residues of the extracellular domain but retains the entire cytoplasmic and transmembrane regions and adjacent 35 amino acids of the extracellular domain (Fig. 2A). One resultant cell line, C7DXB, was labeled metabolically with [35S]methionine, and APP-related molecules were immunoprecipitated from cells and conditioned medium. As expected, 770DXB appeared first as an -55-kDa precursor, matured to an -85-kDa O-glycosylated species (Fig. 2B, lane 1), and was secreted as a truncated =70-kDa molecule (lane 2). Subsequently, C7DXB cells were surface labeled with 1251
Proc. Natl. Acad. Sci. USA 89 (1992)
Medical Sciences: Sisodia
A
N
770
I
F
=,.
I
C
VIA x
-7 -0I
7772CsP
770A20
770DXB
BCIKW
A
I
C
0 5 102040
00
''
:%
:..
ei
'
B-
-a >, o
o
I, P-
>
..J
~--
mC m
--S ~~~
%.,
a
-
U
a,
>
.68
S
K
51020401min1
.97.
2
I- Cell
4 5
1 6 7 8 9 10 -s Sup't -'-1
_n
t
0 - - --w a
1
f t-i
.-A ~
mmm___o
4-'
04%4"M-
__ " g 0 _
at 40C, a temperature at which endocytosis is inhibited. This reaction resulted in labeling of an =85-kDa 770DXB polypeptide (Fig. 2C, lane 1) that migrates indistinguishably from the 0-glycosylated 770DXB polypeptide seen after [35S]methionine labeling (Fig. 2B, lane 1). However, upon return to 37°C, the -85-kDa cell-surface species is metabolized rapidly (til2, 5 min) (Fig. 2C, lanes 2-5), yielding a secreted species of -70 kDa (lanes 6-10). In preliminary studies, it was also demonstrated that APPs that lack the hexapeptide sequence YENPTY, which resembles a clathrin-coated pit targeting signal, are secreted at higher rates than unmodified APPs (unpublished observations). This result is consistent with earlier reports documenting that a fraction of APP is degraded in cultured cells by lysosomal pathways (24, 25). These results strongly suggest that APPs lacking an endocytic signal are retained on the plasma membrane for extended periods, thus increasing the probability of an endoproteolytic event. In concert, these findings reinforce the idea that cleavage at the plasma membrane is the preponderant pathway for generation of soluble APP derivatives in cultured cells. Precursors with Substitutions at Lys-13 Are Cleaved Efficiently. To assess the specificity of the protease(s) involved in APP cleavage, secretion of APP harboring amino acid replacements of the lysine residue positioned at the N-terminal side of the cleavage site (13 amino acids N-terminal to the transmembrane domain) was examined. These substitutions were introduced into plasmid p770A20 (Fig. 3A) (17). COS-1 cells were transfected transiently with wild-type or modified p770A20 templates and metabolically labeled; cleavage efficiency was assayed by the level of secreted molecules that accumulated in the conditioned medium. Most amino acid replacements (i.e., seven of eight) yielded precursors that were still cleaved efficiently (Fig. 3B, lanes 3, 4, and 6-10; compare to levels of secreted -70-kDa wild type in lane 2), and the precise site of cleavage also appeared unchanged (all of the cleaved products comigrated at -70
n %
0
a" .
f
Xi
_r>> "
4 FIG. 2. APP cleavage occurs on the plasma membrane. (A) Structure of wild-type APP-770 and truncated analog 770DXB. Hatched box, APP transmembrane domain. (B) 770DXB is cleaved and secreted. Lanes 1 and 2, [35S]methionine-labeled immunoprecipitates from cell lysate or supernatant, respectively, derived from a stable cell line (C7DXB) that constitutively expresses 770DXB polypeptides. Immunoprecipitation utilized APP-specific polyclonal antibody RGP-3 elicited against a synthetic peptide corresponding to residues 45-62 of APP (a kind gift from George Perry, Case Western Reserve University, Cleveland). Size markers are in kDa. (C) 770DXB is cleaved at the plasma membrane. C7DXB cells were surface radioiodinated at 40C and then placed in prewarmed growth medium. 770DXB-related polypeptides were immunoprecipitated with RGP-3 antiserum from cell pellets (lanes 1-5) or conditioned medium (lanes 6-10) at 0 min (lanes 1 and 6), 5 min (lanes 2 and 7), 10 min (lanes 3 and 8), 20 min (lanes 4 and 9), or 40 min (lanes 5 and 10). Because the pellet and supernatant immunoprecipitates were fractionated on separate gels, an aliquot of the pellet fraction from time 0 is duplicated on the right.
