Article pubs.acs.org/JAFC
Biochemical and Functional Characterization of Transiently Expressed in Neural Precursor (TENP) Protein in Emu Egg White Kenji Maehashi,*,† Megumi Ueda,† Mami Matano,† Junko Takeuchi,‡ Masataka Uchino,# Yutaka Kashiwagi,† and Toshihiro Watanabe‡ †
Department of Fermentation Science, Faculty of Applied Bio-Science, Tokyo University of Agriculture, 1-1-1 Sakuragaoka, Setagaya-ku, Tokyo 156-8502, Japan ‡ Department of Food and Cosmetic Science, Faculty of Bio-Industry, Tokyo University of Agriculture, 196 Yasaka, Abashiri, Hokkaido 099-2493, Japan # Department of Applied Biology and Chemistry, Faculty of Applied Bio-Science, Tokyo University of Agriculture, 1-1-1 Sakuragaoka, Setagaya-ku, Tokyo 156-8502, Japan ABSTRACT: A protein transiently expressed in the neural precursors of developing tissues (TENP) was found to be present in emu (Dromaius novaehollandiae) egg white as one of the major proteins. Nucleotide analysis of its encoding cDNA revealed a sequence of 452 amino acids including a 19 amino acid peptide signal. Phylogenetic analysis determined that emu TENP was clustered within the bactericidal/permeability-increasing protein (BPI) superfamily together with other avian TENPs. RT-PCR analysis revealed that the emu TENP gene was highly expressed in the magnum of the oviduct, indicating that TENP is a major egg white component. Emu TENP was purified by anion exchange chromatography and ammonium sulfate fractionation. Unlike BPI, emu TENP exhibited antibacterial activity against Gram-positive bacteria, including Micrococcus luteus and Bacillus subtilis, but not against Gram-negative bacteria such as Escherichia coli and Salmonella Typhimurium. The results suggest that emu TENP is a potent novel antibacterial protein with a spectrum distinct from that of BPI. KEYWORDS: emu, egg white, TENP, antibacterial activity, BPI
■
developmental transition during neurogenesis.7 Recent studies based on proteomic6 and transcriptomic8 analyses revealed that TENP is a major component of the egg; hence, we sought to test the hypothesis that TENP may exert antimicrobial activity. To the best of our knowledge, there are no reports of the functional characteristics of TENP. A recent paper suggests that the relatively higher thermostability of TENP might explain the unique properties of emu egg white in processed food production.9 In this study, we provide evidence that TENP is present in emu egg white, and we tested its antibacterial activity as a prediction of its function in emu egg white.
INTRODUCTION The emu (Dromaius novaehollandiae) is a bird native to Australia and is the second largest member of the ratite family, which also includes the ostrich, the rhea, and the cassowary. Emus have come to be considered as an alternative form of livestock, and their production has seen an increase in many regions worldwide, including Japan. Emus produce eggs that are 10 times larger than chicken eggs. It was also reported that, during heat-induced coagulation, the albumen and yolk of the emu egg has a softer texture compared to that of the hen egg.1 Thus, emu eggs are of interest as an alternative egg product. However, only a very few studies have investigated the biochemical properties of emu egg white, as opposed to chicken egg white, which has been extensively characterized with regard to its antimicrobial properties,2 its allergenicity,3 etc. We previously reported considerable differences in the composition of major proteins between emu and chicken egg white, including the observation that ovotransferrin was the dominant protein, whereas lysozyme was hardly detected in emu egg white,4,5 in contrast to ovalbumin being the dominant protein in chicken egg white, followed by ovotransferrin, ovomucoid, and lysozyme.4 A remarkable feature of emu egg white is that transiently expressed in neural precursor (TENP) protein represents one of its major proteins, estimated at 16% of the total protein content in emu egg white,4 whereas it accounts for only 0.1−0.5% of chicken egg white total protein content.6 TENP was first reported as a protein transiently expressed in neural precursors of developing tissues, such as the brain and retina, and was believed to be involved in the © 2014 American Chemical Society
■
MATERIALS AND METHODS
Materials. Eggs and tissues of egg-laying female emus (D. novaehollandiae) were obtained from Tokyo Nodai Bio-Industry (Abashiri, Hokkaido, Japan). Eggs of White Leghorn chickens were obtained from a local market. The egg white was collected from eggs and homogenized in a blender. The magnum of the oviduct and the ovary were dissected out immediately after butchering, and smaller than 5 mm3 pieces of tissues were excised and stored in RNAlater (Ambion, Inc., Austin, TX, USA) until use. Purification of TENP from Egg White. The homogenized emu egg white was diluted 10-fold with deionized water and adjusted to pH 6.0 by 1 N HCl. After overnight stirring at 4 °C, the mixture was Received: Revised: Accepted: Published: 5156
February 17, 2014 May 11, 2014 May 12, 2014 May 12, 2014 dx.doi.org/10.1021/jf5008117 | J. Agric. Food Chem. 2014, 62, 5156−5162
Journal of Agricultural and Food Chemistry
Article
centrifuged to remove insoluble substances and was adjusted to pH 8.0 by 1 M Tris-HCl (pH 8.0) and 1 N HCl. The solution was then run through a DEAE-Sepharose FF column (buffered with 20 mM TrisHCl buffer, pH 8.0, ⌀ 2.6 × 30 cm) and eluted with the same buffer followed by 0.14 M NaCl in the same buffer and a linear NaCl concentration gradient of 0.14−0.5 M, again in the same buffer. The eluted fraction was subjected to 55% saturated ammonium sulfate fractionation. The precipitate fraction was separated from the supernatant fraction, desalted by dialysis against deionized water, and lyophilized to obtain purified emu TENP. Deglycosylation of TENP. Specific cleavage of N-glycan moieties (N-acetylglucosamine−asparagine bonds) present in TENP was carried out using glycopeptidase F (Takara-Bio Inc., Otsu, Japan). After denaturation by boiling for 3 min in buffer containing 0.5% SDS and 0.75% β-mercaptoethanol, the sample was subjected to digestion with glycopeptidase F at 37 °C overnight. SDS-PAGE. SDS-PAGE was performed using 12.5 or 15% polyacrylamide gel according to the method of Laemmli.10 The sample solution was mixed with an equal volume of loading buffer prior to heat treatment. The resulting sample was run on a SDS-PAGE gel. After electrophoresis, the gels were stained with 0.025% Coomassie Brilliant Blue R-250 (CBB) in an aqueous solution of 50% methanol and 10% acetic acid. The stained gels were washed using an aqueous solution of 25% methanol and 10% acetic acid, followed by water. cDNA Cloning of Emu TENP. Total RNA was extracted from emu tissues using the TRI Reagent (Molecular Research Center, Inc., Cincinnati, OH, USA), and first-strand cDNA was synthesized using SuperScript III First-Strand Synthesis SuperMix and oligo-dT (20) primer (Invitrogen Co., Carlsbad, CA, USA). The first-strand cDNA was used for subsequent PCR amplifications of emu TENP cDNA with Ex Taq DNA polymerase (Takara Bio Inc., Shiga, Japan). For the cloning of emu TENP cDNA, primers were designed on the basis of the nucleotide sequence of chicken TENP (GenBank ID NM_205026). Sequences of the primers are listed in Table 1.
