Anal Bioanal Chem DOI 10.1007/s00216-015-8710-6
RESEARCH PAPER
Bioluminescent detection probe for tick-borne encephalitis virus immunoassay Ludmila P. Burakova 1 & Alexander N. Kudryavtsev 1 & Galina A. Stepanyuk 1 & Ivan K. Baykov 2 & Vera V. Morozova 2 & Nina V. Tikunova 2 & Maria A. Dubova 3 & Victor N. Lyapustin 4 & Valeri V. Yakimenko 5 & Ludmila A. Frank 1,3
Received: 9 February 2015 / Revised: 6 April 2015 / Accepted: 15 April 2015 # Springer-Verlag Berlin Heidelberg 2015
Abstract To facilitate the detection of the tick-borne encephalitis virus (TBEV), the causative agent of one of the most severe human neuroinfections, we have developed an immunoassay based on bioluminescent hybrid protein 14D5a-Rm7 as a detection probe. The protein containing Renilla luciferase as a reporter and a single-chain variable fragment (scFv) of murine immunoglobulin to TBEV as a recognition element was constructed, produced by bacterial expression, purified, and tested. Both domains were shown to reveal their specific biological properties—affinity to the target antigen and bioluminescent activity. Hybrid protein was applied as a label for solid-phase immunoassay of the antigens, associated with the tick-borne encephalitis virus (native glycoprotein E or extracts of the infected strain of lab ticks). The assay demonstrates high sensitivity (0.056 ng of glycoprotein E; 104–105 virus particles or 0.1 pg virions) and simplicity and is competitive with conventional methods for detection of TBEV.
Electronic supplementary material The online version of this article (doi:10.1007/s00216-015-8710-6) contains supplementary material, which is available to authorized users. * Ludmila A. Frank [email protected] 1
Institute of Biophysics, Siberian Branch, Russian Academy of Sciences, Krasnoyarsk 660036, Russia
2
Institute of Chemical Biology and Fundamental Medicine, Siberian Branch, Russian Academy of Sciences, Novosibirsk 630090, Russia
3
Siberian Federal University, Krasnoyarsk 660041, Russia
4
Institute of Poliomyelitis and Viral Encephalitides, Russian Academy of Sciences, Moscow 142782, Russia
5
Research Institute of Natural Foci Infections, Omsk 644080, Russia
Keywords Tick-borne encephalitis virus . Single-chain antibody . Luciferase . Immunoassay
Introduction The tick-borne encephalitis virus (TBEV) is the causative agent of one of the most severe human neuroinfections. This virus, belonging to the Flaviviridae family, is transmitted by Ixodidae ticks and is endemic in Russia, northern Kazakhstan, Mongolia, China, and many European countries [1–4]. The ecological specifications that determine the abundance of ticks require suitable climatic conditions, specific biotypes such as meadows and forests, and favorable density of host populations. Climate change and leisure habits expose more people to tick bites and have contributed to the increased number of cases [1, 5]. Thousands of cases of tick-borne encephalitis arise every year, with over half of them being recorded in Russia [4]. TBEV is transmitted from the saliva of infected ticks within minutes of the tick bite, but at the average, only 5– 10 % of ticks are TBEV-transmitting agents [1, 4]. Passive immunization with hyperimmune IgG against TBEV produced from plasma of immunized donors has been routinely used in Russia as post-exposure prophylaxis for persons bitten by ticks. However, administration of donor blood products is always accompanied by certain biological risks and often would not be recommended. Therefore, rapid and reliable virus detection methods can significantly decrease the inconveniences associated with the unreasonable immunoprophylaxis. At the initial stage of the disease before seroconversion, TBEV or TBEV RNA can be identified by reverse transcriptase polymerase chain reaction (RT-qPCR). By the time neurologic symptoms are recognized, the virus or viral RNA is usually not present in the blood [6]. TBEV–immunoglobulin
L.P. Burakova et al.
M (IgM) is detectable in serum during the second stage of the disease, and the most commonly used serodiagnostic method is the enzyme-linked immunosorbent assay (ELISA) that is based on either purified virions or recombinant surface TBEV proteins prM (precursor M) and E (envelope) proteins [7]. In spite of a number of colorimetric ELISA or real-time RT-PCRbased commercially available diagnostic kits to detect TBEV (e.g., in Russia, they are manufactured by Vector-Best and Microgen biotechnological companies), the development of new approaches for TBEV detection providing higher sensitivity and routine applicability is still under request. The aim of this study was to create a bioluminescent detection probe based on the luciferase Renilla muelleri and a single-chain variable fragment (scFv) of murine immunoglobulin to TBEV for a highly sensitive, simple, and fast TBEV immunoassay. Bifunctional protein with both luminescent activity of Renilla luciferase and TBEV-binding ability of scFv was constructed, produced in Escherichia coli, purified, tested, and applied as a label in TBEV bioluminescent immunoassay.
Materials and methods Materials Coelenterazine was obtained from PJK GmbH (Kleinblittersdorf, Germany). Recombinant protein E of TBEV [8], native glycoprotein E of TBEV [9], and murine monoclonal antibody 14D5 [10] were developed earlier. TBEV strain 13120 (Siberian subtype) and Dermacentor marginatus ticks laboratory strain 20-12 (TBEV free) were obtained from repositories at the Research Institute of Natural and Focal Infections (Omsk, Russia). All the experiments with live TBEV were conducted under BSL-3 conditions. TBEV-containing samples were prepared as follows: D. marginatus ticks were infected with a suspension of a viable virus by microinjections (0.2 μL/tick) of TBEV with the dose lgLD50 =1.5. The control group of ticks received an injection of phosphate-buffered saline (PBS) without virus particles. On the second day after infection, the presence of a TBEV in both groups of ticks was analyzed. Virus-free and infected ticks were separately pre-treated by washing with 70 % ethanol followed by sterile water. Each tick was frozen at −70 °C, ground, and suspended in 100 μL of PBS. Each suspension was analyzed by (1) bioluminescent immunoassay method, (2) colorimetric immunoassay using Enzyme Immunoassay kit D1154 (Vector-Best, Russia), and (3) RT-qPCR method for the presence of virus RNA, by using a BReal Best RNA TBEV kit^ (Vector-Best, Russia) according to the manufacturer’s protocol. All reagents of analytical grade or better were purchased from Sigma-Aldrich, unless otherwise stated.