D Dw
-O.-
=12
~-4 -
1
1 2 3
6077
.4f
am ,
.A 04.44
ai
A
..4" 4 .d,.-
l
.:4
A
97*
b
1 2 1 2 Cell - +
0400 I* *68 2 3 4 5 6 7 8 9 10
FIG. 3. Effect of Lys-13 mutations on cleavage efficiency. (A) Structure of p770A& and p770A20. Strategy for construction of these plasmids and for introduction of mutations at the Lys-13 position in p770A20 is described (17) as well as shown here. Hatched box, APP transmembrane domain. (B) Efficient cleavage of 770A20 precursors containing mutations at Lys-13. Shown are total radiolabeled products in conditioned medium from COS-1 cells transfected with p770, encoding full-length APP-770 (lane 1), p77OA20 (lane 2), or modified p770A20 templates encoding amino acid substitutions at Lys-13 (lanes 3-10) after fractionation by SDS/PAGE. Arrow, secreted 770A20-related molecules. Size markers are in kDa. (C) Maturation of Val-13 molecules is similar to wild type. Newly synthesized proteins immunoprecipitated from COS-1 cells transiently transfected with p770A20 (lane 1) or p770A20K/V (lane 2), which encodes valine at position 13, are presented. (D) Mature Val-13 molecules are cell-surface bound. A CHO cell line, 770A20K/V, that constitutively overexpresses 770A20 harboring valine at the cleavage site was labeled with [35S]methionine and incubated in the absence (lane 1) or presence (lane 2) of a membrane-impermeable crosslinker (BS3). APP-related molecules in cell lysates were immunoprecipitated with APP N-terminal antibody RGP-3. Arrowhead, crosslinked cellsurface forms of 770A20K/V.
kDa). For only one mutant, 770A20K/V (corresponding to 770A20 containing a lysine-to-valine substitution), was secretion of APP-related molecules inefficient (Fig. 3B, lane 5). To address whether the failure of 770AK/V molecules to be secreted was the result of inefficient maturation and/or sorting to the plasma membrane, two additional experiments were performed. First, because the abundance of newly synthesized intracellular pools of '110-kDa immature forms and -135-kDa 0-glycosylated forms of the mutant 770A20K/V (Fig. 3C, lane 2) and wild-type 770A20 polypeptides (lane 1) appeared indistinguishable, it is unlikely that low-level secretion of 770A20K/V precursors was a consequence of altered kinetics of intracellular maturation. To establish whether fully glycosylated forms of 770A20K/V molecules appeared on the plasma membrane, a CHO cell line that constitutively expresses 770A20K/V polypeptides was constructed, and cell surface molecules were crosslinked with a membrane impermeable crosslinker (BS3). Because only the mature (-135 kDa) forms of 770A20K/V molecules were selectively crosslinked to cell-surface polypeptides (Fig. 3D, lane 2), this result indicates that these molecules are associated with the plasma membrane. Cleavage Apparently Requires Local a-Helicity. The surprisingly relaxed substrate specificity of the endoproteolytic activity suggested that other structural features of the substrate itself might contribute to cleavage efficiency. In earlier
6078
Medical Sciences: Sisodia
Proc. Natl. Acad. Sci. USA 89 (1992)
studies (17), we documented that APPs analogous to 770A20 described above but that lacked residues positioned between 6 and 11 amino acids N-terminal to the membrane were not cleaved. Interestingly, recent two-dimensional nuclear magnetic resonance studies of synthetic peptides containing this region revealed that these residues lie within an a-helix (26). To test whether this putative helix is required for cleavage, 19 precursors containing single amino acid substitutions within this domain were examined (Fig. 4). These substitutions were introduced into plasmid p770A20 (17). Within this series