Bioresource Technology 161 (2014) 200–207
Contents lists available at ScienceDirect
Bioresource Technology journal homepage: www.elsevier.com/locate/biortech
Biomass production and nutrients removal by a new microalgae strain Desmodesmus sp. in anaerobic digestion wastewater Fang Ji a,e, Ying Liu b,e, Rui Hao c, Gang Li d,e, Yuguang Zhou a,e,⇑, Renjie Dong a,e a
College of Engineering/Biomass Engineering Center, China Agricultural University, PR China College of Agriculture and Biotechnology, China Agricultural University, PR China c College of Food Science and Nutritional Engineering, China Agricultural University, PR China d College of Water Resources and Civil Engineering, China Agricultural University, PR China e Key Laboratory of Clean Production and Utilization of Renewable Energy, Ministry of Agriculture, PR China b
h i g h l i g h t s
g r a p h i c a l a b s t r a c t
A new strain of algae was isolated
from fresh water. This novel strain was identified as
Desmodesmus sp. by 18s rRNA and ITS1 analysis. This strain could grow in anaerobic digestion wastewater (ADW). Maximum nutrients removal was observed at 10.0% ADW. This strain could remove 100% NH4– N, TP and PO4–P, and 75.50% TN at 10.0% ADW.
a r t i c l e
i n f o
Article history: Received 9 January 2014 Received in revised form 27 February 2014 Accepted 4 March 2014 Available online 18 March 2014 Keywords: Desmodesmus sp. Anaerobic digestion wastewater (ADW) Nutrient removal Biomass production
a b s t r a c t Anaerobic digestion wastewater (ADW), which contains large amount of nitrogen and phosphorus, particularly high concentration of ammonium, might lead to severely environmental pollution. A new unicellular green microalgae species from a wetland at the Olympic Forest Park, Beijing, China was screened based on its growth rates and nutrients removal capability under ADW. Results of 18s rDNA and ITS1 analysis indicated that this strain have a close relationship with Desmodesmus sp., named as EJ9-6. Desmodesmus sp. EJ9-6 could remove 100% NH4–N (68.691 mg/L), TP (4.565 mg/L) and PO4–P (4.053 mg/L), and 75.50% TN (84.236 mg/L) at 10.0% ADW, which the highest biomass production was 0.412 g/L after 14 d cultivation. Maximum nutrients removal was observed at 10.0% ADW with daily removal rates of TN, NH4–N, TP and PO4–P at 4.542, 5.284, 0.326 and 0.290 mg/L/d, respectively. Ó 2014 Elsevier Ltd. All rights reserved.
1. Introduction With the rapid increasing of globally energy demands and fossil fuel crisis, more attention has been paid on the production of the substitute energy sources (Pittman et al., 2011). Microalgae,
⇑ Corresponding author at: PO Box 50, No. 17 Qinghua Donglu, Haidian District, Beijing 100083, PR China. Tel.: +86 10 6273 7858; fax: +86 10 6273 7885. E-mail address: [email protected] (Y. Zhou).
http://dx.doi.org/10.1016/j.biortech.2014.03.034 0960-8524/Ó 2014 Elsevier Ltd. All rights reserved.