Solid-phase immunoassay was carried out using 96-well opaque microtiter plates (Costar, USA). Modified R. muelleri luciferase (Rm7) of high purity was obtained according to the method described in [11]. Detailed information on Rm7 luciferase production and properties is presented in the Electronic Supplementary Material (ESM). Plasmid construction The coding sequence of the single-chain antibody sc14D5a gene was obtained by PCR synthesis, using plasmid pHEN2-14D5a, comprising VH and VL genes of mouse monoclonal antibody 14D5 [10, 12]. The forward primer with NdeI restriction site was 5′-CGCAACATATGGCCGAGGTG CAG-3′; the reverse primer was 5′-ATGGTGATGCTCGAGT GCGGCC-3. The coding part of the Rm7 gene was synthesized by PCR, with the plasmid pG1-Rm7 [13] used as a template. The forward primer with NotI restriction site was 5′-GAGCGCGG CCGCAGGTGGTTCTGGTGGTTCTGGTGGTTCTGGTG GCTCAGGTGGGTCAGGTGGCTCTACGTCAAAAGT TTACGATCCTG-3′; the reverse primer with EcoRI restriction site was 5′-CCCGGGAATTCTCAGTGGTG-3′. The obtained PCR fragments and oligonucleotide encoding (GGS)4 linker between them were inserted into pFLAG-CTS (NdeI/EcoRI) vector plasmid resulting in pFLAG-14D5aRm7 plasmid. The final construction was verified by DNA sequencing (SB RAS Genomics Core Facility, Novosibirsk, Russia). Hybrid protein production and purification The E. coli strain Rosetta-gami (Novagen, USA) was transformed with pFLAG-14D5a-Rm7 and cultivated with vigorous shaking in a Luria-Bertani (LB) medium containing 200 μg mL−1 ampicillin at 37 °C. When the culture reached an OD590 of 0.6–0.7, it was cooled down to 23 °C, induced with 0.5 mM isopropyl-β-D-thiogalactoside (IPTG). The induced culture was allowed to grow for an additional 20 h at 23 °C. Cells were harvested by centrifugation and resuspended in buffer A (5 mM imidazole, 0.3 M NaCl, 20 mM Tris– HCl pH 7.0), disrupted by sonication (20 s×6) on ice, and cleared by centrifugation. The supernatant was loaded on a HisTrapTM HP (GE Healthcare) column equilibrated with buffer A and extensively washed with the same buffer, and the hybrid protein was eluted with imidazole gradient (50– 150 mM). The fractions containing target protein were collected, concentrated, and purified with a Superdex 75 column (GE Healthcare), equilibrated with 0.5 mM EDTA and 25 mM NaCl in 20 mM Tris–HCl pH 7.0. The typical yield of the 14D5a-Rm7 protein of high purity was 2–3 mg per 1 L of cell culture using the LB medium.
Bioluminescent detection probe for tick-borne encephalitis virus immunoassay
The protein stability was investigated using purified protein (0.2 mg mL−1) by storing samples at (a) 6–8 °C in 20 mM Tris–HCl buffer pH 7.0 containing 0.5 mM EDTA and 25 mM NaCl and (b) −20 °C in 0.1 M PBS, pH 7.0 buffer containing 0.1 % bovine serum albumin. The protein aliquots were tested at intervals and mixed in a luminometer cuvette with 500 μL of 25 mM NaCl, 0.5 mM EDTA, and 50 mM Tris–HCl, pH 7.0, and then the bioluminescence reaction was initiated by rapid injection of 10 μL coelenterazine (0.2 mM in ethanol). All measurements were performed in triplicate. The protein affinity was measured with protein E solid-phase immunoassay. Bioluminescence measurements The 10 μL freshly prepared coelenterazine solution of different concentrations (from 1.32 to 760 μМ; ethanol) was injected rapidly into the cuvette containing 500 μL of Rm7 or 14D5a-Rm7 solution (13.2 nМ each, in 50 mM Tris–HCl pH 7.0, 25 mM NaCl, 0.5 mM EDTA), and the bioluminescent signal was measured immediately using a BLM 8802 photometer (SDTB Nauka, Krasnoyarsk, Russia). Measurements were conducted at 20 °C maintained with the temperature-stabilized cuvette block of the photometer. All measurements were performed in triplicate. Dose–response curve for 14D5a-Rm7 The surface of microtiter plate wells was coated by recombinant protein E (1 μg mL−1 in PBS, 100 μL per well) or with 100 μL of PBS (control) overnight at 8 °C, then washed (three times; PBS, 0.1 % Tween 20, 5 mM EDTA) and blocked with 2 % fat-free milk solution in 10 mM EDTA for 1 h at 37 °C. After washing, the twofold serial 14D5a-Rm7 dilutions in PBS with concentration ranging from 418 to 0.16 nM were placed into the wells, incubated for 1 h at room temperature, and then washed. The bioluminescence was measured immediately after rapid injection of freshly prepared coelenterazine solution (100 μL per well, 5×10−6 M, in PBS) with a plate luminometer LB 940 Multimode Reader Mithras (Berthold, Germany). The light was integrated for 10 s. Signals from the corresponding control wells were taken as the background and subtracted during dose–response curve plotting. All measurements were performed in triplicate. The affinity constant was calculated according to the following equation described in [14]: sffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 1 1 2 xþRþ xþRþ − −4xR k k B¼ 2R where В=L/Lmax is the ratio of the peak light intensity from a sample (L) to the peak light intensity from the samples with
the saturated concentrations of 14D5a-Rm7 (Lmax); R is the surface concentration of recombinant protein E; x is the concentration of 14D5a-Rm7 in solutions, placed into the wells; and k is the affinity constant. Parameters were calculated by non-linear regression using SigmaPlot 2000 software. Bioluminescent immunoassay of antigens associated with TBEV (native glycoprotein E or infected tick extracts) The surface of microtiter wells was activated with a solution of murine monoclonal antibody 14D5 (100 μL per well, 5 μg mL−1, in PBS, overnight at 8 °C), then washed and blocked with 2 % fat-free milk solution in 10 mM EDTA for 1 h at 37 °C. Then, 100-μL solutions of glycoprotein E of different concentrations (from 0.004 to 1 ng mL−1 in PBS) and 100 μL PBS (C−, control sample) were placed into the wells, incubated for 1 h at room temperature, and washed. In the case of tick analyses, 100 μL of infected and virus-free (control) tick extracts (tenfold dilutions in PBS) was placed into the wells, incubated for 1 h at room temperature, and washed. The solution of 14D5a-Rm7 (1 μg mL−1 in PBS, 100 μL) was placed into the wells and incubated for 1 h at room temperature. After washing, the bioluminescence of immobilized 14D5a-Rm7 was measured as described above. The experiments were carried out in triplicate. Colorimetric immunoassay of native glycoprotein E was carried out using Vector-Best Enzyme Immunoassay kit D1154 (Vector-Best, Russia) according to the manufacturer’s protocol.
Results and discussion At present, the light-emitting enzymes—luciferases and photoproteins—are being extensively employed as highly sensitive and simple reporters in binding assay (ELISA type, DNA hybridization, etc.); see, e.g., [15]. DNA cloning and recombinant protein techniques have made their analogs available and accelerated the development of bioluminescence-based analytical techniques used not only in scientific investigations but in clinical laboratories as well. Some of the bioluminescent assays have been approaching the attomolar detection limit, being fast, simple, and safe at the same time. R. muelleri luciferase [16], a highly sensitive bioluminescent reporter, potentially suitable to detect the trace amounts of TBEV, was used in our research. This enzyme is a relatively small single-chain polypeptide catalyzing substrate (coelenterazine) oxidation with the emission of blue light. The Rm7, a mutated variant of Renilla luciferase with several amino acid replacements providing improved protein thermostability, was used in this study.
L.P. Burakova et al.