of mutations, the only two precursors that exhibited significantly diminished cleavage efficiencies were those with amino acid substitutions that interrupted or distorted the predicted a-helix [e.g., a proline substitution in 770A20F/P (Fig. 4C, lane 4) or introduction of a glycine in 770A20V/G (Fig. 4B, lane 2)]. These studies support the idea that local a-helicity contributes to cleavage efficiency, presumably through direct interaction of the endoprotease(s) to this structure. Proteolytic Cleavage Occurs at a Defined Distance from the Transmembrane Helix. A curious feature of the soluble derivatives generated from mutant precursors cleaved at high, low, or moderate efficiencies is their indistinguishable electrophoretic migration (Figs. 3B and 4). The complete absence of soluble derivatives with migration patterns different from those of the wild type strongly suggests that the protease(s) is constrained to cleave substrates at a specified distance from the membrane. If this interpretation is correct, then the migration of secreted APP-related polypeptides derived from plasmids analogous to p770A20 (see above), but that encoded either 24 (p770A24) or 15 (p770A15) amino acids of the APP extracellular domain, should yield larger or smaller cleavage products, respectively. Relative to the a70kDa secreted form of 770A20 (Fig. 5B, lane 2), the secreted forms of 770A24 (lane 1) and 770A15 (lane 3) displayed slightly
Is
A
0t
-
1 2 3
4 5 6
I
3
)
c
TI
a1)
co
D
0
m-
1
c
a)>-LC
a
C
2
>
a-
3 4
5
;
6 7
FIG. 4. Effect of mutations proximal to cleavage site. (A) Cleavage efficiency of precursors with mutations at Leu-12. Total radiolabeled products in conditioned medium from COS-1 cells transiently
transfected with p770A20 (lane 1) or p770A20 templates encoding amino acid substitutions at leucine, 12 residues N-terminal to the transmembrane domain (lanes 2-6), were fractionated by SDS/ PAGE. Polypeptides in the 65- to 75-kDa range are presented. (B) Cleavage efficiency of precursors with mutations at Val-li. Total radiolabeled products in conditioned medium from COS-1 cells transiently transfected with p770A20 (lane 1) or p770A20 templates encoding amino acid substitutions at valine, 11 amino acids N-terminal to the transmembrane domain (lanes 2-9), were fractionated by SDS/PAGE. Polypeptides in the 65- to 75-kDa range are presented. (C) Cleavage efficiency of precursors with mutations at Phe-10. Total radiolabeled products in conditioned medium from COS-1 cells transiently transfected with p770A20 (lane 1) or p770A20 templates encoding amino acid substitutions at Phe-10 (lanes 2-7) were fractionated by SDS/PAGE. Polypeptides in the 65- to 75-kDa range are presented.
A .-
B
'a
L °O <
f8-Amyloid precursor protein cleavage by a membranebound protease SANGRAM S. SISODIA* Department of Pathology and the Neuropathology Laboratory, The Johns Hopkins University School of Medicine, Baltimore, MD 21205
Communicated by M. Daniel Lane, April 6, 1992
ABSTRACT The principal component of amyloid plaques in Alzheimer disease is .3-amyloid protein, an -4-kDa peptide derived from amyloid precursor proteins. Previous studies have established that amyloid precursor proteins are secreted after proteolytic cleavage within the (3-amyloid peptide. The present investigation documents that, in cultured cells, amyloid precursor protein is cleaved on the plasma membrane by a membrane-bound endoprotease and that the specificity of peptide bond hydrolysis is largely independent of the primary sequence of the precursor. The principal determinants of cleavage appear to be an a-helical conformation and the distance (12-13 residues) of the hydrolyzed bond from membrane.