especially unicellular eukaryotic algae have higher oil production yield than that of the best oilseed crops in terms of land area that required for cultivation (Brennan and Owende, 2010; Stephens et al., 2010). Therefore, energy from microalgae could be a potential bioenergy in future (Wijffels and Barbosa, 2010). However, the formidable cost for microalgae biofuel production has constrained on the development in industrialized production (Hu et al., 2012). A large quantity of water is consumed during microalgae cultivation, which occupies 10–20% of the total cost of algae production (Subhadra, 2011; Sander and Murthy, 2010). Hence,
201
F. Ji et al. / Bioresource Technology 161 (2014) 200–207
combining algae biomass production with organic wastewater treatment can mitigate costs in algae-oriented biofuel industry. Anaerobic digestion is an efficient approach for waste treatment where organic materials are converted into biogas (methane), with the production of clean energy. At the same time, this process also produces digestate (Morken et al., 2013). Biogas digested effluent is a new type of green fertilizer with comprehensive nutrients, which can promote the growth of crops. However, without sufficient treatment, that wastewater might create severely environmental pollution (Salminen et al., 2001). Therefore, the integration of anaerobic digestion wastewater (ADW) treatment and algae biomass production could be one of viable ways to reduce the risk of nitrogen and phosphorus pollutions from anaerobic digestion. Many studies have focussed on nutrient removal form municipal wastewater, agricultural wastewater and Industrial wastewater by microalgae (Wang and Lan, 2011; Senthil et al., 2010; Wu et al., 2012), whereas, it is less reported for the cultivation of microalgae in ADW (Table 1) because the process of digestion would consume a large of organic nutrients and produce high concentration of ammonium (Cai et al., 2013b). Only a few species of microalgae has been found and can grow in ADW (e.g. Chlorella sp. and Scenedesmus sp.). It is necessary to isolate potential microalgae species in order to investigate the coupling of advanced ADW treatment and biomass production. This work studies the potential of a new species of microalgae isolated from wild in order to promote biomass production, which is context of the removal of nitrogen and phosphorus from ADW.
microalgae Desmodesmus sp. EJ9-6 was selected based on its growth rates and nutrients removal capability under ADW. Desmodesmus sp. EJ9-6 was purified by serial dilutions and plate streaking in 1.5% agar Blue–Green (BG-11) medium (Rippka et al., 1979) containing following components (per liter) 1500 mg NaNO3, 40 mg K2HPO4, 75 mg MgSO47H2O, 36 mg CaCl22H2O, 6 mg citric acid, 6 mg ferric ammonium citrate, 1 mg EDTANa2, 20 mg Na2CO3, 2.86 mg H3BO3, 1.86 mg MnCl24H2O, 0.22 mg ZnSO47H2O, 0.39 mg Na2MoO42H2O, 0.08 mg CuSO45H2O, and 0.05 mg Co(NO3)26H2O. The pH value of medium was titrated to 7.0 with 1 mol/L HCl. The plates were incubated for 2–3 weeks and after the colony formation, isolated single colonies were picked up. The microalgae seed were cultivated in 50 mL autoclaved BG-11 medium in 100 mL Erlenmeyer flasks. Individual colonies were inoculated into medium within a forced ventilation clean bench (SW-CJ-2FD, Suzhou Antai Airtech, China). The flasks were then incubated in a growth chamber at 24 ± 1 °C under light intensity of 120 ± 2 lmol/(m2 s)1 by fluorescent lights and light/dark cycles (L:D) of 15:9 h for 14 d. Periodic agitations were performed for three times each day. 2.2. Amplification and sequencing of 18S rDNA and ITS1 Although rRNA genes are present in high copy numbers and the sensitivity of their detection on many dramatically increased by use of PCR, internal transcribed spacer (ITS) regions are divergent and distinctive (Turenne et al., 1999). Polymeric Chain Reaction (PCR) primers for 18S rDNA and ITS1 (Table 2) were synthesized by the Sangon Biotech (Shanghai) Co., Ltd., China. The DNA of microalgae was extracted using the NuClean PlantGen DNA kit (Beijing ComWin Biotech Co., Ltd., China) according to the manufacturer’s instructions. The 18S rDNA PCR reaction mixture contained 1 lL of DNA template, 1 lL of each primer, 4 lL of dNTP, 10 lL of 5 Q5 buffer,
2. Methods 2.1. Species sampling and microalgae pre-cultures Desmodesmus sp. EJ9-6 was isolated in August 2011 from the Olympic Forest Park (40°70 2900 N, 116°2300 3300 E), Beijing, China. In this study, totally 20 strains of microalgae were isolated and green
Table 1 Comparison of major nutrient removal rates by microalgae cultivation in various ADW conditions. Wastewater category
Gas source
Microalgae species
Cultivation period (d)
Initial nutrient (mg/L)
Nutrient removal (mg/L/d)
Dry cell weight (g/L/d)
References
Digested dairy manure (20 dilution)
CO2
Chlorella sp.