used for RT-PCR analysis. Sequences of the primers are listed in Table 1. PCR amplification was performed with Ex Taq DNA polymerase (Takara Bio) at 94 °C for 30 s followed by 35 cycles at 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 45 s. To calibrate the cDNA concentration between samples, the β-actin gene was amplified as a housekeeping gene using a primer set of bact-13F/bact-14R, as determined by the same program. Amplicon sizes were confirmed by agarose gel electrophoresis with ethidium bromide staining. Phylogenetic Tree Analysis. The amino acid sequences of TENP and other BPI superfamily proteins were obtained from the NCBI GenBank database as indicated in Figure 3. The ClustalW 1.81 multiple sequence alignment program was used for the alignments of protein sequences of various BPI superfamily proteins and emu ovotransferrin (DDBJ ID AB455549), determination of amino acid substitution, and construction of the neighbor-joining phylogenetic tree. Bootstrap analysis was replicated 1000 times to evaluate the phylogenetic tree topology.11 Antibacterial Assay. Escherichia coli TOP10, Salmonella Typhimurium TA1535/pSK1002, Micrococcus luteus NRIC1094, and Bacillus subtilis NRIC1016 were used for antibacterial assay. The antibacterial activity of TENP was measured using the method described by Wellman-Labadie et al.12 with some modifications. Overnight bacterial cultures were grown to the log phase in nutrient broth (for all bacteria except E. coli) or in LB broth (for E. coli), then centrifuged, washed, and resuspended in 10 mM sodium phosphate buffer (pH 7.4). TENP dissolved in the same buffer or in homogenized egg white samples was added to an equal volume of bacterial suspension diluted to 0.02 at OD675 nm to give 5−200 μM final TENP concentration and then incubated for 1 h at 37 °C. After incubation, a serial dilution of the sample was plated onto nutrient agar or LB agar and incubated at 37 °C until distinct colonies could be counted (18−36 h). All assays were performed in triplicate, and the antibacterial activity was represented as the percentage of reduced bacterial cell (colony) number compared with controls consisting of microbes incubated alone.
■
RESULTS AND DISCUSSION Primary Structure of TENP. In a previous study, we detected and identified TENP by amino acid sequencing of its N-terminus and found that TENP was one of the major proteins in emu egg white.2 Here we designed a gene-specific primer set for emu TENP based on the sequence of chicken TENP and successfully cloned and sequenced the 1356 bp sequence of TENP precursor cDNA, containing an ORF encoding for a 46 kDa mature protein (Figure 1). A signal peptide cleavage site of emu TENP (indicated in Figure 1) was previously identified by N-terminal amino acid sequencing of the purified protein.4 The results were in accordance with the prediction obtained from the SignalP program using the emu TENP precursor sequence. They were also in agreement with that of the chicken TENP (HG007958) proposed by Whenham et al.,8 but different from that published by Yan and Wang7 (AF029841), as shown in Figure 2. Our results indicate that the emu TENP sequence is 6 amino acids longer than that of chicken TENP (HG007958) at the C-terminus and has 1 amino acid insertion at position 123 (Figure 2). The predicted N-glycosylation site and the number of cysteine residues were conserved features of both TENPs of emu and chicken. A consensus proline-rich region was found in the midsection (amino acid position 209−220 in emu) of both sequences. It was previously reported that human BPI consists of two domains of similar size that are connected by a prolinerich linker of 21 residues including 6 prolines.13 Upon phylogenetic analysis of the inferred amino acid sequence, results showed that emu TENP belongs to the BPI/LBP/ PLUNC superfamily together with other avian TENPs but distinct from other BPI-related proteins14 such as BPI-like 1
Table 1. Primers Used in This Study name
sequence (5′ → 3′)
use
TENP-7F TENP-5R TENP-8F TENP-16R TENP-10F TENP-12R TENP-15F bact-13F bact-14R
CCTGGCTTTGTCCGAGCA CCCACATTGGAGGCAGCCA CTACTACACCAGCCTCTTCCTC GTTACAATCCATCCTCCTTC ACAGCAAACAGAAAAGGCAG GACGGTGAGGAAGAGCTTCA CGGACAAGGAGATTGATGTCG GTGACCTGACAGACTACCT CAGGAAGGATGGCTGGAAGAG
cloning cloning cloning cloning cloning RT-PCR RT-PCR RT-PCR RT-PCR
At first, emu TENP cDNA fragment was amplified from magnum cDNA using the primers TENP-7F and TENP-5R. Next, the primers TENP-8F based on the emu TENP cDNA fragment and TENP-16 based on the chicken TENP were used for amplification of the fragment containing a start codon of emu TENP cDNA. Also, the reverse primer TENP-12R based on the emu TENP cDNA fragment and the forward primer TENP-10F based on the sequence of chicken TENP cDNA were used for amplification of the fragment containing a stop codon of emu TENP cDNA. All amplified fragments were cloned into pCR2.1-TOPO (Invitrogen) and sequenced. DNA Sequencing. Nucleotide sequences of cloned DNAs in pCR2.1-TOPO were analyzed by Macrogen Japan Co. (Tokyo, Japan). T7 promoter primer and M13 reverse primer (Invitrogen) were used as sequencing primers. The resultant nucleotide sequence data were assembled using the ATGC program (Genetyx Corp., Tokyo, Japan) and analyzed by using the NCBI nucleotide BLAST program. Reverse Transcription Polymerase Chain Reaction (RT-PCR). For tissue expression profiling of emu TENP mRNA, the primer set composed of TENP-15F/TENP-12R and emu magnum cDNA were 5157
dx.doi.org/10.1021/jf5008117 | J. Agric. Food Chem. 2014, 62, 5156−5162
Journal of Agricultural and Food Chemistry
Article
Figure 1. Nucleotide and deduced amino acid sequences of emu TENP. Signal peptide sequence is indicated by a bold underline. The amino acids determined by direct sequencing in a previous paper2 are indicated by a dashed line. A signal cleavage site is indicated by an inverted triangle. This sequence will appear in the DDBJ database under the accession number AB556937. Arrows indicate locations of the primers for RT-PCR.
orthologous to mammalian BPIL1s, as previously suggested by Gautron et al.14 Gene Expression of TENP in Emu Tissues. The chicken egg is formed in the reproductive system composed of the ovary and the oviduct, and the egg white is produced in the magnum, a specific region of the oviduct.21 To confirm whether TENP mRNA is expressed in the magnum, RT-PCR analysis of the magnum and the ovary of female egg-laying emus was performed. As expected, the TENP gene was highly amplified from the emu magnum, but was hardly detected in the ovary, as shown in Figure 4. Yan and Wang7 reported the transient expression of chicken TENP gene in embryonic retina and brain tissues during the early developmental stages. Recently, a strong expression of the TENP gene was reported in the chicken magnum.22 Whenham et al.8 revealed that the expression of TENP gene is largely confined to the magnum of the oviduct of adult chicken and is controlled by gonadal steroids as a typically egg-specific gene. It is predicted that the emu TENP gene is also specifically expressed in the magnum of
(BPIL1) and ovocalyxin-36 (OCX-36) (Figure 3). OCX-36 is an eggshell protein that is secreted during shell formation and found in the basal shell and associated membranes15 and also eggshell cuticle.16 Upon BLAST search for emu TENP, chicken TENP sequence was found to be identical to the protein previously known as chicken ovoglobulin G2 (sequence ID AB219158). Ovoglobulin G2 has three different polymorphic forms, AA, AB, and BB, with the majority being of the BB type.17 Although ovoglobulin G2 is well documented for its presence in chicken egg white,18 its biological function in egg white remains unknown. On the basis of amino acid sequence similarity with BPI and in relation to its bactericidal domain, chicken TENP was predicted to exert bactericidal activity similar to that of BPI protein. It is well established that BPI is an essential component of the innate immune system repertoire against Gram-negative bacterial infections.19 Antibacterial activity and LPS-binding capacity of chicken OCX-36 were recently reported.20 The phylogeny represented in Figure 3 suggests that avian TENPs, including emu TENP, are 5158
dx.doi.org/10.1021/jf5008117 | J. Agric. Food Chem. 2014, 62, 5156−5162
Journal of Agricultural and Food Chemistry
Article
Figure 2. Alignment of amino acid sequences of emu and chicken TENPs [GenBank ID HG007958 (ChicHG) and AF029841 (ChicAF)]. Consensus sequences are highlighted in gray. Consensus cysteine residues are highlighted in black, whereas proline-rich regions are indicated by a dark gray background. The asterisk indicates a potential N-glycosylation site.