cleavage site are cleaved efficiently. Amid the apparent lack of sequence specificity, the primary determinants for proteolysis appear to be an a-helical conformation and the distance (12-13 amino acids) of the hydrolyzed bond from the membrane. MATERIALS AND METHODS Transfection, Cell Labeling, Immunoprecipitation, and Immunoblotting. Details of these methods have been described (17). Briefly, COS-1 cells were transfected by the CaPO4 coprecipitation technique with supercoiled plasmid DNA. Approximately 40 hr after transfection, cells were metabolically labeled with [35S]methionine for 2.5-4 hr. For analysis of newly synthesized proteins, cells were labeled for 10 min with [35S]methionine and were chased for 20 min in unlabeled methionine. For immunoprecipitation, labeled cells were lysed in buffer containing detergents and protease inhibitors, and solubilized APP-related molecules were immunoprecipitated with APP-specific polyclonal antiserum. Immunoprecipitates or aliquots of conditioned medium were subjected to SDS/PAGE and were visualized after fluorographic enhancement and exposure of x-ray film. Stable Cell Lines. For generation of permanent cell lines, Chinese hamster ovary (CHO) cells were cotransfected with 1 ,Ag of circular plasmid DNA and 0.1 ,ug of pSV2neo (21), which harbors a gene encoding resistance to the neomycin analog G418, by the CaPO4 coprecipitation technique. Exogenous APPs in G418-resistant cell lines were assayed by immunoblot analysis of cell extracts with an APP-specific antibody, 22C11 (14). Plasmid Constructions. p770SP, p7706M, and p77011M. Plasmids p7706M and p77011M were constructed essentially as described for the construction of p770SP (17). Briefly, exonuclease III was used to generate 3' deletions of the APP-770 cDNA that resulted in truncations of C-terminal regions of the encoded polypeptide. Truncated cDNA was fused to a vector fragment encoding substance P to create p7706M and p77011M, which encoded the entire APP-770 extracellular domain and either 6 or 11 residues of the transmembrane helix, respectively. The sequence at the fusion site was verified by double-stranded sequencing of plasmid templates (22). p770DXB. p770 was digested with Xho I and Bgl II, and the ends were filled with Klenow DNA polymerase and deoxynucleotide triphosphates. The large (-5 kilobases) vector fragment was gel isolated and self-ligated to create p770DXB, which encodes an in-frame fusion between residues 380 and 665 of APP-770. Mutagenesis. For generation of mutations at Lys-13, Leu12, Val-11, or Phe-10, plasmid p770 (17) was incubated in
Alzheimer disease is a progressive neurodegenerative disorder that affects a significant percentage of elderly individuals. The classic neuropathological features of Alzheimer disease include senile plaques, composed of neurites and extracellular amyloid deposits, and intracellular neurofibrillary tangles in the hippocampus and cerebral cortex (1-4). The principal component of plaques is the ,3-amyloid protein (AP3) (5, 6), an -4-kDa peptide derived from larger amyloid precursor proteins (APPs) (7, 8). APPs are integral membrane glycoproteins of 695, 714, 751, and 770 amino acids (8-11); the two larger isoforms contain a domain homologous to the Kunitz family of protease inhibitors (12, 13). The 39- to 43-residue AP peptide is composed of 28 residues of the extracellular domain and 11-15 residues of the adjacent transmembrane domain of APP. Biochemical studies in cultured cells reveal that APPs mature rapidly through a constitutive secretory pathway and acquire N- and O-linked carbohydrates and tyrosine sulfate and phosphate during transit (14, 15). In addition, C-terminally truncated APP derivatives are secreted into the conditioned medium (14). The presence of C-terminally truncated APPs in the cerebrospinal fluid indicates that similar pathways may be used in vivo (14, 16). In previous efforts, we used molecular biological approaches to demonstrate that APPs were cleaved within the AP domain (17). Biochemical analysis of termini of membrane-retained and secreted molecules revealed that, in cultured mammalian cells, APP is cleaved between residues 16 (lysine) and 17 (leucine) of the AP3 sequence (18-20). In concert, these studies indicated that AP3 cannot be generated as an intact fragment as a result of this proteolytic event but, rather, is derived by an alternative processing pathway(s) of APP. In the present analysis, the cellular site(s) of APP cleavage and the structural specificities of the protease that liberate soluble APP derivatives are examined. This study documents that APP is a substrate when bound to the external side of the plasma membrane. The proteolytic activity exhibits a relaxed sequence specificity; membrane-bound precursors harboring widely differing primary sequences at or neighboring the
Abbreviations: A8, ,B-amyloid protein; APP, amyloid precursor protein. *To whom reprint requests should be addressed at: Neuropathology Laboratory, The Johns Hopkins University School of Medicine, 558 Ross Research Building, 720 Rutland Avenue, Baltimore, MD 21205-2196.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact. 6075