21
NH4–N = 89.1 TKNa = 172.8 TP = 12.485
4.24b 6.44c 0.20d
0.0814e
Wang et al. (2010)
Anaerobically digested dairy manure (50 dilution)
2–3% CO2
Neochloris oleoabundans
16
NH4–N = 42
6.48f
0.0883
Levine et al. (2011)
Scenedesmus accuminatus
10
NH4–N = 120
5.20
0.0458
Park et al. (2010)
Anaerobic digestion effluent from piggery farm (10 dilution)
a b c d e f g h i j k m
Biogas effluent from an anaerobic digester (6 dilution)
Biogas
Chlorella sp.
6
TN = 59.57 TP = 6.21
8.33g 0.83h
0.1026i
Yan and Zheng (2013)
Anaerobically digested cattle slurry and whey (20 dilution)
CO2
Chlorella vulgaris
21
NH4–N = 81.7 PO4–P = 3.65
5.2 0.19
0.25
Franchino et al. (2013)
Anaerobic digestion effluent
3% air
Synechocystis sp.
10
TN = 80 NH4–N = 68 TP = 11.43
8.0j 6.8k 1.143m
0.1509
Cai et al. (2013a)
Total Kjeldahl nitrogen (TKN). Estimated from 100% removal of NH4–N after 21 d. Estimated from 78.3% removal of TKN after 21 d. Estimated from 34.3% removal of TP after 21 d. Estimated from biomass production of 1.71 g/L after 21 d. Estimated from 90% to 95% removal of initial N after 6 d. Estimated from 83.94% removal of TN after 6 d. Estimated from 80.43% removal of TP after 6 d. Estimated from biomass production of 615.84 mg/L after 6 d. Estimated from 100% removal of TN after 10 d. Estimated from 100% removal of NH4–N after 10 d. Estimated from 100% removal of TP after 10 d.
202
F. Ji et al. / Bioresource Technology 161 (2014) 200–207
Table 2 PCR primers used in this study. Primers
Target a
18S rDNA FW
18S0 rDNA RV ITS1 FWb ITS2 RVb a b
a
18S 18S ITS1 ITS1
Table 3 Physicochemical characteristics of ADW.
Sequence 0
5 30 50 50 50
AAGTATAAACTGCTTATACTGTGAA 0
CCTACGGAAACCTTGTTACGACT 3 AGTCGTAACAAGGTTTCCGTAGG 30 TATGCTTAAGTTCAGCGGGTAAT 30
Direction
Parameter
Unit
Concentration
Forward
pH COD TN NH4–N NO3–N NO2–N TP PO4–P
– mg/L mg/L mg/L mg/L mg/L mg/L mg/L
9.18 6900 ± 53 928.46 ± 4.64 824.55 ± 4.20 84.46 ± 2.86 N.D.a 45.72 ± 0.55 39.68 ± 0.37
Reverse Forward Reverse
Designed by DNAMAN (USA) and Primer 5.0 (Canada). Ji et al. (2013). a
0.5 lL of Q5 DNA Polymerase (New England Biolabs, USA) and 10 lL of 5 Q5 High GC Enhancer in a volume of 50 lL. PCR thermal program included an initial pre-heating denaturation at 98 °C for 60 s, followed by 37 cycles of denaturation at 98 °C for 20 s, annealing at 58 °C for 30 s and extension at 72 °C for 45 s, and a final 180 s extension at 72 °C with a thermal cycler (Biometra TGRADIENT, Germany). The ITS1 PCR thermal program was also the same as the above except temperature of primer annealing at 52 °C. PCR products were sequenced by the Life Technologies Corporation (China). Comparisons for similar sequences were carried out using the BLAST Program (NCBI BLAST, USA). 2.3. ADW collection The ADW employed in this study, was collected from Beilangzhong pig farm biogas plant, Beijing, China. The ADW sample was immediately filtered using 1.2 lm glass microfiber filters (Whatman Inc., USA) to remove large particles and microorganisms, then stored at 4 °C to avoid variation of wastewater composition. 2.4. Experimental procedures
Where: Ri is the removal efficiency of substrate i (TN, NH4–N, TP, or PO4–P); Si0 is the initial concentration of i; and Sit is the final concentration of i after t days cultivation. The rate of nutrient removal was calculated according to Eq. (2):
ri ¼ ðSi0 Sit Þ=ðt i t0 Þ
ð2Þ
Where: ri (g/L/d) is the removal rate of substrate i (TN, NH4–N, TP, or PO4–P); Si0 is the initial concentration of i; and Sit is the final concentration of i at time t. 2.6. Determination of microalgae growth Microalgae production was determined by measuring the optical density of samples at 680 nm (OD680) using a spectrophotometer (UV-7504PC, Xinmao Instrument, Shanghai, China) as an indicator of cell density. Biomass concentration was evaluated using the method of dry cell weight (DCW; Ho et al., 2010). The DCW showed a linear relationship with OD680, as follows:
y ¼ 0:2706x 0:0178ðR2 ¼ 0:991; P < 0:05Þ
ð3Þ
Where: y (g/L) is the DCW; x is the absorbance at 680 nm.