Fig. 1 a Log–log plots of Rm7 (circles) and 14D5a-Rm7 (triangles) bioluminescence signals vs coelenterazine concentration. The protein concentration is 13.2 nМ in both experiments. Each point is the average of the initial (maximal) bioluminescence intensity±standard deviation,
n=3. b A Lineweaver–Burk plot of Rm7 (circles) and 14D5a-Rm7 (triangles). c Rm7 (solid line) and 14D5a-Rm7 (dashed line) bioluminescence. Coelenterazine concentration is 4 μM (300-fold molar excess) in both cases. r.l.u. relative light units
Detailed information on Rm7 luciferase properties is presented in the ESM. In order to develop a bioluminescent probe to TBEV, luciferase Rm7 was genetically fused with a single-chain antibody sc14D5a at the C-terminus. The designed hybrid protein contains variable domains of murine monoclonal antibody with a high affinity to TBEV envelope glycoprotein E (Ka −8.5× 107 M−1) [17]; modified luciferase Rm7, connected through a flexible (GGS)4 fragment; and a C-terminus poly-His-tag (see ESM Fig. S1a). To produce the target hybrid protein, the E. coli Rosettagami strain was selected as the expression host due to its enhanced disulfide bond formation in the cytoplasm. As estimated by SDS-PAGE analysis of the whole-cell lysate (see ESM Fig. S1b), the expressed target fusion protein comprised approximately 0.5 % of the total cellular protein and majority of the protein was accumulated in cytoplasm. The metalaffinity chromatography yielded a purity of 40 %, and a further gel filtration on a Superdex 75 column increased the protein purity to approximately 87 % (Fig. S1b). The typical yield of the protein was 2–3 mg per 1 L cell culture using the LB medium. Catalytic properties of the luciferase domain were firstly investigated. Figure 1a presents the concentration dependence of the bioluminescence intensity maximum when the hybrid 14D5a-Rm7 or luciferase Rm7 is assayed with coelenterazine. The bioluminescent intensity of Bfree^ luciferase is three to four times higher than that of the fused protein within a dynamic range of substrate concentrations, i.e., from 6 to 200 nM. Figure 1b shows the Lineweaver– Burk plots using the initial maximum bioluminescence intensity as a measure of the luciferase velocity, V. From these plots, the apparent Michaelis–Menten constants (Km)
of the fusion protein and luciferase Rm7 have been determined as 0.91 and 3.98 μM, respectively, whereas the maximal rates (Vmax) were calculated as 5.8×102 and 8.5×103 r.l.u., correspondingly. To characterize the efficiency of Bfree^ and Bfused^ luciferases, we estimated the turnover numbers (kcat=Vmax/[E], where [E] is a luciferase concentration) and the rate constants (kcat/Km) with the assumption that the total emitted light is proportional to the formed product, coelenteramide, and so we use the terms Bapparent kcat^ and Bapparent rate constant.^ The apparent kcat for Rm7 was 643 and 44 s−1 for 14D5a-Rm7, indicating that free luciferase turns over approximately 14 times faster. The apparent rate constants, which characterize the efficiency of an enzyme, were 161 and 49 μM−1 s−1 for Rm7 and 14D5a-Rm7, respectively; in other words, the luciferase oxidizes coelenterazine approximately three times more effectively than the fusion protein. However, each luminescent reaction results in a specific quantum yield and the number of moles of the oxidized product (coelenteramide, in our case) will always exceed the number of photons of the emitted light.
Fig. 2 Dose–response curve for 14D5a-Rm7. r.l.u. relative light units
Bioluminescent detection probe for tick-borne encephalitis virus immunoassay Fig. 3 Left panel, bioluminescence sandwich-type immunoassay of TBEV glycoprotein E. r.l.u. relative light units. Right panel, colorimetric immunoassay of TBEV glycoprotein E. OD450 sample optical density at wavelength 450 nm. C− negative control, a sample without protein E. Each point is the average±standard deviation, n=3
Figure 1c shows that the total light calculated as an integral of the area under the curve is approximately three times higher in the case of free Rm7. This difference is consistent with the ratio obtained from a comparison of the apparent rate constants. We also can assume that the quantum yield of free luciferase bioluminescent reaction is approximately three times higher than that of the fusion protein. It is possible that the complex formed by coelenterazine and luciferase in the hybrid protein, elongated from both N- and C-ends, could be more exposed to the solvent than the complex of coelenterazine with Rm7 luciferase. As a result, the greater part of the reaction energy can be dissipated as heat, leading to the lower quantum yield. It is also possible that the addition of the N-terminal antibody domain to the luciferase sequence creates the unfavorable conformational changes in the luciferase active site that results in decreased catalytic activity. The affinity of the single-chain antibody domain to protein E was previously determined using noncompetitive enzyme solid-phase immunoassay [18]. Hybrid protein was titrated on the recombinant protein E absorbed on the well surface and revealed by bioluminescent signal at coelenterazine injection (Fig. 2). The affinity constant was calculated according to the method described elsewhere [14] and equaled 2.65×107 M−1, which is close to the value of unmodified recombinant sc14D5a—1.6× 107 M−1 [18]. Therefore, E. coli strain Rosetta-gami provides the properly folded single-chain antibody domain during the synthesis in cytoplasm. Thus, both domains composing the hybrid protein demonstrated specific functional properties—the binding ability of sc14D5a and the bioluminescent activity of Renilla luciferase. To demonstrate its analytical potential, a bioluminescent sandwich-type immunoassay of the native glycoprotein E of TBEV was carried out using the 14D5a-Rm7 protein as a bioluminescent probe. Glycoprotein E is a TBEV surface
envelope protein that plays a key role in the virus penetration into the host cells. For comparison, glycoprotein E colorimetric immunoassay based on a peroxidase label was also carried out using a commercially available kit (Vector-Best, Russia). The bioluminescent reporter signal depends on the protein E concentration linearly in the range of 0.015–1 ng (R2 =0.997) (Fig. 3, left panel). Using the dependence as a calibration curve, the assay sensitivity was estimated as 0.056 ng of protein E (calculated from three replicates of C− sample as mean+2 standard deviations). It is almost five times higher than the sensitivity of commercial colorimetric immunoassay—0.25 ng (Fig. 3, right panel). The hybrid protein is stable during freezing and under storage in solution at 8 °C: loss of bioluminescent activity did not exceed 15 % over a period of 4 months. The demonstrated model experiments show that 14D5a-Rm7 hybrid protein is a highly sensitive detection probe applicable for bioluminescent immunoassay. Of the most interest and importance were the experiments on detecting TBEV in ticks for the reason that this kind of test
Fig. 4 Immunoassay of extracts of TBEV-infected and non-infected (C−) ticks. Numbers above the columns show the virus load measured as the log of TBEV RNA copies in the corresponding samples, detected by the RT-qPCR technique. r.l.u. relative light units, nd no positive signal detected. Each column is the average±standard deviation, n=3
L.P. Burakova et al.