6076
PCR with "antisense" primer as2, CCGCTCGAGCTGTTTCTTCTTCAGCATC, complementary to the sequence encoding four residues of the APP cytoplasmic domain and adjacent transmembrane regions, and either of the following oligonucleotides: s30, CCGCTCGAGGGATATGAAGTTCATCATCAAVVVTTGGTGTTCT (V = A, G, or C), which encodes APP-770 residues 679-690 and is multiply degenerate at codon 687 (Lys-13); s32, CCGCTCGAGGGATATGAAGTTCATCATCAAAAAVVVGTGTTCTTTGC, which encodes APP-770 residues 679-692 and is multiply degenerate at codon 688 (Leu-12); s32, CCGCTCGAGGGATATGAAGTTCATCATCAAAAATTGVVVTTCTTTGCAGAAGATG, which encodes APP-770 residues 679694 and is multiply degenerate at codon 689 (Val-li); or s33,
CCGCTCGAGGGATATGAAGTTCATCATCAAAAATTGGTGVVVTTTGCAGAAGATG, which encodes APP770 residues 679-694 and is multiply degenerate at codon 690 (Phe-10), respectively. For synthesis of p770A15 and p770A15+i, plasmid p770 and antisense primer as2 (see above) were incubated in a PCR with either s34, CCGCTCGAGCATCAAAAATTGGTGTTCTTTGCAG, which encodes APP-770 residues 685-692; or s35, CCGCTCGAGCATCATCAAAAATTGGTGTTCTTTGTTACCAACGCAGAAGATG, which encodes APP-770 residues 685-695 and includes an insertion, Val-Thr-Asp. PCR products were digested with Xho I, purified by PAGE, and ligated to Xho I-digested and alkaline phosphatase-treated plasmid p770A (17). The sequence of inserted fragments was verified by double-stranded sequencing of plasmid templates (22). Surface Labeling. For surface-labeling studies, a stable CHO cell line, C7DXB, which overexpresses 770DXB polypeptides, was analyzed. Approximately 5 x 106 C7DXB cells in suspension culture were washed and surface labeled (4°C) in Hanks' balanced salt solution (HBSS) containing 1 mCi of 125I (1 Ci = 37 GBq) and Iodo-Gen reagent (Pierce). Cells were then washed with cold HBSS and placed in suspension medium prewarmed to 37°C. Aliquots of =106 cells were removed immediately or at various times thereafter, and APP-related polypeptides in cell lysates and medium at each time point were immunoprecipitated with APP-speciflic rabbit polyclonal antibody RGP-3. RGP-3 was elicited against a synthetic peptide corresponding to APP residues 45-62. For cell-surface crosslinking studies, monolayer cells were labeled with [35S]methionine, washed in cold phosphatebuffered saline (PBS), and subsequently incubated at 4°C in BS3 (Pierce), a membrane-impermeable crosslinking agent, prepared in PBS at 0.5 mg/ml. Cells were washed and then lysed, and APP-related polypeptides were immunoprecipitated and analyzed as described above.
RESULTS Membrane Association of APP Is Required for Cleavage. To
address whether association with the plasma membrane is obligatory for APP cleavage, the fate of APP-770-related polypeptides containing deletions of the entire cytoplasmic region and segments of the transmembrane domain was analyzed. COS-1 cells were transfected with genes encoding APP-770 in which the last 56 (p77011M) or 61 (p7706M) amino acids of APP (including 13 or 18 amino acids of the transmembrane domain, respectively) and the entire cytoplasmic domain were replaced with a 16-amino acid epitope tag that contains the C terminus of neuropeptide substance P (23) (Fig. 1A). Hybrid 77011M and 7706M molecules were expected to mature through the secretory pathway as soluble (nonmembrane associated) polypeptides because the residual transmembrane sequences from APP-770 are too short to span the lipid bilayer and to serve as a membrane anchor. After biosynthetic labeling, both 7706M and 77011M polypeptides migrated at -105 kDa, a position appropriate for the
fi~ 97
Proc. Natl. Acad. Sci. USA 89 (1992)
Medical Sciences: Sisodia
A
-,
m
-200
^C 20B) ;; -20:)
_
-
-
*
1
2 -68 1 2 3 4 Ab SP APP SP
ism 1
Cetl
2
_ 3
4
Trans Sup
Stable Sup
5
Sup
FIG. 1. Membrane association is obligatory for cleavage. (A) Structure of hybrid APP-770-substance P polypeptides. Position of Lys-687, immediately N-terminal to the cleavage site, is shown. APP-770 residues 1-684 (stippled box); APP transmembrane region (hatched box); APP cytoplasmic region (open box); and substance P sequences (solid box) are shown. (B) Analysis of hybrid 77011M and 7706M polypeptides in transfected COS-1 cells. Lanes: 1 and 2, [35S]methionine-labeled immunoprecipitates from cell lysates transfected with p77011M and p7706M plasmids, respectively; 3-5, total radiolabeled conditioned medium from untransfected cells or from cells transfected with p77011M and p7706M, respectively. Arrowheads, secreted 77011M- and 7706M-related molecules. Size markers are in kDa. (C) Secreted 77011M- and 7706M-related molecules retain substance P epitope. Conditioned medium from COS-1 cells transfected with p77011M (lane 1) or p7706M (lane 2) was concentrated and then immunoblotted with substance P-specific monoclonal antibody NCI 34. SP, substance P antibody. (D) 7706M is not cleaved before secretion in stably transfected CHO cells. Conditioned medium from CHO cells stably transfected with p770SP (lanes 1 and 3) or p7706M (lanes 2 and 4) was immunoblotted with APP-specific monoclonal antibody 22C11 (lanes 1 and 2) or with substance P-specific antibody NCI 34 (lanes 3 and 4).