Batch experiments were performed after microalgae strain was cultivated in 5.0% ADW for one month to obtain stable characteristics. Three levels of ADW concentration were chosen, 2.5%, 5.0% and 10.0% ADW allowed by the initial concentration used. The other conditions were prepared as mentioned in Section 2.1 and biomass concentration was controlled at around OD 0.1 after inoculation. The other flasks filled with same concentration ADW without algae addition were set up for control experiments. All the experiments were carried out in three replicates. 2.5. Nutrients analysis For physicochemical analysis of ADW, the solution pH was measured with a pH meter (Orion-3 STAR, Orion Corporation, USA). Samples were filtered using a 0.45 lm glass microfiber filters (Whatman, USA). Then the filtrates were appropriately diluted and analyzed chemical oxygen demand (COD) according to the Hach DR 2700 Spectrophotometer Manual (Hach Company, USA; Hach, 2008). Total nitrogen (TN) and total phosphorus (TP) were determined colorimetrically as nitrate and phosphate after the samples had been oxidized. Ammonia nitrogen (NH4–N) and phosphate (PO4–P) were measured following the UV/Vis-spectrophotometric method (National Standard Method of China; Wei et al., 2002). The amounts of nitrite nitrogen (NO2–N) and nitrate nitrogen (NO3–N) were determined with a flow injection analyzer (AA3, Seal Analytical, Ltd., UK). The physicochemical characteristics of the ADW are presented in Table 3. Nutrient removal efficiencies were calculated using in Eq. (1):
Ri ¼ ðSi0 Sit Þ=Si0
N.D., Not detected.
ð1Þ
3. Results and discussion 3.1. Isolation and identification of microalgae The cells of Desmodesmus sp. EJ9-6 are few in number, varying from two to four, and united into a frond by a hyaline matrix. The cell was ellipse in shape, smooth surface and cell size is approximately 5.0–7.0 lm in length, and 2.0–4.0 lm in width under optical microscope (Fig. 1). The 18S rRNA gene sequence amplified from this strain is 1097 bp in length with no heterogeneity while the ITS1 was 600 bp, and showed similarities with other known sequences from green algae based on the BLAST results, ranging in homology from 99% with Desmodesmus sp. Mary 6/3 T-2d and Desmodesmus sp. Tow 10/11 T-2W (Johnson et al., 2007). The phylogenetic analysis indicated that this strain have a close relationship with Desmodesmus sp., named EJ9-6 (Fig. 1). 3.2. ADW nutrients removal by algae growth As shown in Table 3, the ADW contains relatively high levels of TN, especially NH4–N while NO3–N, NO2–N and PO4–P are very low. Generally, a proper NH4–N concentration was reported as 20 mg/L for microalgae growth (Azov and Goldman, 1982). The ADW needs to be diluted first due to toxic effect of high concentration ammonium on microalgae growth (Chen et al., 2011; Peccia et al., 2013). The removal of nitrogen (TN and NH4–N) and phosphorus (TP and PO4–P) from ADW by Desmodesmus sp. EJ9-6 cultivation as a function of incubation time are shown in Figs. 2 and 3, respectively.
F. Ji et al. / Bioresource Technology 161 (2014) 200–207
203
Fig. 1. Phylogenetic tree of Desmodesmus sp. EJ9-6 based on partial ITS1 sequences (MEGA5.10) and morphological graph under optical microscope.