is routinely performed in clinical diagnostic laboratories to avoid unnecessary immunoprophylaxis. In our study, extracts of five TBEV-infected ticks were analyzed by bioluminescent immunoassay, colorimetric immunoassay, and RT-qPCR method. Three non-infected ticks were used as a negative control. Colorimetric immunoassay did not detect the virus in both infected and control ticks. Bioluminescent immunoassay and RT-qPCR assay revealed the virus in all five infected ticks and showed a negative result in control samples (Fig. 4). According to the RT-qPCR data, the developed bioluminescent immunoassay allowed the detection of almost 104–105 virus particles or about 0.1 pg virions. At the same time, bioluminescent immunoassay is a much simpler, cheaper, and faster method—the bioluminescent signal during the test is integrated during 10 s only. Highthroughput microplate format provides simultaneous analysis from 8 (one stripe) up to 96 samples (standard-format plate). Eukaryotic proteins produced in bacteria do not carry posttranslation modifications, are often misfolded, and lack specific biological activity. This is a major problem facing the production of novel hybrid proteins. One of the ways to overcome the problem of heterologous protein expression is to explore the other expression systems, such as yeast, baculovirus, or mammalian cell cultures. For example, Burbelo and coauthors described the production of a variety of hybrid proteins Bantigen–RLuc^ (where Bantigen^ is tumor- or infection-associated proteins, BRLuc^—Renilla reniformis recombinant luciferase) in mammalian COS cells, with their following application as highly sensitive bioluminescent probes in immunoassay [19]. This approach is successfully applied to biomedical investigations but is expensive and complex for routine usage. In this study, we have successfully produced bifunctional hybrid protein consisting of a single-chain antibody 14D5a and Renilla luciferase domains from a bacterial expression system. The use of the E. coli Rosetta-gami strain has yielded soluble protein with a proper folding: both domains revealed their adherent properties—affinity to the target antigen and bioluminescent activity. Immunoassay based on the hybrid protein as a probe demonstrated high sensitivity to TBEV: its detection capacity is close to that of the RT-qPCR method but much simpler and faster. However, a series of analyses of TBEV in wild ticks is necessary to prove the practical applicability and significance of our method. Currently, by changing the bio-specific domains (antibodies), we see a great potential to apply this technique for generating novel bioluminescent probes to various targets of interest.
References 1. 2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14. Acknowledgments The work was supported by the Russian Academy of Sciences, Siberian Branch, within the framework of the Interdisciplinary Integration Project No. 139 and the State budget allocated to the fundamental research at the Russian Academy of Sciences (project No. VI 57.1.1).
15.
Lindquist L, Vapalahti O (2008) Tick-borne encephalitis. Lancet 371:1861–1871 Suss J (2011) Tick-borne encephalitis 2010: epidemiology, risk areas, and virus strains in Europe and Asia—an overview. Ticks Tick Borne Dis 2(1):2–15 Jaaskelainen AE, Sironen T, Murueva GB, Subbotina N, Alekseev AN, Castre J, Alitalo I, Vaheri A, Vapalahti O (2010) Tick-borne encephalitis virus in ticks in Finland, Russian Karelia and Buryatia. J Gen Virol 91:2706–2712 Tkachev SE, Rar VA et al (2011) Epidemiology, prophylaxis and diagnostics of transmissive tick-borne infections. In: V.V.Vlassov (ed) Infections transmitted by ticks in the Siberian region. Published by SB RAN, Novosibirsk, in Russian Jaenson TG, Hjertqvist M, Bergström T, Lundkvist A (2012) Why is tick-borne encephalitis increasing? A review of the key factors causing the increasing incidence of human TBE in Sweden. Parasit Vectors 5:184–197 Puchhammer-Stockl E, Kunz C, Mandl CW, Heinz FX (1995) Identification of tick-borne encephalitis virus ribonucleic acid in tick suspensions and in clinical specimens by a reverse transcription-nested polymerase chain reaction assay. Clin Diagn Virol 4(4):321–326 Jaaskelainen A, Han X, Niedrig M, Vaheri A, Vapalahti O (2003) Diagnosis of tick-borne encephalitis by a mu-capture immunoglobulin M-enzyme immunoassay based on secreted recombinant antigen produced in insect cells. J Clin Microbiol 41(9):4336–4342 Netesova NA, Belavin PA, Malygin EG, Rukavishnikov MYu (1999) Recombinant plasmid pGSDEI, encoding protein E of tick-borne encephalitis virus and strain Escherichia coli—producer of recombinant protein E of tick-borne encephalitis virus. Patent of Russian Federation No 2136754 Liapustin VN, Karganova GG, Sobolev SG, Gritsun TS (1988) Preparative separation of the antigenic structures of the tick-borne encephalitis virus by electrophoresis in a liquid medium. Vopr Virusol 33(1):98–102 (in Russian) Tsekhanovskaya NA, Matveev LE, Rubin SG, Karavanov AS, Pressman EK (1993) Epitope analysis of tick-borne encephalitis (TBE) complex viruses using monoclonal antibodies to envelope glycoprotein of TBE virus (persulcatus subtype). Virus Res 30(1): 1–16 Stepanyuk GA, Unch J, Malikova NP, Markova SV, Lee J, Vysotski ES (2010) Coelenterazine-v ligated to Ca 2 + -triggered coelenterazine-binding protein is a stable and efficient substrate of the red-shifted mutant of Renilla muelleri luciferase. Anal Bioanal Chem 398:1809–1817 Baykov IK, Matveev LE, Matveev AL, Tikunova NV (2012) Comparative analysis of variable domains of monoclonal antibodies against tick-born encephalitis virus. Sibirskij Medicinskij Zurnal 111(4):30–33 (in Russian) Frank LA, Tikunova NV, Burakova LP, Tyumentseva MA, Kudryavtsev AN, Morozova VV (2014) Recombinant plasmid pG1-Rm7, encoding genes of the human single-chain antibody binding necrosis tumor factor and modified Renilla muelleri luciferase in one frame; hybrid protein Bsingle-chain antibody–Renilla muelleri luciferase (G1-Rm7)^. Patent of Russian Federation, No 2513686 Beatty JD, Beatty BG, Vlahos WG (1987) Measurement of monoclonal antibody affinity by non-competitive enzyme immunoassay. J Immunol Methods 100:173–179 Frank LA, Krasitskaya VV (2014) Application of enzyme bioluminescence for medical diagnostics. Adv Biochem Eng Biotechnol 144:175–197
Bioluminescent detection probe for tick-borne encephalitis virus immunoassay 16.
17.
Titushin MS, Markova SV, Frank LA, Malikova NP, Stepanyuk GA, Lee J, Vysotski ES (2008) Coelenterazine-binding protein of Renilla muelleri: cDNA cloning, overexpression, and characterization as a substrate of luciferase. Photochem Photobiol Sci 7:189– 196 Baykov IK, Matveev AL, Stronin OV, Ryzhikov AB, Matveev LE, Kasakin MF, Richter VA, Tikunova NV (2014) A protective chimeric antibody to tick-borne encephalitis. Vaccine 32:3589–3594
18.
19.