Figure 4. RT-PCR analysis of expression of TENP gene in emu magnum and ovary. Figure 3. Phylogenetic analysis of TENPs and BPI/LBP/PLUNCrelated proteins based on amino acid sequences. The accession numbers of the proteins used in this analysis are indicated. Numbers at the nodes represent bootstrap proportions (%) from 1000 replicates.
further understand the abundance of TENP in the emu egg white in relation to its gene expression profiles. Purification and Identification of TENP from Emu Egg White. Emu egg white preparation was separated into three peaks on DEAE-Sepharose FF column with NaCl elution. As determined by SDS-PAGE analysis, peaks P1 and P2 contained mainly an 80 kDa protein and a 100 kDa protein, respectively (Figure 5B). These peaks were further characterized by
laying emus, as is the case in chickens. It would thus be of great interest to investigate the tissue distribution and regulation of TENP gene expression in each region of the emu oviduct including the magnum, the white isthmus, and the uterus, to 5159
dx.doi.org/10.1021/jf5008117 | J. Agric. Food Chem. 2014, 62, 5156−5162
Journal of Agricultural and Food Chemistry
Article
Figure 6. (A) Antibacterial activity of emu and chicken egg whites (EW) versus emu TENP. (B) Antibacterial activity of emu TENP against M. luteus and B. subtilis. M. luteus, Micrococcus luteus NRIC1094; B. subtilis, Bacillus subtilis NRIC1016; E. coli, Escherichia coli TOP10; S. Typhimurium, Salmonella Typhimurium TA1535/ pSK1002. The results are represented as the average values obtained from three independent experiments. (∗) p < 0.05; (∗∗)p < 0.01.
Figure 5. (A) Separation of emu egg white on DEAE-Sepharose column. (B) SDS-PAGE of DEAE peaks. (C) SDS-PAGE of deglycosylated samples from ammonium sulfate fractions (sup, supernatant; ppt, precipitate) of P3. Deglycosylation was carried out using glycopeptidase F.
separation (data not shown) and identified as ovotransferrin and ovalbumin, respectively, as previously described in our studies.4 P3 contained mainly a 50 kDa protein, which was further separated by a 55% saturated ammonium sulfate fractionation. Resultant supernatant (sup) and precipitate (ppt) fractions both showed a single band on SDS-PAGE, as indicated in Figure 5C. However, after deglycosylation the sup fraction revealed another protein of 30 kDa. We reported in our previous study that emu egg albumen contained a riboflavinbinding protein of 50 kDa, which showed a 30 kDa band after deglycosylation.23 A 50 kDa protein, reduced in size after deglycosylation, of the ppt fraction was identified as TENP by protein sequencing and we thereby concluded that emu TENP is an N-glycosylated protein as predicted from its amino acid sequence. The deglycosylation also confirmed that the ppt fraction was not contaminated with RBP. Thus, purified TENP migrating as a single band on SDS-PAGE was obtained from the ppt fraction and used for further testing on antimicrobial activity. Antimicrobial Activity of Emu TENP. It is well-known that chicken egg white significantly reduces growth of bacteria;12 more particularly, Gram-positive bacteria are sensitive to a bacteriolytic enzyme, lysozyme, in the egg white. As represented in Figure 6A, chicken egg white exhibited antibacterial activity against Gram-positive bacteria including M. luteus and B. subtilis. Similarly, emu egg white exhibited antibacterial activity against Gram-positive bacteria. However, it has been reported that emu egg white hardly contains lysozyme, so lytic activity is not detected in emu egg white.5 It is now widely recognized that the avian egg holds a number
of antimicrobial proteins, not only ovotransferrin and lysozyme, but also defensin peptides, protease inhibitors, and novel unidentified proteins.2 Therefore, the existence of bactericidal proteins against Gram-positive bacteria, other than wellestablished substances, was expected in emu egg white. Emu TENP (0.2 mM) purified from emu egg white reduced the growth of Gram-positive bacteria, especially M. luteus, but substantively failed to affect the growth of Gram-negative bacteria including E. coli and S. Typhimurium. The final concentration of TENP present in the bacterial suspension mixed with emu egg white was estimated to be approximately 0.15 mM on the basis of the 16% estimated level of TENP4 present in 8.9% of total protein in egg white.1 The antibacterial activities of emu TENP against M. luteus and B. subtilis increased as a function of TENP concentration, as shown in Figure 6B. The protein purity of the TENP sample was evaluated by SDS-PAGE; however, further confirmation is required to rule out any concern with contaminants that may affect its antibacterial activity. Human24 and oyster25 BPIs exert antimicrobial activities against Pseudomonas aeruginosa and E. coli, respectively. On the basis of its structural similarity with BPI, it was expected that TENP would exhibit a bactericidal activity spectrum similar to that of BPI against Gram-negative bacteria. Surprisingly, emu TENP was found not to affect Gram-negative bacteria but caused bactericidal effects against Gram-positive bacteria. These results suggest a contribution of TENP to the antibacterial activity of emu egg white against Gram-positive bacteria such as M. luteus and B. subtilis. OCX36, a member of the BPI superfamily, which is an abundant 5160
dx.doi.org/10.1021/jf5008117 | J. Agric. Food Chem. 2014, 62, 5156−5162
Journal of Agricultural and Food Chemistry
Article
allergenic proteins in emu (Dromaius novaehollandiae) egg white. J. Agric. Food Chem. 2010, 58, 12530−12536. (5) Maehashi, K.; Matano, M.; Irisawa, T.; Uchino, M.; Kashiwagi, Y.; Watanabe, T. Molecular characterization of goose- and chicken-type lysozymes in emu (Dromaius novaehollandiae): evidence for extremely low lysozyme levels in emu egg white. Gene 2012, 492, 244−249. (6) Guerin-Dubiard, C.; Pasco, M.; Molle, D.; Desert, C.; Croguennec, T.; Nau, F. Proteomic analysis of hen egg white. J. Agric. Food Chem. 2006, 54, 3901−3910. (7) Yan, R.-T.; Wang, S.-Z. Identification and characterization of tenp, a gene transiently expressed before overt cell differentiation during neurogenesis. J. Neurobiol. 1998, 34, 319−328. (8) Whenham, N.; Wilson, P. W.; Bain, M. M.; Stevenson, L.; Dunn, I. C. Compaative biology and expression of TENP, an egg protein related to the bacterial permeability-increasing family of proteins. Gene 2014, 538, 99−108. (9) Takeuchi, J.; Maehashi, K.; Yasutake, Y.; Muramatsu, Y.; Miyata, K.; Watanabe, T.; Nagashima, T. Properties of emu (Dromaius novaehollandiae) albumen proteins. Food Res. Int. 2012, 49, 567−571. (10) Laemmli, U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970, 227, 680− 685. (11) Felsenstein, J. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 1985, 39, 783−79. (12) Wellman-Labadie, O.; Picman, J.; Hincke, M. T. Comparative antibacterial activity of avian egg white protein extracts. Br. Poult. Sci. 2008, 49, 125−132. (13) Beamer, L. J.; Carroll, S. F.; Eisenberg, D. Crystal structure of human BPI and two bound phospholipids at 2.4 angstrom resolution. Science 1997, 276, 1861−1864. (14) Gautron, J.; Rehault-Godbert, S.; Pascal, G.; Nys, Y.; Hincke, M. T. Ovocalyxin-36 and other LBP/BPI/PLUNC-like proteins as molecular actors of the mechanisms of the avian egg natural defenses. Biochem. Soc. Trans. 