Nitrogen is an important nutrient during the process of microalgae growth. Since nitrogen can be utilized as nitrate, nitrite or ammonium, the production of microalgae biomass response varied with different sources and amounts (Costa et al., 2001). In this study, nitrogen removal analysis carried out only for TN and NH4–N, because of low NO3–N concentration in the diluted ADW (2.5–8 ppm). The ADW concentration higher than 10.0% were not tested, since high NH4–N concentrations (12.0% AWD, the content of NH4–N was approximately 100 mg/L) were apparently toxic to Desmodesmus sp., which microalgae was completely bleached after three days. The results of NH4–N and TN removal by Desmodesmus sp. EJ9-6 cultured in different concentrations of ADW are shown in Fig. 2a and b, respectively. For all conditions, nearly all NH4–N was removed within 9, 13 and 13 d for 2.5%, 5.0% and 10.0% ADW cultivation, respectively. The tendency for TN removal in all concen-
trations was similar to that for NH4–N removal in this study. Comparing to the condition that all the TN had been removed with 2.5% ADW, 87.71% and 75.50% of TN were accordingly removed from the 5.0% and 10.0% ADW when the tests came to an end, respectively. Similar results were also observed by Hu et al. (2012) who cultured Chlorella sp. in liquid swine manure, indicating that there were still some organic compounds that could not be converted to ammonium and assimilated by microalgae. Phosphorus is found in nucleic acids, lipids, proteins, and the intermediates of carbohydrate metabolism and is also an essential macro-nutrient for microalgae growth. Fig. 3a and b shows the removal of PO4–P and TP contaminants form diluted ADW. It was observed that the concentrations of PO4–P and TP decreased dramatically due to their fast assimilation by Desmodesmus sp. EJ9-6 in the first three days, the removal rate of PO4–P could
204
F. Ji et al. / Bioresource Technology 161 (2014) 200–207
(a)
90.000 80.000 2.5% control
NH4-N (mg/L)
70.000
2.5%
60.000
5.0% control
50.000
5.0% 10.0% control
40.000
10.0%
30.000 20.000 10.000 0.000
0
1
2
3
4
5
6
7
8
9 10 11 12 13 14 15
Days (d)
(b)
90.000 80.000 2.5% control
TN (mg/L)
70.000
2.5%
60.000
5.0% control
50.000
5.0% 10.0% control
40.000
10.0%
30.000 20.000 10.000 0.000
0
1
2
3
4
5
6
7
8
9 10 11 12 13 14 15
Days (d) Fig. 2. Nitrogen evolution during the culturing period: (a) trends of NH4–N in the different concentrations of ADW; (b) trends of TN in different ADW concentrations.
almost totally removed in the 2.5% and 5.0% ADW for four days while 51.24% in 10.0% ADW. The significant reduction of PO4–P was also reported by Franchino et al. (2013) who achieved around 94% PO4–P reduction when treating agro-zootechnical digestate with algae starting. Fig. 3b illustrates that the removal pattern of the TP was similar to the removal pattern of PO4–P in diluted ADW. After 14 days, the TP content was reduced from 0.940, 2.503 and 4.565 mg/L (control) to zero in 2.5%, 5.0% and 10.0% ADW, respectively. It should be noted that phosphorus removal in wastewater is not only utilized by algae cell, but also by external conditions such as pH and dissolved oxygen (DO) (Cai et al., 2013b). In general, pH increased approximately from 9 to 10 during Desmodesmus sp. EJ96 growth in diluted ADW. Thus, phosphate will precipitate from ADW as a result of elevated pH and high DO concentration. Although the proportion of abiotic precipitation is hard to quantify, it did not affect the efficiency of result that the algae uptake is still the main mechanism of phosphorus removal (Su et al., 2012). The Desmodesmus sp. EJ9-6 biomass production and nutrients removal performance in different concentrations ADW were investigated (Table 4). TN and TP daily removal rate rose as the ADW