Baykov IK, Levanov LN, Matveev LE, Tikunova NV (2009) Development of the single-chain antibodies against tick-borne encephalitis virus. Proceedings of the conference BGenomics and proteomics in medicine^, 9-13th of September, Novosibirsk, Russia, p 98 Burbelo PD, Lebovitz EE, Notkins AL (2014) Luciferase immunoprecipitation systems for measuring antibodies in autoimmune and infectious diseases. Transl Res. doi:10.1016/j.trsl.2014.08.006
RESEARCH PAPER
Bioluminescent detection probe for tick-borne encephalitis virus immunoassay Ludmila P. Burakova 1 & Alexander N. Kudryavtsev 1 & Galina A. Stepanyuk 1 & Ivan K. Baykov 2 & Vera V. Morozova 2 & Nina V. Tikunova 2 & Maria A. Dubova 3 & Victor N. Lyapustin 4 & Valeri V. Yakimenko 5 & Ludmila A. Frank 1,3
Received: 9 February 2015 / Revised: 6 April 2015 / Accepted: 15 April 2015 # Springer-Verlag Berlin Heidelberg 2015
Abstract To facilitate the detection of the tick-borne encephalitis virus (TBEV), the causative agent of one of the most severe human neuroinfections, we have developed an immunoassay based on bioluminescent hybrid protein 14D5a-Rm7 as a detection probe. The protein containing Renilla luciferase as a reporter and a single-chain variable fragment (scFv) of murine immunoglobulin to TBEV as a recognition element was constructed, produced by bacterial expression, purified, and tested. Both domains were shown to reveal their specific biological properties—affinity to the target antigen and bioluminescent activity. Hybrid protein was applied as a label for solid-phase immunoassay of the antigens, associated with the tick-borne encephalitis virus (native glycoprotein E or extracts of the infected strain of lab ticks). The assay demonstrates high sensitivity (0.056 ng of glycoprotein E; 104–105 virus particles or 0.1 pg virions) and simplicity and is competitive with conventional methods for detection of TBEV.
Electronic supplementary material The online version of this article (doi:10.1007/s00216-015-8710-6) contains supplementary material, which is available to authorized users. * Ludmila A. Frank [email protected] 1
Institute of Biophysics, Siberian Branch, Russian Academy of Sciences, Krasnoyarsk 660036, Russia
2
Institute of Chemical Biology and Fundamental Medicine, Siberian Branch, Russian Academy of Sciences, Novosibirsk 630090, Russia
3
Siberian Federal University, Krasnoyarsk 660041, Russia
4
Institute of Poliomyelitis and Viral Encephalitides, Russian Academy of Sciences, Moscow 142782, Russia
5
Research Institute of Natural Foci Infections, Omsk 644080, Russia
Keywords Tick-borne encephalitis virus . Single-chain antibody . Luciferase . Immunoassay
Introduction The tick-borne encephalitis virus (TBEV) is the causative agent of one of the most severe human neuroinfections. This virus, belonging to the Flaviviridae family, is transmitted by Ixodidae ticks and is endemic in Russia, northern Kazakhstan, Mongolia, China, and many European countries [1–4]. The ecological specifications that determine the abundance of ticks require suitable climatic conditions, specific biotypes such as meadows and forests, and favorable density of host populations. Climate change and leisure habits expose more people to tick bites and have contributed to the increased number of cases [1, 5]. Thousands of cases of tick-borne encephalitis arise every year, with over half of them being recorded in Russia [4]. TBEV is transmitted from the saliva of infected ticks within minutes of the tick bite, but at the average, only 5– 10 % of ticks are TBEV-transmitting agents [1, 4]. Passive immunization with hyperimmune IgG against TBEV produced from plasma of immunized donors has been routinely used in Russia as post-exposure prophylaxis for persons bitten by ticks. However, administration of donor blood products is always accompanied by certain biological risks and often would not be recommended. Therefore, rapid and reliable virus detection methods can significantly decrease the inconveniences associated with the unreasonable immunoprophylaxis. At the initial stage of the disease before seroconversion, TBEV or TBEV RNA can be identified by reverse transcriptase polymerase chain reaction (RT-qPCR). By the time neurologic symptoms are recognized, the virus or viral RNA is usually not present in the blood [6]. TBEV–immunoglobulin
L.P. Burakova et al.
M (IgM) is detectable in serum during the second stage of the disease, and the most commonly used serodiagnostic method is the enzyme-linked immunosorbent assay (ELISA) that is based on either purified virions or recombinant surface TBEV proteins prM (precursor M) and E (envelope) proteins [7]. In spite of a number of colorimetric ELISA or real-time RT-PCRbased commercially available diagnostic kits to detect TBEV (e.g., in Russia, they are manufactured by Vector-Best and Microgen biotechnological companies), the development of new approaches for TBEV detection providing higher sensitivity and routine applicability is still under request. The aim of this study was to create a bioluminescent detection probe based on the luciferase Renilla muelleri and a single-chain variable fragment (scFv) of murine immunoglobulin to TBEV for a highly sensitive, simple, and fast TBEV immunoassay. Bifunctional protein with both luminescent activity of Renilla luciferase and TBEV-binding ability of scFv was constructed, produced in Escherichia coli, purified, tested, and applied as a label in TBEV bioluminescent immunoassay.
Materials and methods Materials Coelenterazine was obtained from PJK GmbH (Kleinblittersdorf, Germany). Recombinant protein E of TBEV [8], native glycoprotein E of TBEV [9], and murine monoclonal antibody 14D5 [10] were developed earlier. TBEV strain 13120 (Siberian subtype) and Dermacentor marginatus ticks laboratory strain 20-12 (TBEV free) were obtained from repositories at the Research Institute of Natural and Focal Infections (Omsk, Russia). All the experiments with live TBEV were conducted under BSL-3 conditions. TBEV-containing samples were prepared as follows: D. marginatus ticks were infected with a suspension of a viable virus by microinjections (0.2 μL/tick) of TBEV with the dose lgLD50 =1.5. The control group of ticks received an injection of phosphate-buffered saline (PBS) without virus particles. On the second day after infection, the presence of a TBEV in both groups of ticks was analyzed. Virus-free and infected ticks were separately pre-treated by washing with 70 % ethanol followed by sterile water. Each tick was frozen at −70 °C, ground, and suspended in 100 μL of PBS. Each suspension was analyzed by (1) bioluminescent immunoassay method, (2) colorimetric immunoassay using Enzyme Immunoassay kit D1154 (Vector-Best, Russia), and (3) RT-qPCR method for the presence of virus RNA, by using a BReal Best RNA TBEV kit^ (Vector-Best, Russia) according to the manufacturer’s protocol. All reagents of analytical grade or better were purchased from Sigma-Aldrich, unless otherwise stated.