N-glycosylated precursor, and larger species of 115-135 kDa (Fig. 1B, lanes 1 and 2). As expected, the conditioned medium contained 77011M- and 7706M-related molecules of =135 kDa (lanes 4 and 5). Immunoblot analysis of conditioned medium with a monoclonal antibody that recognizes an epitope at the C terminus of substance P revealed retention of substance P epitopes in secreted forms of 7706M and 77011M and proved that these polypeptides are not cleaved (Fig. 1C, lanes 1 and 2). A parallel analysis of conditioned medium from CHO cells stably transfected with p7706M also revealed that secreted 7706M molecules are full length (Fig. 1D, lane 4), whereas membrane-anchored substrates-i.e., 770SP (Fig. 1A)-in which the C-terminal 17 amino acids of APP are replaced with substance P sequences are cleaved efficiently (Fig. 1D, lane 3). These studies strongly suggest that APPs are cleaved only as a membrane-bound substrate by one or more membrane-associated proteases. APP Is Cleaved on the Plasma Membrane. Earlier studies in cultured cells documented the presence of full-length APP on the plasma membrane (14). Accordingly, the fate of APP molecules still bound to the plasma membrane was addressed. For this analysis, CHO cells were stably transfected with p770DXB, a plasmid that encodes APP-770 deleted of 285 residues of the extracellular domain but retains the entire cytoplasmic and transmembrane regions and adjacent 35 amino acids of the extracellular domain (Fig. 2A). One resultant cell line, C7DXB, was labeled metabolically with [35S]methionine, and APP-related molecules were immunoprecipitated from cells and conditioned medium. As expected, 770DXB appeared first as an -55-kDa precursor, matured to an -85-kDa O-glycosylated species (Fig. 2B, lane 1), and was secreted as a truncated =70-kDa molecule (lane 2). Subsequently, C7DXB cells were surface labeled with 1251
Proc. Natl. Acad. Sci. USA 89 (1992)
Medical Sciences: Sisodia
A
N
770
I
F
=,.
I
C
VIA x
-7 -0I
7772CsP
770A20
770DXB
BCIKW
A
I
C
0 5 102040
00
''
:%
:..
ei
'
B-
-a >, o
o
I, P-
>
..J
~--
mC m
--S ~~~
%.,
a
-
U
a,
>
.68
S
K
51020401min1
.97.
2
I- Cell
4 5
1 6 7 8 9 10 -s Sup't -'-1
_n
t
0 - - --w a
1
f t-i
.-A ~
mmm___o
4-'
04%4"M-
__ " g 0 _
at 40C, a temperature at which endocytosis is inhibited. This reaction resulted in labeling of an =85-kDa 770DXB polypeptide (Fig. 2C, lane 1) that migrates indistinguishably from the 0-glycosylated 770DXB polypeptide seen after [35S]methionine labeling (Fig. 2B, lane 1). However, upon return to 37°C, the -85-kDa cell-surface species is metabolized rapidly (til2, 5 min) (Fig. 2C, lanes 2-5), yielding a secreted species of -70 kDa (lanes 6-10). In preliminary studies, it was also demonstrated that APPs that lack the hexapeptide sequence YENPTY, which resembles a clathrin-coated pit targeting signal, are secreted at higher rates than unmodified APPs (unpublished observations). This result is consistent with earlier reports documenting that a fraction of APP is degraded in cultured cells by lysosomal pathways (24, 25). These results strongly suggest that APPs lacking an endocytic signal are retained on the plasma membrane for extended periods, thus increasing the probability of an endoproteolytic event. In concert, these findings reinforce the idea that cleavage at the plasma membrane is the preponderant pathway for generation of soluble APP derivatives in cultured cells. Precursors with Substitutions at Lys-13 Are Cleaved Efficiently. To assess the specificity of the protease(s) involved in APP cleavage, secretion of APP harboring amino acid replacements of the lysine residue positioned at the N-terminal side of the cleavage site (13 amino acids N-terminal to the transmembrane domain) was examined. These substitutions were introduced into plasmid p770A20 (Fig. 3A) (17). COS-1 cells were transfected transiently with wild-type or modified p770A20 templates and metabolically labeled; cleavage efficiency was assayed by the level of secreted molecules that accumulated in the conditioned medium. Most amino acid replacements (i.e., seven of eight) yielded precursors that were still cleaved efficiently (Fig. 3B, lanes 3, 4, and 6-10; compare to levels of secreted -70-kDa wild type in lane 2), and the precise site of cleavage also appeared unchanged (all of the cleaved products comigrated at -70
n %
0
a" .