concentration increased. Maximum nutrients removal was observed at 10.0% ADW with TN, and TP daily removal rate of 14.759 and 1.123 mg/L/d while the average daily was 4.542 and 0.326 mg/L/d, respectively. The initial N/P ratio did not only affect microalgae growth, but also directly affected the removal capacities of nitrogen and phosphorus. According to this study, the concentration of ammonia is high while the initial N/P ratio is approximate 20:1. Kim et al. (2013) reported that, the proper N/P ratio depending on the nitrogen source would be 16:1 for ammonia in advanced wastewater treatment; and it was expected that a proper N/P ratio would increase microalgae growth and removal rates of nitrogen and phosphorus. 3.3. Microalgae biomass production The growth characteristics of Desmodesmus sp. EJ9-6 under different concentration ADW were investigated (as shown in Fig. 4). Compared with the serial dilutions, microalgae grew faster in 2.5% ADW during the first seven days, after then, the growth started to level off due to earlier exhaustion of less amount of
205
F. Ji et al. / Bioresource Technology 161 (2014) 200–207
(a)
6.000 5.000
2.5% control
PO4-P (mg/L)
2.5% 4.000
5.0% control 5.0%
3.000
10.0% control 10.0%
2.000 1.000 0.000
0
1
2
3
4
5
6
7
8
9 10 11 12 13 14 15
Days (d)
(b)
6.000 5.000
2.5% control 2.5%
TP (mg/L)
4.000
5.0% control 5.0%
3.000
10.0% control 10.0%
2.000 1.000 0.000
0
1
2
3
4
5
6
7
8
9 10 11 12 13 14 15
Days (d) Fig. 3. Phosphorus evolution during the culturing period: (a) trends of PO4–P in the different concentrations of ADW; (b) trends of TP in the different concentrations of ADW.
Table 4 Microalgae biomass productivities and nutrients removal performance in different ADW concentrations Table 1. ADW concentrations (%)
2.5 5.0 10.0 a b
Assimilation days (d)
a
Average daily removal rate (mg/L/d)
Maximum daily removal rate (mg/L/d)
TN
NH4–N
TP
PO4–P
TN
NH4–N
TP
PO4–P
TN
NH4–N
TP
PO4–P
12 14 14
9 13 13
4 8 14
4 8 14
1.671 2.916 4.542
2.257 3.371 5.284
0.235 0.313 0.326
0.214 0.300 0.290
3.585 8.877 14.759
3.914 7.212 12.827
0.423 1.487 1.123
0.395 1.460 0.843
Biomass production (g/L/d)
b
0.019 0.025 0.029
The number of days when the residue nutrients in culture decreased to a undetectable or became constant. The biomass production is the average daily productivity when cultivated 14 d.
nitrogen and phosphorus. In the contrast, microalgae in 5.0% and 10.0% growth started slower and picked up in the latter part of cultivation period. A similar result was reported for Cholrella sp. cultivation by Wang et al. (2010). After the first 7 d cultivation, average dry biomasses of 0.210 ± 0.007, 0.157 ± 0.007 and 0.120 ± 0.001 g/L were found in 2.5%, 5.0% and 10.0% ADW conditions, as cultivated time goes on, after 14 d, the dry biomass increased to 0.272 ± 0.006, 0.351 ± 0.011 and 0.412 ± 0.005 g/L, respectively. It
can be observed from Table 4 that 10.0% ADW is better than other two concentrations when cultivated time increased, the maximum biomass production was 0.029 g DCW/L/d after 14 d. However, the microalgae biomass was not high compared to the biomass levels (0.025–0.7 g/L) commonly reported in other wastewater cultivation (Pittman et al., 2011). This result might be attributed to the high NH4–N and low PO4–P concentration in ADW (Wang et al., 2008).
206
F. Ji et al. / Bioresource Technology 161 (2014) 200–207
0.500 0.450 0.400
Biomass (g/L)
0.350 0.300 0.250 0.200 0.150
2.5% 5.0% 10.0%
0.100 0.050 0.000 0
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
Days (d) Fig. 4. Dry biomass of Desmodesmus sp. EJ9-6 cultivated in different concentrations of ADW for 14 d.