Solid-phase immunoassay was carried out using 96-well opaque microtiter plates (Costar, USA). Modified R. muelleri luciferase (Rm7) of high purity was obtained according to the method described in [11]. Detailed information on Rm7 luciferase production and properties is presented in the Electronic Supplementary Material (ESM). Plasmid construction The coding sequence of the single-chain antibody sc14D5a gene was obtained by PCR synthesis, using plasmid pHEN2-14D5a, comprising VH and VL genes of mouse monoclonal antibody 14D5 [10, 12]. The forward primer with NdeI restriction site was 5′-CGCAACATATGGCCGAGGTG CAG-3′; the reverse primer was 5′-ATGGTGATGCTCGAGT GCGGCC-3. The coding part of the Rm7 gene was synthesized by PCR, with the plasmid pG1-Rm7 [13] used as a template. The forward primer with NotI restriction site was 5′-GAGCGCGG CCGCAGGTGGTTCTGGTGGTTCTGGTGGTTCTGGTG GCTCAGGTGGGTCAGGTGGCTCTACGTCAAAAGT TTACGATCCTG-3′; the reverse primer with EcoRI restriction site was 5′-CCCGGGAATTCTCAGTGGTG-3′. The obtained PCR fragments and oligonucleotide encoding (GGS)4 linker between them were inserted into pFLAG-CTS (NdeI/EcoRI) vector plasmid resulting in pFLAG-14D5aRm7 plasmid. The final construction was verified by DNA sequencing (SB RAS Genomics Core Facility, Novosibirsk, Russia). Hybrid protein production and purification The E. coli strain Rosetta-gami (Novagen, USA) was transformed with pFLAG-14D5a-Rm7 and cultivated with vigorous shaking in a Luria-Bertani (LB) medium containing 200 μg mL−1 ampicillin at 37 °C. When the culture reached an OD590 of 0.6–0.7, it was cooled down to 23 °C, induced with 0.5 mM isopropyl-β-D-thiogalactoside (IPTG). The induced culture was allowed to grow for an additional 20 h at 23 °C. Cells were harvested by centrifugation and resuspended in buffer A (5 mM imidazole, 0.3 M NaCl, 20 mM Tris– HCl pH 7.0), disrupted by sonication (20 s×6) on ice, and cleared by centrifugation. The supernatant was loaded on a HisTrapTM HP (GE Healthcare) column equilibrated with buffer A and extensively washed with the same buffer, and the hybrid protein was eluted with imidazole gradient (50– 150 mM). The fractions containing target protein were collected, concentrated, and purified with a Superdex 75 column (GE Healthcare), equilibrated with 0.5 mM EDTA and 25 mM NaCl in 20 mM Tris–HCl pH 7.0. The typical yield of the 14D5a-Rm7 protein of high purity was 2–3 mg per 1 L of cell culture using the LB medium.
Bioluminescent detection probe for tick-borne encephalitis virus immunoassay
The protein stability was investigated using purified protein (0.2 mg mL−1) by storing samples at (a) 6–8 °C in 20 mM Tris–HCl buffer pH 7.0 containing 0.5 mM EDTA and 25 mM NaCl and (b) −20 °C in 0.1 M PBS, pH 7.0 buffer containing 0.1 % bovine serum albumin. The protein aliquots were tested at intervals and mixed in a luminometer cuvette with 500 μL of 25 mM NaCl, 0.5 mM EDTA, and 50 mM Tris–HCl, pH 7.0, and then the bioluminescence reaction was initiated by rapid injection of 10 μL coelenterazine (0.2 mM in ethanol). All measurements were performed in triplicate. The protein affinity was measured with protein E solid-phase immunoassay. Bioluminescence measurements The 10 μL freshly prepared coelenterazine solution of different concentrations (from 1.32 to 760 μМ; ethanol) was injected rapidly into the cuvette containing 500 μL of Rm7 or 14D5a-Rm7 solution (13.2 nМ each, in 50 mM Tris–HCl pH 7.0, 25 mM NaCl, 0.5 mM EDTA), and the bioluminescent signal was measured immediately using a BLM 8802 photometer (SDTB Nauka, Krasnoyarsk, Russia). Measurements were conducted at 20 °C maintained with the temperature-stabilized cuvette block of the photometer. All measurements were performed in triplicate. Dose–response curve for 14D5a-Rm7 The surface of microtiter plate wells was coated by recombinant protein E (1 μg mL−1 in PBS, 100 μL per well) or with 100 μL of PBS (control) overnight at 8 °C, then washed (three times; PBS, 0.1 % Tween 20, 5 mM EDTA) and blocked with 2 % fat-free milk solution in 10 mM EDTA for 1 h at 37 °C. After washing, the twofold serial 14D5a-Rm7 dilutions in PBS with concentration ranging from 418 to 0.16 nM were placed into the wells, incubated for 1 h at room temperature, and then washed. The bioluminescence was measured immediately after rapid injection of freshly prepared coelenterazine solution (100 μL per well, 5×10−6 M, in PBS) with a plate luminometer LB 940 Multimode Reader Mithras (Berthold, Germany). The light was integrated for 10 s. Signals from the corresponding control wells were taken as the background and subtracted during dose–response curve plotting. All measurements were performed in triplicate. The affinity constant was calculated according to the following equation described in [14]: sffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 1 1 2 xþRþ xþRþ − −4xR k k B¼ 2R where В=L/Lmax is the ratio of the peak light intensity from a sample (L) to the peak light intensity from the samples with
the saturated concentrations of 14D5a-Rm7 (Lmax); R is the surface concentration of recombinant protein E; x is the concentration of 14D5a-Rm7 in solutions, placed into the wells; and k is the affinity constant. Parameters were calculated by non-linear regression using SigmaPlot 2000 software. Bioluminescent immunoassay of antigens associated with TBEV (native glycoprotein E or infected tick extracts) The surface of microtiter wells was activated with a solution of murine monoclonal antibody 14D5 (100 μL per well, 5 μg mL−1, in PBS, overnight at 8 °C), then washed and blocked with 2 % fat-free milk solution in 10 mM EDTA for 1 h at 37 °C. Then, 100-μL solutions of glycoprotein E of different concentrations (from 0.004 to 1 ng mL−1 in PBS) and 100 μL PBS (C−, control sample) were placed into the wells, incubated for 1 h at room temperature, and washed. In the case of tick analyses, 100 μL of infected and virus-free (control) tick extracts (tenfold dilutions in PBS) was placed into the wells, incubated for 1 h at room temperature, and washed. The solution of 14D5a-Rm7 (1 μg mL−1 in PBS, 100 μL) was placed into the wells and incubated for 1 h at room temperature. After washing, the bioluminescence of immobilized 14D5a-Rm7 was measured as described above. The experiments were carried out in triplicate. Colorimetric immunoassay of native glycoprotein E was carried out using Vector-Best Enzyme Immunoassay kit D1154 (Vector-Best, Russia) according to the manufacturer’s protocol.
Results and discussion At present, the light-emitting enzymes—luciferases and photoproteins—are being extensively employed as highly sensitive and simple reporters in binding assay (ELISA type, DNA hybridization, etc.); see, e.g., [15]. DNA cloning and recombinant protein techniques have made their analogs available and accelerated the development of bioluminescence-based analytical techniques used not only in scientific investigations but in clinical laboratories as well. Some of the bioluminescent assays have been approaching the attomolar detection limit, being fast, simple, and safe at the same time. R. muelleri luciferase [16], a highly sensitive bioluminescent reporter, potentially suitable to detect the trace amounts of TBEV, was used in our research. This enzyme is a relatively small single-chain polypeptide catalyzing substrate (coelenterazine) oxidation with the emission of blue light. The Rm7, a mutated variant of Renilla luciferase with several amino acid replacements providing improved protein thermostability, was used in this study.
L.P. Burakova et al.