2011, 39, 971−976. (15) Gautron, J.; Murayama, E.; Morisson, M.; Mckee, M. D.; Rehault, S.; Labas, V.; Belghazi, M.; Vidal, M.-L.; Nys, Y.; Hincke, M. T. Cloning of ovocalxin-36, a novel chicken eggshell protein related to lipopolysaccharide-binding proteins, bactericidal permeability-increasing proteins, and Plunc family proteins. J. Biol. Chem. 2007, 282, 5273−5286. (16) Rose-Martel, M.; Du, J.; Hincke, M. T. Proteomic analysis provides new insight into the chicken eggshell cuticle. J. Proteomics 2012, 75, 2697−2706. (17) Myint, S.-L.; Shimogiri, T.; Kawabe, K.; Hashiguchi, T.; Maeda, Y.; Okamoto, S. Characteristics of seven Japanese native chicken breeds based on egg white protein polymorphisms. Asian−Aust. J. Anim. Sci. 2010, 23, 1137−1144. (18) Forsythe, R. H.; Foster, J. F. Egg white proteins. I. Electrophoretic studies on whole white. J. Biol. Chem. 1950, 184, 377−384. (19) Weiss, J. Bactericidal/permeability-increasing protein (BPI) and lipopolysaccharide-binding protein (LBP): structure, function and regulation in host defence against Gram-negative bacteria. Biochem. Soc. Trans. 2003, 31, 785−790. (20) Cordeiro, C. M. M.; Esmail, H.; Ansah, G.; Hincke, M. T. Ovocalyxin-36 is a pattern recognition protein in chicken eggshell membranes. PLoS One 2013, 8, DOI: 10.1371/journal.pone.0084112. (21) Jonchere, V.; Rehault-Godbert, S.; Hennequet-Antier, C.; Cabau, C.; Sibut, V.; Cogburn, L. A.; Nys, Y.; Gautron, J. Gene expression profiling to identify eggshell proteins involved in physical defense of the chicken egg. BMC Genomics 2010, 11, 57. (22) Chiang, S.-C.; Veldhuizen, E. J. A.; Barnes, F. A.; Craven, C. J. Identification and characterisation of the BPI/LBP/PLUNC-like gene repertoire in chickens reveals the absence of a LBP gene. Dev. Comp. Immunol. 2011, 35, 285−295. (23) Maehashi, K.; Matano, M.; Uchino, M.; Yamamoto, Y.; Takano, K.; Watanabe, T. The primary structure of a novel riboflavin-binding protein of emu (Dromaius novaehollandiae). Comp. Biochem. Physiol. Part B 2009, 153, 95−100.
component of chicken egg shell membrane, was recently investigated for its antimicrobial activity and was found to be effective against Staphylococcus aureus but not against Gramnegative bacteria such as P. aeruginosa, E. coli and S. Typhimurium.21 The avian eggshell protects the embryo against entry of micro-organisms.26 OCX-36 was suggested to play an innate role in the protection of the egg.21 Defensins constitute a large number of cationic antibacterial peptides.27 Avian β-defensin 11 was purified from chicken egg vitelline membrane and exhibited antimicrobial activity toward both Gram-positive and Gram-negative bacteria.28 In emu egg, an ovocalyxin-17 (OC-17)-like protein, a member of the C-type lectin-like proteins, was named dromaiocalcin and represents a dominant protein in the eggshell matrix.29 Because chicken OC-17 is a bactericidal protein,30 dromaiocalcin is also expected to play an important role in the protection of the emu egg. In a previous study by Wellman-Labadie et al., species differences in the antibacterial activity of egg albumen were observed between Galliformes and Anseriformies and were attributed to the concentrations of ovotransferrin and lysozyme.12 Because ovotransferrin is present in emu egg white4 in a remarkably abundant amount, it was suggested that ovotransferrin was the main contributor to the antibacterial activity of emu egg white, whereas TENP was only partially involved, for example, against M. luteus. In this study, we examined for the first time the bioactivity of TENP and found that emu TENP is a novel antibacterial protein but exerts a different spectrum of action compared to BPI, despite their structural similarity. Because TENP is contained abundantly in emu egg white, emu TENP might play a role, even partially, in the defense system against bacterial infection of the egg white. Further investigations on the antimicrobial action of TENP is required to elucidate the natural defense system present in emu egg white, with a particular focus on the role of ovotransferrin, the most abundant protein in emu egg white.
■
AUTHOR INFORMATION
Corresponding Author
*(K.M.) Phone/fax: +81-3-5477-2748. E-mail: maehashi@ nodai.ac.jp. Funding
This work was financially supported by the Kieikai Research Foundation. Notes
The authors declare no competing financial interest.
■ ■
ACKNOWLEDGMENTS We thank Ms. Yuki Yoshida for her technical assistance. REFERENCES
(1) Takeuchi, J.; Nagashima, T. Chemical and physical characterization of Dromaius novaehollandiae (emu) eggs. Food Sci. Technol. Res. 2010, 16, 149−156. (2) Wellman-Labadie, O.; Picman, J.; Hincke, M. T. Avian antimicrobial proteins: structure, distribution and activity. Worlds Poult. Sci. J. 2007, 63, 421−438. (3) Mine, Y.; Yang, M. Recent advances in the understanding of egg allergens: basic, industrial, and clinical perspectives. J. Agric. Food Chem. 2008, 56, 4874−4900. (4) Maehashi, K.; Matano, M.; Irisawa, T.; Uchino, M.; Itagaki, Y.; Takano, K.; Kashiwagi, Y.; Watanabe, T. Primary structure of potential 5161
dx.doi.org/10.1021/jf5008117 | J. Agric. Food Chem. 2014, 62, 5156−5162
Journal of Agricultural and Food Chemistry
Article
(24) Aichele, D.; Schunare, M.; Saake, M.; Rollinghoff, M.; Gessner, A. Expression and antimicrobial function of bactericidal permiabilityincreasing protein in cystic fibrosis patients. Infect. Immun. 2006, 74, 4708−4714. (25) Gonzalez, M.; Gueguen, Y.; Destoumieux-Garzon, D.; Romestand, B.; Fievet, J.; Pugniere, M.; Roquet, F.; Escoubas, J.-M.; Vandenbulcke, F.; Levy, O.; Saune, L.; Bulet, P.; Bachere, E. Evidence of a bactericidal permeability increasing protein in an inverterbrate, the Crassostrea gigas Cg-BPI. Proc. Natl. Acad. Sci. U.S.A. 2007, 45, 17759− 17764. (26) Rose, M. L. H.; Hincke, M. T. Protein constituents of the eggshell: eggshell-specific matrix proteins. Cell. Mol. Life Sci. 2009, 66, 2707−2719. (27) Xiao, Y.; Hughes, A. L.; Ando, J.; Matsuda, Y.; Cheng, J.-F.; Skinner-Noble, D.; Zhang, G. A genome-wide screen identifies a single β-defensin gene cluster in the chicken: implications for the origin and evolution of mammalian defensins. BMC Genomics 2004, 5, 56. (28) Herve-Grepinet, V.; Rehault-Godbert, S.; Labas, V.; Magallon, T.; Derache, C.; Lavergne, M.; Gautron, J.; Lalmanach, A.-C.; Nys, Y. Purification and characterization of afffvian β-defensin 11, an antimicrobial peptide of the hen egg. Antimicrob. Agents Chemother. 2010, 54, 4401−4408. (29) Mann, K. Identification of the major proteins of the organic matrix of emu (Dromaius novaehollandiae) and rhea (Rhea americana) eggshell calcified layer. Br. Poult. Sci. 2004, 45, 483−490. (30) Wellman-Labadie, O.; Lakshminarayanan, R.; Hincke, M. T. antimicrobial properties of avian eggshell-specific C-type lectin-like proteins. FEBS Lett. 2008, 582, 699−704.