f
Xi
_r>> "
4 FIG. 2. APP cleavage occurs on the plasma membrane. (A) Structure of wild-type APP-770 and truncated analog 770DXB. Hatched box, APP transmembrane domain. (B) 770DXB is cleaved and secreted. Lanes 1 and 2, [35S]methionine-labeled immunoprecipitates from cell lysate or supernatant, respectively, derived from a stable cell line (C7DXB) that constitutively expresses 770DXB polypeptides. Immunoprecipitation utilized APP-specific polyclonal antibody RGP-3 elicited against a synthetic peptide corresponding to residues 45-62 of APP (a kind gift from George Perry, Case Western Reserve University, Cleveland). Size markers are in kDa. (C) 770DXB is cleaved at the plasma membrane. C7DXB cells were surface radioiodinated at 40C and then placed in prewarmed growth medium. 770DXB-related polypeptides were immunoprecipitated with RGP-3 antiserum from cell pellets (lanes 1-5) or conditioned medium (lanes 6-10) at 0 min (lanes 1 and 6), 5 min (lanes 2 and 7), 10 min (lanes 3 and 8), 20 min (lanes 4 and 9), or 40 min (lanes 5 and 10). Because the pellet and supernatant immunoprecipitates were fractionated on separate gels, an aliquot of the pellet fraction from time 0 is duplicated on the right.
D Dw
-O.-
=12
~-4 -
1
1 2 3
6077
.4f
am ,
.A 04.44
ai
A
..4" 4 .d,.-
l
.:4
A
97*
b
1 2 1 2 Cell - +
0400 I* *68 2 3 4 5 6 7 8 9 10
FIG. 3. Effect of Lys-13 mutations on cleavage efficiency. (A) Structure of p770A& and p770A20. Strategy for construction of these plasmids and for introduction of mutations at the Lys-13 position in p770A20 is described (17) as well as shown here. Hatched box, APP transmembrane domain. (B) Efficient cleavage of 770A20 precursors containing mutations at Lys-13. Shown are total radiolabeled products in conditioned medium from COS-1 cells transfected with p770, encoding full-length APP-770 (lane 1), p77OA20 (lane 2), or modified p770A20 templates encoding amino acid substitutions at Lys-13 (lanes 3-10) after fractionation by SDS/PAGE. Arrow, secreted 770A20-related molecules. Size markers are in kDa. (C) Maturation of Val-13 molecules is similar to wild type. Newly synthesized proteins immunoprecipitated from COS-1 cells transiently transfected with p770A20 (lane 1) or p770A20K/V (lane 2), which encodes valine at position 13, are presented. (D) Mature Val-13 molecules are cell-surface bound. A CHO cell line, 770A20K/V, that constitutively overexpresses 770A20 harboring valine at the cleavage site was labeled with [35S]methionine and incubated in the absence (lane 1) or presence (lane 2) of a membrane-impermeable crosslinker (BS3). APP-related molecules in cell lysates were immunoprecipitated with APP N-terminal antibody RGP-3. Arrowhead, crosslinked cellsurface forms of 770A20K/V.