Fig. 1 a Log–log plots of Rm7 (circles) and 14D5a-Rm7 (triangles) bioluminescence signals vs coelenterazine concentration. The protein concentration is 13.2 nМ in both experiments. Each point is the average of the initial (maximal) bioluminescence intensity±standard deviation,
n=3. b A Lineweaver–Burk plot of Rm7 (circles) and 14D5a-Rm7 (triangles). c Rm7 (solid line) and 14D5a-Rm7 (dashed line) bioluminescence. Coelenterazine concentration is 4 μM (300-fold molar excess) in both cases. r.l.u. relative light units
Detailed information on Rm7 luciferase properties is presented in the ESM. In order to develop a bioluminescent probe to TBEV, luciferase Rm7 was genetically fused with a single-chain antibody sc14D5a at the C-terminus. The designed hybrid protein contains variable domains of murine monoclonal antibody with a high affinity to TBEV envelope glycoprotein E (Ka −8.5× 107 M−1) [17]; modified luciferase Rm7, connected through a flexible (GGS)4 fragment; and a C-terminus poly-His-tag (see ESM Fig. S1a). To produce the target hybrid protein, the E. coli Rosettagami strain was selected as the expression host due to its enhanced disulfide bond formation in the cytoplasm. As estimated by SDS-PAGE analysis of the whole-cell lysate (see ESM Fig. S1b), the expressed target fusion protein comprised approximately 0.5 % of the total cellular protein and majority of the protein was accumulated in cytoplasm. The metalaffinity chromatography yielded a purity of 40 %, and a further gel filtration on a Superdex 75 column increased the protein purity to approximately 87 % (Fig. S1b). The typical yield of the protein was 2–3 mg per 1 L cell culture using the LB medium. Catalytic properties of the luciferase domain were firstly investigated. Figure 1a presents the concentration dependence of the bioluminescence intensity maximum when the hybrid 14D5a-Rm7 or luciferase Rm7 is assayed with coelenterazine. The bioluminescent intensity of Bfree^ luciferase is three to four times higher than that of the fused protein within a dynamic range of substrate concentrations, i.e., from 6 to 200 nM. Figure 1b shows the Lineweaver– Burk plots using the initial maximum bioluminescence intensity as a measure of the luciferase velocity, V. From these plots, the apparent Michaelis–Menten constants (Km)
of the fusion protein and luciferase Rm7 have been determined as 0.91 and 3.98 μM, respectively, whereas the maximal rates (Vmax) were calculated as 5.8×102 and 8.5×103 r.l.u., correspondingly. To characterize the efficiency of Bfree^ and Bfused^ luciferases, we estimated the turnover numbers (kcat=Vmax/[E], where [E] is a luciferase concentration) and the rate constants (kcat/Km) with the assumption that the total emitted light is proportional to the formed product, coelenteramide, and so we use the terms Bapparent kcat^ and Bapparent rate constant.^ The apparent kcat for Rm7 was 643 and 44 s−1 for 14D5a-Rm7, indicating that free luciferase turns over approximately 14 times faster. The apparent rate constants, which characterize the efficiency of an enzyme, were 161 and 49 μM−1 s−1 for Rm7 and 14D5a-Rm7, respectively; in other words, the luciferase oxidizes coelenterazine approximately three times more effectively than the fusion protein. However, each luminescent reaction results in a specific quantum yield and the number of moles of the oxidized product (coelenteramide, in our case) will always exceed the number of photons of the emitted light.
Fig. 2 Dose–response curve for 14D5a-Rm7. r.l.u. relative light units
Bioluminescent detection probe for tick-borne encephalitis virus immunoassay Fig. 3 Left panel, bioluminescence sandwich-type immunoassay of TBEV glycoprotein E. r.l.u. relative light units. Right panel, colorimetric immunoassay of TBEV glycoprotein E. OD450 sample optical density at wavelength 450 nm. C− negative control, a sample without protein E. Each point is the average±standard deviation, n=3
Figure 1c shows that the total light calculated as an integral of the area under the curve is approximately three times higher in the case of free Rm7. This difference is consistent with the ratio obtained from a comparison of the apparent rate constants. We also can assume that the quantum yield of free luciferase bioluminescent reaction is approximately three times higher than that of the fusion protein. It is possible that the complex formed by coelenterazine and luciferase in the hybrid protein, elongated from both N- and C-ends, could be more exposed to the solvent than the complex of coelenterazine with Rm7 luciferase. As a result, the greater part of the reaction energy can be dissipated as heat, leading to the lower quantum yield. It is also possible that the addition of the N-terminal antibody domain to the luciferase sequence creates the unfavorable conformational changes in the luciferase active site that results in decreased catalytic activity. The affinity of the single-chain antibody domain to protein E was previously determined using noncompetitive enzyme solid-phase immunoassay [18]. Hybrid protein was titrated on the recombinant protein E absorbed on the well surface and revealed by bioluminescent signal at coelenterazine injection (Fig. 2). The affinity constant was calculated according to the method described elsewhere [14] and equaled 2.65×107 M−1, which is close to the value of unmodified recombinant sc14D5a—1.6× 107 M−1 [18]. Therefore, E. coli strain Rosetta-gami provides the properly folded single-chain antibody domain during the synthesis in cytoplasm. Thus, both domains composing the hybrid protein demonstrated specific functional properties—the binding ability of sc14D5a and the bioluminescent activity of Renilla luciferase. To demonstrate its analytical potential, a bioluminescent sandwich-type immunoassay of the native glycoprotein E of TBEV was carried out using the 14D5a-Rm7 protein as a bioluminescent probe. Glycoprotein E is a TBEV surface
envelope protein that plays a key role in the virus penetration into the host cells. For comparison, glycoprotein E colorimetric immunoassay based on a peroxidase label was also carried out using a commercially available kit (Vector-Best, Russia). The bioluminescent reporter signal depends on the protein E concentration linearly in the range of 0.015–1 ng (R2 =0.997) (Fig. 3, left panel). Using the dependence as a calibration curve, the assay sensitivity was estimated as 0.056 ng of protein E (calculated from three replicates of C− sample as mean+2 standard deviations). It is almost five times higher than the sensitivity of commercial colorimetric immunoassay—0.25 ng (Fig. 3, right panel). The hybrid protein is stable during freezing and under storage in solution at 8 °C: loss of bioluminescent activity did not exceed 15 % over a period of 4 months. The demonstrated model experiments show that 14D5a-Rm7 hybrid protein is a highly sensitive detection probe applicable for bioluminescent immunoassay. Of the most interest and importance were the experiments on detecting TBEV in ticks for the reason that this kind of test
Fig. 4 Immunoassay of extracts of TBEV-infected and non-infected (C−) ticks. Numbers above the columns show the virus load measured as the log of TBEV RNA copies in the corresponding samples, detected by the RT-qPCR technique. r.l.u. relative light units, nd no positive signal detected. Each column is the average±standard deviation, n=3
L.P. Burakova et al.