5162
dx.doi.org/10.1021/jf5008117 | J. Agric. Food Chem. 2014, 62, 5156−5162
Biochemical and Functional Characterization of Transiently Expressed in Neural Precursor (TENP) Protein in Emu Egg White Kenji Maehashi,*,† Megumi Ueda,† Mami Matano,† Junko Takeuchi,‡ Masataka Uchino,# Yutaka Kashiwagi,† and Toshihiro Watanabe‡ †
Department of Fermentation Science, Faculty of Applied Bio-Science, Tokyo University of Agriculture, 1-1-1 Sakuragaoka, Setagaya-ku, Tokyo 156-8502, Japan ‡ Department of Food and Cosmetic Science, Faculty of Bio-Industry, Tokyo University of Agriculture, 196 Yasaka, Abashiri, Hokkaido 099-2493, Japan # Department of Applied Biology and Chemistry, Faculty of Applied Bio-Science, Tokyo University of Agriculture, 1-1-1 Sakuragaoka, Setagaya-ku, Tokyo 156-8502, Japan ABSTRACT: A protein transiently expressed in the neural precursors of developing tissues (TENP) was found to be present in emu (Dromaius novaehollandiae) egg white as one of the major proteins. Nucleotide analysis of its encoding cDNA revealed a sequence of 452 amino acids including a 19 amino acid peptide signal. Phylogenetic analysis determined that emu TENP was clustered within the bactericidal/permeability-increasing protein (BPI) superfamily together with other avian TENPs. RT-PCR analysis revealed that the emu TENP gene was highly expressed in the magnum of the oviduct, indicating that TENP is a major egg white component. Emu TENP was purified by anion exchange chromatography and ammonium sulfate fractionation. Unlike BPI, emu TENP exhibited antibacterial activity against Gram-positive bacteria, including Micrococcus luteus and Bacillus subtilis, but not against Gram-negative bacteria such as Escherichia coli and Salmonella Typhimurium. The results suggest that emu TENP is a potent novel antibacterial protein with a spectrum distinct from that of BPI. KEYWORDS: emu, egg white, TENP, antibacterial activity, BPI
■
developmental transition during neurogenesis.7 Recent studies based on proteomic6 and transcriptomic8 analyses revealed that TENP is a major component of the egg; hence, we sought to test the hypothesis that TENP may exert antimicrobial activity. To the best of our knowledge, there are no reports of the functional characteristics of TENP. A recent paper suggests that the relatively higher thermostability of TENP might explain the unique properties of emu egg white in processed food production.9 In this study, we provide evidence that TENP is present in emu egg white, and we tested its antibacterial activity as a prediction of its function in emu egg white.
INTRODUCTION The emu (Dromaius novaehollandiae) is a bird native to Australia and is the second largest member of the ratite family, which also includes the ostrich, the rhea, and the cassowary. Emus have come to be considered as an alternative form of livestock, and their production has seen an increase in many regions worldwide, including Japan. Emus produce eggs that are 10 times larger than chicken eggs. It was also reported that, during heat-induced coagulation, the albumen and yolk of the emu egg has a softer texture compared to that of the hen egg.1 Thus, emu eggs are of interest as an alternative egg product. However, only a very few studies have investigated the biochemical properties of emu egg white, as opposed to chicken egg white, which has been extensively characterized with regard to its antimicrobial properties,2 its allergenicity,3 etc. We previously reported considerable differences in the composition of major proteins between emu and chicken egg white, including the observation that ovotransferrin was the dominant protein, whereas lysozyme was hardly detected in emu egg white,4,5 in contrast to ovalbumin being the dominant protein in chicken egg white, followed by ovotransferrin, ovomucoid, and lysozyme.4 A remarkable feature of emu egg white is that transiently expressed in neural precursor (TENP) protein represents one of its major proteins, estimated at 16% of the total protein content in emu egg white,4 whereas it accounts for only 0.1−0.5% of chicken egg white total protein content.6 TENP was first reported as a protein transiently expressed in neural precursors of developing tissues, such as the brain and retina, and was believed to be involved in the © 2014 American Chemical Society
■
MATERIALS AND METHODS
Materials. Eggs and tissues of egg-laying female emus (D. novaehollandiae) were obtained from Tokyo Nodai Bio-Industry (Abashiri, Hokkaido, Japan). Eggs of White Leghorn chickens were obtained from a local market. The egg white was collected from eggs and homogenized in a blender. The magnum of the oviduct and the ovary were dissected out immediately after butchering, and smaller than 5 mm3 pieces of tissues were excised and stored in RNAlater (Ambion, Inc., Austin, TX, USA) until use. Purification of TENP from Egg White. The homogenized emu egg white was diluted 10-fold with deionized water and adjusted to pH 6.0 by 1 N HCl. After overnight stirring at 4 °C, the mixture was Received: Revised: Accepted: Published: 5156
February 17, 2014 May 11, 2014 May 12, 2014 May 12, 2014 dx.doi.org/10.1021/jf5008117 | J. Agric. Food Chem. 2014, 62, 5156−5162
Journal of Agricultural and Food Chemistry
Article
centrifuged to remove insoluble substances and was adjusted to pH 8.0 by 1 M Tris-HCl (pH 8.0) and 1 N HCl. The solution was then run through a DEAE-Sepharose FF column (buffered with 20 mM TrisHCl buffer, pH 8.0, ⌀ 2.6 × 30 cm) and eluted with the same buffer followed by 0.14 M NaCl in the same buffer and a linear NaCl concentration gradient of 0.14−0.5 M, again in the same buffer. The eluted fraction was subjected to 55% saturated ammonium sulfate fractionation. The precipitate fraction was separated from the supernatant fraction, desalted by dialysis against deionized water, and lyophilized to obtain purified emu TENP. Deglycosylation of TENP. Specific cleavage of N-glycan moieties (N-acetylglucosamine−asparagine bonds) present in TENP was carried out using glycopeptidase F (Takara-Bio Inc., Otsu, Japan). After denaturation by boiling for 3 min in buffer containing 0.5% SDS and 0.75% β-mercaptoethanol, the sample was subjected to digestion with glycopeptidase F at 37 °C overnight. SDS-PAGE. SDS-PAGE was performed using 12.5 or 15% polyacrylamide gel according to the method of Laemmli.10 The sample solution was mixed with an equal volume of loading buffer prior to heat treatment. The resulting sample was run on a SDS-PAGE gel. After electrophoresis, the gels were stained with 0.025% Coomassie Brilliant Blue R-250 (CBB) in an aqueous solution of 50% methanol and 10% acetic acid. The stained gels were washed using an aqueous solution of 25% methanol and 10% acetic acid, followed by water. cDNA Cloning of Emu TENP. Total RNA was extracted from emu tissues using the TRI Reagent (Molecular Research Center, Inc., Cincinnati, OH, USA), and first-strand cDNA was synthesized using SuperScript III First-Strand Synthesis SuperMix and oligo-dT (20) primer (Invitrogen Co., Carlsbad, CA, USA). The first-strand cDNA was used for subsequent PCR amplifications of emu TENP cDNA with Ex Taq DNA polymerase (Takara Bio Inc., Shiga, Japan). For the cloning of emu TENP cDNA, primers were designed on the basis of the nucleotide sequence of chicken TENP (GenBank ID NM_205026). Sequences of the primers are listed in Table 1.