kDa). For only one mutant, 770A20K/V (corresponding to 770A20 containing a lysine-to-valine substitution), was secretion of APP-related molecules inefficient (Fig. 3B, lane 5). To address whether the failure of 770AK/V molecules to be secreted was the result of inefficient maturation and/or sorting to the plasma membrane, two additional experiments were performed. First, because the abundance of newly synthesized intracellular pools of '110-kDa immature forms and -135-kDa 0-glycosylated forms of the mutant 770A20K/V (Fig. 3C, lane 2) and wild-type 770A20 polypeptides (lane 1) appeared indistinguishable, it is unlikely that low-level secretion of 770A20K/V precursors was a consequence of altered kinetics of intracellular maturation. To establish whether fully glycosylated forms of 770A20K/V molecules appeared on the plasma membrane, a CHO cell line that constitutively expresses 770A20K/V polypeptides was constructed, and cell surface molecules were crosslinked with a membrane impermeable crosslinker (BS3). Because only the mature (-135 kDa) forms of 770A20K/V molecules were selectively crosslinked to cell-surface polypeptides (Fig. 3D, lane 2), this result indicates that these molecules are associated with the plasma membrane. Cleavage Apparently Requires Local a-Helicity. The surprisingly relaxed substrate specificity of the endoproteolytic activity suggested that other structural features of the substrate itself might contribute to cleavage efficiency. In earlier
6078
Medical Sciences: Sisodia
Proc. Natl. Acad. Sci. USA 89 (1992)
studies (17), we documented that APPs analogous to 770A20 described above but that lacked residues positioned between 6 and 11 amino acids N-terminal to the membrane were not cleaved. Interestingly, recent two-dimensional nuclear magnetic resonance studies of synthetic peptides containing this region revealed that these residues lie within an a-helix (26). To test whether this putative helix is required for cleavage, 19 precursors containing single amino acid substitutions within this domain were examined (Fig. 4). These substitutions were introduced into plasmid p770A20 (17). Within this series of mutations, the only two precursors that exhibited significantly diminished cleavage efficiencies were those with amino acid substitutions that interrupted or distorted the predicted a-helix [e.g., a proline substitution in 770A20F/P (Fig. 4C, lane 4) or introduction of a glycine in 770A20V/G (Fig. 4B, lane 2)]. These studies support the idea that local a-helicity contributes to cleavage efficiency, presumably through direct interaction of the endoprotease(s) to this structure. Proteolytic Cleavage Occurs at a Defined Distance from the Transmembrane Helix. A curious feature of the soluble derivatives generated from mutant precursors cleaved at high, low, or moderate efficiencies is their indistinguishable electrophoretic migration (Figs. 3B and 4). The complete absence of soluble derivatives with migration patterns different from those of the wild type strongly suggests that the protease(s) is constrained to cleave substrates at a specified distance from the membrane. If this interpretation is correct, then the migration of secreted APP-related polypeptides derived from plasmids analogous to p770A20 (see above), but that encoded either 24 (p770A24) or 15 (p770A15) amino acids of the APP extracellular domain, should yield larger or smaller cleavage products, respectively. Relative to the a70kDa secreted form of 770A20 (Fig. 5B, lane 2), the secreted forms of 770A24 (lane 1) and 770A15 (lane 3) displayed slightly
Is
A
0t
-
1 2 3
4 5 6
I
3
)
c
TI
a1)
co
D
0
m-
1
c
a)>-LC
a
C
2
>
a-
3 4
5
;
6 7
FIG. 4. Effect of mutations proximal to cleavage site. (A) Cleavage efficiency of precursors with mutations at Leu-12. Total radiolabeled products in conditioned medium from COS-1 cells transiently
transfected with p770A20 (lane 1) or p770A20 templates encoding amino acid substitutions at leucine, 12 residues N-terminal to the transmembrane domain (lanes 2-6), were fractionated by SDS/ PAGE. Polypeptides in the 65- to 75-kDa range are presented. (B) Cleavage efficiency of precursors with mutations at Val-li. Total radiolabeled products in conditioned medium from COS-1 cells transiently transfected with p770A20 (lane 1) or p770A20 templates encoding amino acid substitutions at valine, 11 amino acids N-terminal to the transmembrane domain (lanes 2-9), were fractionated by SDS/PAGE. Polypeptides in the 65- to 75-kDa range are presented. (C) Cleavage efficiency of precursors with mutations at Phe-10. Total radiolabeled products in conditioned medium from COS-1 cells transiently transfected with p770A20 (lane 1) or p770A20 templates encoding amino acid substitutions at Phe-10 (lanes 2-7) were fractionated by SDS/PAGE. Polypeptides in the 65- to 75-kDa range are presented.
A .-
B
'a
L °O <