is routinely performed in clinical diagnostic laboratories to avoid unnecessary immunoprophylaxis. In our study, extracts of five TBEV-infected ticks were analyzed by bioluminescent immunoassay, colorimetric immunoassay, and RT-qPCR method. Three non-infected ticks were used as a negative control. Colorimetric immunoassay did not detect the virus in both infected and control ticks. Bioluminescent immunoassay and RT-qPCR assay revealed the virus in all five infected ticks and showed a negative result in control samples (Fig. 4). According to the RT-qPCR data, the developed bioluminescent immunoassay allowed the detection of almost 104–105 virus particles or about 0.1 pg virions. At the same time, bioluminescent immunoassay is a much simpler, cheaper, and faster method—the bioluminescent signal during the test is integrated during 10 s only. Highthroughput microplate format provides simultaneous analysis from 8 (one stripe) up to 96 samples (standard-format plate). Eukaryotic proteins produced in bacteria do not carry posttranslation modifications, are often misfolded, and lack specific biological activity. This is a major problem facing the production of novel hybrid proteins. One of the ways to overcome the problem of heterologous protein expression is to explore the other expression systems, such as yeast, baculovirus, or mammalian cell cultures. For example, Burbelo and coauthors described the production of a variety of hybrid proteins Bantigen–RLuc^ (where Bantigen^ is tumor- or infection-associated proteins, BRLuc^—Renilla reniformis recombinant luciferase) in mammalian COS cells, with their following application as highly sensitive bioluminescent probes in immunoassay [19]. This approach is successfully applied to biomedical investigations but is expensive and complex for routine usage. In this study, we have successfully produced bifunctional hybrid protein consisting of a single-chain antibody 14D5a and Renilla luciferase domains from a bacterial expression system. The use of the E. coli Rosetta-gami strain has yielded soluble protein with a proper folding: both domains revealed their adherent properties—affinity to the target antigen and bioluminescent activity. Immunoassay based on the hybrid protein as a probe demonstrated high sensitivity to TBEV: its detection capacity is close to that of the RT-qPCR method but much simpler and faster. However, a series of analyses of TBEV in wild ticks is necessary to prove the practical applicability and significance of our method. Currently, by changing the bio-specific domains (antibodies), we see a great potential to apply this technique for generating novel bioluminescent probes to various targets of interest.
References 1. 2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14. Acknowledgments The work was supported by the Russian Academy of Sciences, Siberian Branch, within the framework of the Interdisciplinary Integration Project No. 139 and the State budget allocated to the fundamental research at the Russian Academy of Sciences (project No. VI 57.1.1).
15.
Lindquist L, Vapalahti O (2008) Tick-borne encephalitis. Lancet 371:1861–1871 Suss J (2011) Tick-borne encephalitis 2010: epidemiology, risk areas, and virus strains in Europe and Asia—an overview. Ticks Tick Borne Dis 2(1):2–15 Jaaskelainen AE, Sironen T, Murueva GB, Subbotina N, Alekseev AN, Castre J, Alitalo I, Vaheri A, Vapalahti O (2010) Tick-borne encephalitis virus in ticks in Finland, Russian Karelia and Buryatia. J Gen Virol 91:2706–2712 Tkachev SE, Rar VA et al (2011) Epidemiology, prophylaxis and diagnostics of transmissive tick-borne infections. In: V.V.Vlassov (ed) Infections transmitted by ticks in the Siberian region. Published by SB RAN, Novosibirsk, in Russian Jaenson TG, Hjertqvist M, Bergström T, Lundkvist A (2012) Why is tick-borne encephalitis increasing? A review of the key factors causing the increasing incidence of human TBE in Sweden. Parasit Vectors 5:184–197 Puchhammer-Stockl E, Kunz C, Mandl CW, Heinz FX (1995) Identification of tick-borne encephalitis virus ribonucleic acid in tick suspensions and in clinical specimens by a reverse transcription-nested polymerase chain reaction assay. Clin Diagn Virol 4(4):321–326 Jaaskelainen A, Han X, Niedrig M, Vaheri A, Vapalahti O (2003) Diagnosis of tick-borne encephalitis by a mu-capture immunoglobulin M-enzyme immunoassay based on secreted recombinant antigen produced in insect cells. J Clin Microbiol 41(9):4336–4342 Netesova NA, Belavin PA, Malygin EG, Rukavishnikov MYu (1999) Recombinant plasmid pGSDEI, encoding protein E of tick-borne encephalitis virus and strain Escherichia coli—producer of recombinant protein E of tick-borne encephalitis virus. Patent of Russian Federation No 2136754 Liapustin VN, Karganova GG, Sobolev SG, Gritsun TS (1988) Preparative separation of the antigenic structures of the tick-borne encephalitis virus by electrophoresis in a liquid medium. Vopr Virusol 33(1):98–102 (in Russian) Tsekhanovskaya NA, Matveev LE, Rubin SG, Karavanov AS, Pressman EK (1993) Epitope analysis of tick-borne encephalitis (TBE) complex viruses using monoclonal antibodies to envelope glycoprotein of TBE virus (persulcatus subtype). Virus Res 30(1): 1–16 Stepanyuk GA, Unch J, Malikova NP, Markova SV, Lee J, Vysotski ES (2010) Coelenterazine-v ligated to Ca 2 + -triggered coelenterazine-binding protein is a stable and efficient substrate of the red-shifted mutant of Renilla muelleri luciferase. Anal Bioanal Chem 398:1809–1817 Baykov IK, Matveev LE, Matveev AL, Tikunova NV (2012) Comparative analysis of variable domains of monoclonal antibodies against tick-born encephalitis virus. Sibirskij Medicinskij Zurnal 111(4):30–33 (in Russian) Frank LA, Tikunova NV, Burakova LP, Tyumentseva MA, Kudryavtsev AN, Morozova VV (2014) Recombinant plasmid pG1-Rm7, encoding genes of the human single-chain antibody binding necrosis tumor factor and modified Renilla muelleri luciferase in one frame; hybrid protein Bsingle-chain antibody–Renilla muelleri luciferase (G1-Rm7)^. Patent of Russian Federation, No 2513686 Beatty JD, Beatty BG, Vlahos WG (1987) Measurement of monoclonal antibody affinity by non-competitive enzyme immunoassay. J Immunol Methods 100:173–179 Frank LA, Krasitskaya VV (2014) Application of enzyme bioluminescence for medical diagnostics. Adv Biochem Eng Biotechnol 144:175–197
Bioluminescent detection probe for tick-borne encephalitis virus immunoassay 16.
17.
Titushin MS, Markova SV, Frank LA, Malikova NP, Stepanyuk GA, Lee J, Vysotski ES (2008) Coelenterazine-binding protein of Renilla muelleri: cDNA cloning, overexpression, and characterization as a substrate of luciferase. Photochem Photobiol Sci 7:189– 196 Baykov IK, Matveev AL, Stronin OV, Ryzhikov AB, Matveev LE, Kasakin MF, Richter VA, Tikunova NV (2014) A protective chimeric antibody to tick-borne encephalitis. Vaccine 32:3589–3594
18.
19.
Baykov IK, Levanov LN, Matveev LE, Tikunova NV (2009) Development of the single-chain antibodies against tick-borne encephalitis virus. Proceedings of the conference BGenomics and proteomics in medicine^, 9-13th of September, Novosibirsk, Russia, p 98 Burbelo PD, Lebovitz EE, Notkins AL (2014) Luciferase immunoprecipitation systems for measuring antibodies in autoimmune and infectious diseases. Transl Res. doi:10.1016/j.trsl.2014.08.006