used for RT-PCR analysis. Sequences of the primers are listed in Table 1. PCR amplification was performed with Ex Taq DNA polymerase (Takara Bio) at 94 °C for 30 s followed by 35 cycles at 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 45 s. To calibrate the cDNA concentration between samples, the β-actin gene was amplified as a housekeeping gene using a primer set of bact-13F/bact-14R, as determined by the same program. Amplicon sizes were confirmed by agarose gel electrophoresis with ethidium bromide staining. Phylogenetic Tree Analysis. The amino acid sequences of TENP and other BPI superfamily proteins were obtained from the NCBI GenBank database as indicated in Figure 3. The ClustalW 1.81 multiple sequence alignment program was used for the alignments of protein sequences of various BPI superfamily proteins and emu ovotransferrin (DDBJ ID AB455549), determination of amino acid substitution, and construction of the neighbor-joining phylogenetic tree. Bootstrap analysis was replicated 1000 times to evaluate the phylogenetic tree topology.11 Antibacterial Assay. Escherichia coli TOP10, Salmonella Typhimurium TA1535/pSK1002, Micrococcus luteus NRIC1094, and Bacillus subtilis NRIC1016 were used for antibacterial assay. The antibacterial activity of TENP was measured using the method described by Wellman-Labadie et al.12 with some modifications. Overnight bacterial cultures were grown to the log phase in nutrient broth (for all bacteria except E. coli) or in LB broth (for E. coli), then centrifuged, washed, and resuspended in 10 mM sodium phosphate buffer (pH 7.4). TENP dissolved in the same buffer or in homogenized egg white samples was added to an equal volume of bacterial suspension diluted to 0.02 at OD675 nm to give 5−200 μM final TENP concentration and then incubated for 1 h at 37 °C. After incubation, a serial dilution of the sample was plated onto nutrient agar or LB agar and incubated at 37 °C until distinct colonies could be counted (18−36 h). All assays were performed in triplicate, and the antibacterial activity was represented as the percentage of reduced bacterial cell (colony) number compared with controls consisting of microbes incubated alone.
■
RESULTS AND DISCUSSION Primary Structure of TENP. In a previous study, we detected and identified TENP by amino acid sequencing of its N-terminus and found that TENP was one of the major proteins in emu egg white.2 Here we designed a gene-specific primer set for emu TENP based on the sequence of chicken TENP and successfully cloned and sequenced the 1356 bp sequence of TENP precursor cDNA, containing an ORF encoding for a 46 kDa mature protein (Figure 1). A signal peptide cleavage site of emu TENP (indicated in Figure 1) was previously identified by N-terminal amino acid sequencing of the purified protein.4 The results were in accordance with the prediction obtained from the SignalP program using the emu TENP precursor sequence. They were also in agreement with that of the chicken TENP (HG007958) proposed by Whenham et al.,8 but different from that published by Yan and Wang7 (AF029841), as shown in Figure 2. Our results indicate that the emu TENP sequence is 6 amino acids longer than that of chicken TENP (HG007958) at the C-terminus and has 1 amino acid insertion at position 123 (Figure 2). The predicted N-glycosylation site and the number of cysteine residues were conserved features of both TENPs of emu and chicken. A consensus proline-rich region was found in the midsection (amino acid position 209−220 in emu) of both sequences. It was previously reported that human BPI consists of two domains of similar size that are connected by a prolinerich linker of 21 residues including 6 prolines.13 Upon phylogenetic analysis of the inferred amino acid sequence, results showed that emu TENP belongs to the BPI/LBP/ PLUNC superfamily together with other avian TENPs but distinct from other BPI-related proteins14 such as BPI-like 1
Table 1. Primers Used in This Study name
sequence (5′ → 3′)
use
TENP-7F TENP-5R TENP-8F TENP-16R TENP-10F TENP-12R TENP-15F bact-13F bact-14R
CCTGGCTTTGTCCGAGCA CCCACATTGGAGGCAGCCA CTACTACACCAGCCTCTTCCTC GTTACAATCCATCCTCCTTC ACAGCAAACAGAAAAGGCAG GACGGTGAGGAAGAGCTTCA CGGACAAGGAGATTGATGTCG GTGACCTGACAGACTACCT CAGGAAGGATGGCTGGAAGAG
cloning cloning cloning cloning cloning RT-PCR RT-PCR RT-PCR RT-PCR
At first, emu TENP cDNA fragment was amplified from magnum cDNA using the primers TENP-7F and TENP-5R. Next, the primers TENP-8F based on the emu TENP cDNA fragment and TENP-16 based on the chicken TENP were used for amplification of the fragment containing a start codon of emu TENP cDNA. Also, the reverse primer TENP-12R based on the emu TENP cDNA fragment and the forward primer TENP-10F based on the sequence of chicken TENP cDNA were used for amplification of the fragment containing a stop codon of emu TENP cDNA. All amplified fragments were cloned into pCR2.1-TOPO (Invitrogen) and sequenced. DNA Sequencing. Nucleotide sequences of cloned DNAs in pCR2.1-TOPO were analyzed by Macrogen Japan Co. (Tokyo, Japan). T7 promoter primer and M13 reverse primer (Invitrogen) were used as sequencing primers. The resultant nucleotide sequence data were assembled using the ATGC program (Genetyx Corp., Tokyo, Japan) and analyzed by using the NCBI nucleotide BLAST program. Reverse Transcription Polymerase Chain Reaction (RT-PCR). For tissue expression profiling of emu TENP mRNA, the primer set composed of TENP-15F/TENP-12R and emu magnum cDNA were 5157
dx.doi.org/10.1021/jf5008117 | J. Agric. Food Chem. 2014, 62, 5156−5162
Journal of Agricultural and Food Chemistry
Article
Figure 1. Nucleotide and deduced amino acid sequences of emu TENP. Signal peptide sequence is indicated by a bold underline. The amino acids determined by direct sequencing in a previous paper2 are indicated by a dashed line. A signal cleavage site is indicated by an inverted triangle. This sequence will appear in the DDBJ database under the accession number AB556937. Arrows indicate locations of the primers for RT-PCR.
orthologous to mammalian BPIL1s, as previously suggested by Gautron et al.14 Gene Expression of TENP in Emu Tissues. The chicken egg is formed in the reproductive system composed of the ovary and the oviduct, and the egg white is produced in the magnum, a specific region of the oviduct.21 To confirm whether TENP mRNA is expressed in the magnum, RT-PCR analysis of the magnum and the ovary of female egg-laying emus was performed. As expected, the TENP gene was highly amplified from the emu magnum, but was hardly detected in the ovary, as shown in Figure 4. Yan and Wang7 reported the transient expression of chicken TENP gene in embryonic retina and brain tissues during the early developmental stages. Recently, a strong expression of the TENP gene was reported in the chicken magnum.22 Whenham et al.8 revealed that the expression of TENP gene is largely confined to the magnum of the oviduct of adult chicken and is controlled by gonadal steroids as a typically egg-specific gene. It is predicted that the emu TENP gene is also specifically expressed in the magnum of
(BPIL1) and ovocalyxin-36 (OCX-36) (Figure 3). OCX-36 is an eggshell protein that is secreted during shell formation and found in the basal shell and associated membranes15 and also eggshell cuticle.16 Upon BLAST search for emu TENP, chicken TENP sequence was found to be identical to the protein previously known as chicken ovoglobulin G2 (sequence ID AB219158). Ovoglobulin G2 has three different polymorphic forms, AA, AB, and BB, with the majority being of the BB type.17 Although ovoglobulin G2 is well documented for its presence in chicken egg white,18 its biological function in egg white remains unknown. On the basis of amino acid sequence similarity with BPI and in relation to its bactericidal domain, chicken TENP was predicted to exert bactericidal activity similar to that of BPI protein. It is well established that BPI is an essential component of the innate immune system repertoire against Gram-negative bacterial infections.19 Antibacterial activity and LPS-binding capacity of chicken OCX-36 were recently reported.20 The phylogeny represented in Figure 3 suggests that avian TENPs, including emu TENP, are 5158
dx.doi.org/10.1021/jf5008117 | J. Agric. Food Chem. 2014, 62, 5156−5162
Journal of Agricultural and Food Chemistry
Article
Figure 2. Alignment of amino acid sequences of emu and chicken TENPs [GenBank ID HG007958 (ChicHG) and AF029841 (ChicAF)]. Consensus sequences are highlighted in gray. Consensus cysteine residues are highlighted in black, whereas proline-rich regions are indicated by a dark gray background. The asterisk indicates a potential N-glycosylation site.
Figure 4. RT-PCR analysis of expression of TENP gene in emu magnum and ovary. Figure 3. Phylogenetic analysis of TENPs and BPI/LBP/PLUNCrelated proteins based on amino acid sequences. The accession numbers of the proteins used in this analysis are indicated. Numbers at the nodes represent bootstrap proportions (%) from 1000 replicates.
further understand the abundance of TENP in the emu egg white in relation to its gene expression profiles. Purification and Identification of TENP from Emu Egg White. Emu egg white preparation was separated into three peaks on DEAE-Sepharose FF column with NaCl elution. As determined by SDS-PAGE analysis, peaks P1 and P2 contained mainly an 80 kDa protein and a 100 kDa protein, respectively (Figure 5B). These peaks were further characterized by
laying emus, as is the case in chickens. It would thus be of great interest to investigate the tissue distribution and regulation of TENP gene expression in each region of the emu oviduct including the magnum, the white isthmus, and the uterus, to 5159
dx.doi.org/10.1021/jf5008117 | J. Agric. Food Chem. 2014, 62, 5156−5162
Journal of Agricultural and Food Chemistry
Article
Figure 6. (A) Antibacterial activity of emu and chicken egg whites (EW) versus emu TENP. (B) Antibacterial activity of emu TENP against M. luteus and B. subtilis. M. luteus, Micrococcus luteus NRIC1094; B. subtilis, Bacillus subtilis NRIC1016; E. coli, Escherichia coli TOP10; S. Typhimurium, Salmonella Typhimurium TA1535/ pSK1002. The results are represented as the average values obtained from three independent experiments. (∗) p < 0.05; (∗∗)p < 0.01.
Figure 5. (A) Separation of emu egg white on DEAE-Sepharose column. (B) SDS-PAGE of DEAE peaks. (C) SDS-PAGE of deglycosylated samples from ammonium sulfate fractions (sup, supernatant; ppt, precipitate) of P3. Deglycosylation was carried out using glycopeptidase F.
separation (data not shown) and identified as ovotransferrin and ovalbumin, respectively, as previously described in our studies.4 P3 contained mainly a 50 kDa protein, which was further separated by a 55% saturated ammonium sulfate fractionation. Resultant supernatant (sup) and precipitate (ppt) fractions both showed a single band on SDS-PAGE, as indicated in Figure 5C. However, after deglycosylation the sup fraction revealed another protein of 30 kDa. We reported in our previous study that emu egg albumen contained a riboflavinbinding protein of 50 kDa, which showed a 30 kDa band after deglycosylation.23 A 50 kDa protein, reduced in size after deglycosylation, of the ppt fraction was identified as TENP by protein sequencing and we thereby concluded that emu TENP is an N-glycosylated protein as predicted from its amino acid sequence. The deglycosylation also confirmed that the ppt fraction was not contaminated with RBP. Thus, purified TENP migrating as a single band on SDS-PAGE was obtained from the ppt fraction and used for further testing on antimicrobial activity. Antimicrobial Activity of Emu TENP. It is well-known that chicken egg white significantly reduces growth of bacteria;12 more particularly, Gram-positive bacteria are sensitive to a bacteriolytic enzyme, lysozyme, in the egg white. As represented in Figure 6A, chicken egg white exhibited antibacterial activity against Gram-positive bacteria including M. luteus and B. subtilis. Similarly, emu egg white exhibited antibacterial activity against Gram-positive bacteria. However, it has been reported that emu egg white hardly contains lysozyme, so lytic activity is not detected in emu egg white.5 It is now widely recognized that the avian egg holds a number
of antimicrobial proteins, not only ovotransferrin and lysozyme, but also defensin peptides, protease inhibitors, and novel unidentified proteins.2 Therefore, the existence of bactericidal proteins against Gram-positive bacteria, other than wellestablished substances, was expected in emu egg white. Emu TENP (0.2 mM) purified from emu egg white reduced the growth of Gram-positive bacteria, especially M. luteus, but substantively failed to affect the growth of Gram-negative bacteria including E. coli and S. Typhimurium. The final concentration of TENP present in the bacterial suspension mixed with emu egg white was estimated to be approximately 0.15 mM on the basis of the 16% estimated level of TENP4 present in 8.9% of total protein in egg white.1 The antibacterial activities of emu TENP against M. luteus and B. subtilis increased as a function of TENP concentration, as shown in Figure 6B. The protein purity of the TENP sample was evaluated by SDS-PAGE; however, further confirmation is required to rule out any concern with contaminants that may affect its antibacterial activity. Human24 and oyster25 BPIs exert antimicrobial activities against Pseudomonas aeruginosa and E. coli, respectively. On the basis of its structural similarity with BPI, it was expected that TENP would exhibit a bactericidal activity spectrum similar to that of BPI against Gram-negative bacteria. Surprisingly, emu TENP was found not to affect Gram-negative bacteria but caused bactericidal effects against Gram-positive bacteria. These results suggest a contribution of TENP to the antibacterial activity of emu egg white against Gram-positive bacteria such as M. luteus and B. subtilis. OCX36, a member of the BPI superfamily, which is an abundant 5160
dx.doi.org/10.1021/jf5008117 | J. Agric. Food Chem. 2014, 62, 5156−5162
Journal of Agricultural and Food Chemistry
Article
allergenic proteins in emu (Dromaius novaehollandiae) egg white. J. Agric. Food Chem. 2010, 58, 12530−12536. (5) Maehashi, K.; Matano, M.; Irisawa, T.; Uchino, M.; Kashiwagi, Y.; Watanabe, T. Molecular characterization of goose- and chicken-type lysozymes in emu (Dromaius novaehollandiae): evidence for extremely low lysozyme levels in emu egg white. Gene 2012, 492, 244−249. (6) Guerin-Dubiard, C.; Pasco, M.; Molle, D.; Desert, C.; Croguennec, T.; Nau, F. Proteomic analysis of hen egg white. J. Agric. Food Chem. 2006, 54, 3901−3910. (7) Yan, R.-T.; Wang, S.-Z. Identification and characterization of tenp, a gene transiently expressed before overt cell differentiation during neurogenesis. J. Neurobiol. 1998, 34, 319−328. (8) Whenham, N.; Wilson, P. W.; Bain, M. M.; Stevenson, L.; Dunn, I. C. Compaative biology and expression of TENP, an egg protein related to the bacterial permeability-increasing family of proteins. Gene 2014, 538, 99−108. (9) Takeuchi, J.; Maehashi, K.; Yasutake, Y.; Muramatsu, Y.; Miyata, K.; Watanabe, T.; Nagashima, T. Properties of emu (Dromaius novaehollandiae) albumen proteins. Food Res. Int. 2012, 49, 567−571. (10) Laemmli, U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970, 227, 680− 685. (11) Felsenstein, J. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 1985, 39, 783−79. (12) Wellman-Labadie, O.; Picman, J.; Hincke, M. T. Comparative antibacterial activity of avian egg white protein extracts. Br. Poult. Sci. 2008, 49, 125−132. (13) Beamer, L. J.; Carroll, S. F.; Eisenberg, D. Crystal structure of human BPI and two bound phospholipids at 2.4 angstrom resolution. Science 1997, 276, 1861−1864. (14) Gautron, J.; Rehault-Godbert, S.; Pascal, G.; Nys, Y.; Hincke, M. T. Ovocalyxin-36 and other LBP/BPI/PLUNC-like proteins as molecular actors of the mechanisms of the avian egg natural defenses. Biochem. Soc. Trans. 2011, 39, 971−976. (15) Gautron, J.; Murayama, E.; Morisson, M.; Mckee, M. D.; Rehault, S.; Labas, V.; Belghazi, M.; Vidal, M.-L.; Nys, Y.; Hincke, M. T. Cloning of ovocalxin-36, a novel chicken eggshell protein related to lipopolysaccharide-binding proteins, bactericidal permeability-increasing proteins, and Plunc family proteins. J. Biol. Chem. 2007, 282, 5273−5286. (16) Rose-Martel, M.; Du, J.; Hincke, M. T. Proteomic analysis provides new insight into the chicken eggshell cuticle. J. Proteomics 2012, 75, 2697−2706. (17) Myint, S.-L.; Shimogiri, T.; Kawabe, K.; Hashiguchi, T.; Maeda, Y.; Okamoto, S. Characteristics of seven Japanese native chicken breeds based on egg white protein polymorphisms. Asian−Aust. J. Anim. Sci. 2010, 23, 1137−1144. (18) Forsythe, R. H.; Foster, J. F. Egg white proteins. I. Electrophoretic studies on whole white. J. Biol. Chem. 1950, 184, 377−384. (19) Weiss, J. Bactericidal/permeability-increasing protein (BPI) and lipopolysaccharide-binding protein (LBP): structure, function and regulation in host defence against Gram-negative bacteria. Biochem. Soc. Trans. 2003, 31, 785−790. (20) Cordeiro, C. M. M.; Esmail, H.; Ansah, G.; Hincke, M. T. Ovocalyxin-36 is a pattern recognition protein in chicken eggshell membranes. PLoS One 2013, 8, DOI: 10.1371/journal.pone.0084112. (21) Jonchere, V.; Rehault-Godbert, S.; Hennequet-Antier, C.; Cabau, C.; Sibut, V.; Cogburn, L. A.; Nys, Y.; Gautron, J. Gene expression profiling to identify eggshell proteins involved in physical defense of the chicken egg. BMC Genomics 2010, 11, 57. (22) Chiang, S.-C.; Veldhuizen, E. J. A.; Barnes, F. A.; Craven, C. J. Identification and characterisation of the BPI/LBP/PLUNC-like gene repertoire in chickens reveals the absence of a LBP gene. Dev. Comp. Immunol. 2011, 35, 285−295. (23) Maehashi, K.; Matano, M.; Uchino, M.; Yamamoto, Y.; Takano, K.; Watanabe, T. The primary structure of a novel riboflavin-binding protein of emu (Dromaius novaehollandiae). Comp. Biochem. Physiol. Part B 2009, 153, 95−100.
component of chicken egg shell membrane, was recently investigated for its antimicrobial activity and was found to be effective against Staphylococcus aureus but not against Gramnegative bacteria such as P. aeruginosa, E. coli and S. Typhimurium.21 The avian eggshell protects the embryo against entry of micro-organisms.26 OCX-36 was suggested to play an innate role in the protection of the egg.21 Defensins constitute a large number of cationic antibacterial peptides.27 Avian β-defensin 11 was purified from chicken egg vitelline membrane and exhibited antimicrobial activity toward both Gram-positive and Gram-negative bacteria.28 In emu egg, an ovocalyxin-17 (OC-17)-like protein, a member of the C-type lectin-like proteins, was named dromaiocalcin and represents a dominant protein in the eggshell matrix.29 Because chicken OC-17 is a bactericidal protein,30 dromaiocalcin is also expected to play an important role in the protection of the emu egg. In a previous study by Wellman-Labadie et al., species differences in the antibacterial activity of egg albumen were observed between Galliformes and Anseriformies and were attributed to the concentrations of ovotransferrin and lysozyme.12 Because ovotransferrin is present in emu egg white4 in a remarkably abundant amount, it was suggested that ovotransferrin was the main contributor to the antibacterial activity of emu egg white, whereas TENP was only partially involved, for example, against M. luteus. In this study, we examined for the first time the bioactivity of TENP and found that emu TENP is a novel antibacterial protein but exerts a different spectrum of action compared to BPI, despite their structural similarity. Because TENP is contained abundantly in emu egg white, emu TENP might play a role, even partially, in the defense system against bacterial infection of the egg white. Further investigations on the antimicrobial action of TENP is required to elucidate the natural defense system present in emu egg white, with a particular focus on the role of ovotransferrin, the most abundant protein in emu egg white.
■
AUTHOR INFORMATION
Corresponding Author
*(K.M.) Phone/fax: +81-3-5477-2748. E-mail: maehashi@ nodai.ac.jp. Funding
This work was financially supported by the Kieikai Research Foundation. Notes
The authors declare no competing financial interest.
■ ■
ACKNOWLEDGMENTS We thank Ms. Yuki Yoshida for her technical assistance. REFERENCES
(1) Takeuchi, J.; Nagashima, T. Chemical and physical characterization of Dromaius novaehollandiae (emu) eggs. Food Sci. Technol. Res. 2010, 16, 149−156. (2) Wellman-Labadie, O.; Picman, J.; Hincke, M. T. Avian antimicrobial proteins: structure, distribution and activity. Worlds Poult. Sci. J. 2007, 63, 421−438. (3) Mine, Y.; Yang, M. Recent advances in the understanding of egg allergens: basic, industrial, and clinical perspectives. J. Agric. Food Chem. 2008, 56, 4874−4900. (4) Maehashi, K.; Matano, M.; Irisawa, T.; Uchino, M.; Itagaki, Y.; Takano, K.; Kashiwagi, Y.; Watanabe, T. Primary structure of potential 5161
dx.doi.org/10.1021/jf5008117 | J. Agric. Food Chem. 2014, 62, 5156−5162
Journal of Agricultural and Food Chemistry
Article
(24) Aichele, D.; Schunare, M.; Saake, M.; Rollinghoff, M.; Gessner, A. Expression and antimicrobial function of bactericidal permiabilityincreasing protein in cystic fibrosis patients. Infect. Immun. 2006, 74, 4708−4714. (25) Gonzalez, M.; Gueguen, Y.; Destoumieux-Garzon, D.; Romestand, B.; Fievet, J.; Pugniere, M.; Roquet, F.; Escoubas, J.-M.; Vandenbulcke, F.; Levy, O.; Saune, L.; Bulet, P.; Bachere, E. Evidence of a bactericidal permeability increasing protein in an inverterbrate, the Crassostrea gigas Cg-BPI. Proc. Natl. Acad. Sci. U.S.A. 2007, 45, 17759− 17764. (26) Rose, M. L. H.; Hincke, M. T. Protein constituents of the eggshell: eggshell-specific matrix proteins. Cell. Mol. Life Sci. 2009, 66, 2707−2719. (27) Xiao, Y.; Hughes, A. L.; Ando, J.; Matsuda, Y.; Cheng, J.-F.; Skinner-Noble, D.; Zhang, G. A genome-wide screen identifies a single β-defensin gene cluster in the chicken: implications for the origin and evolution of mammalian defensins. BMC Genomics 2004, 5, 56. (28) Herve-Grepinet, V.; Rehault-Godbert, S.; Labas, V.; Magallon, T.; Derache, C.; Lavergne, M.; Gautron, J.; Lalmanach, A.-C.; Nys, Y. Purification and characterization of afffvian β-defensin 11, an antimicrobial peptide of the hen egg. Antimicrob. Agents Chemother. 2010, 54, 4401−4408. (29) Mann, K. Identification of the major proteins of the organic matrix of emu (Dromaius novaehollandiae) and rhea (Rhea americana) eggshell calcified layer. Br. Poult. Sci. 2004, 45, 483−490. (30) Wellman-Labadie, O.; Lakshminarayanan, R.; Hincke, M. T. antimicrobial properties of avian eggshell-specific C-type lectin-like proteins. FEBS Lett. 2008, 582, 699−704.
5162
dx.doi.org/10.1021/jf5008117 | J. Agric. Food Chem. 2014, 62, 5156−5162