4. Conclusion A new unicellular green microalgae species, Desmodesmus sp. EJ9-6, was isolated and identified from fresh water. It was trained for ADW treatment and biomass productivity. Desmodesmus sp. EJ9-6 is in capable of completely depleting nitrogen and phosphorus form ADW containing high concentration of NH4–N. Maximum nutrients removal was observed at 10.0% ADW with TN, NH4–N, TP and PO4–P daily removal rate of 4.542, 5.284, 0.326 and 0.290 mg/ L/d, respectively, which the highest biomass production was 0.412 g/L after 14 d cultivation. Acknowledgements This investigation was financially supported by The Chinese National Advanced Technology Development Program (Grant No. 2013AA065802), The Chinese National ‘‘Twelfth Five-Year’’ Plan for Science & Technology Supporting Project (Grant No. 2012BAD47B03), The China Scholarship Council Fund, The Chinese Universities Scientific Fund (Grant No. 2013YJ007), and Beijing Municipal Key Discipline of Biomass Engineering. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.biortech.2014. 03.034. References Azov, Y., Goldman, J.C., 1982. Free ammonia inhibition of algal photosynthesis in intensive cultures. Appl. Environ. Microbiol. 43 (4), 735–739. Brennan, L., Owende, P., 2010. Biofuels from microalgae—a review of technologies for production, processing, and extractions of biofuels and co-products. Renew. Sust. Energ. Rev. 14 (2), 557–577. Cai, T., Ge, X., Park, S.Y., Li, Y., 2013a. Comparison of Synechocystis sp. PCC6803 and Nannochloropsis salina for lipid production using artificial seawater and nutrients from anaerobic digestion effluent. Bioresour. Technol. 144, 255–260. Cai, T., Park, S.Y., Li, Y., 2013b. Nutrient recovery from wastewater streams by microalgae: status and prospects. Renew. Sust. Energ. Rev. 19, 360–369. Chen, M., Tang, H., Ma, H., Holland, T.C., Simon Ng, K.Y., Salley, S.O., 2011. Effect of nutrients on growth and lipid accumulation in the green algae Dunaliella tertiolecta. Bioresour. Technol. 102 (2), 1649–1655.
Costa, J.A.V., Cozza, K.L., Oliveira, L., Magagnin, G., 2001. Different nitrogen sources and growth responses of Spirulina platensis in microenvironments. World J. Microbiol. Biotechnol. 17 (5), 439–442. Franchino, M., Comino, E., Bona, F., Riggio, V.A., 2013. Growth of three microalgae strains and nutrient removal from an agro-zootechnical digestate. Chemosphere 92 (6), 738–744. Hach, 2008. Procedure Manual. Hach, Loveland, CO, USA. Ho, S.H., Chen, C.Y., Yeh, K.L., Chen, W.M., Lin, C.Y., Chang, J.S., 2010. Characterization of photosynthetic carbon dioxide fixation ability of indigenous Scenedesmus obliquus isolates. Biochem. Eng. J. 53 (1), 57–62. Hu, B., Min, M., Zhou, W., Du, Z., Mohr, M., Chen, P., Zhu, J., Cheng, Y., Liu, Y., Ruan, R., 2012. Enhanced mixotrophic growth of microalga Chlorella sp. on pretreated swine manure for simultaneous biofuel feedstock production and nutrient removal. Bioresour. Technol. 126, 71–79. Ji, F., Hao, R., Liu, Y., Li, G., Zhou, Y., Dong, R., 2013. Isolation of a novel microalgae strain Desmodesmus sp. and optimization of environmental factors for its biomass production. Bioresour. Technol. 148, 249–254. Johnson, J.L., Fawley, M.W., Fawley, K.P., 2007. The diversity of Scenedesmus and Desmodesmus (Chlorophyceae) in Itasca State Park, Minnesota, USA. Phycologia 46 (2), 214–229. Kim, S., Lee, Y., Hwang, S.J., 2013. Removal of nitrogen and phosphorus by Chlorella sorokiniana cultured heterotrophically in ammonia and nitrate. Int. Biodeterior. Biodegrad. 85, 511–516. Levine, R.B., Costanza-Robinson, M.S., Spatafora, G.A., 2011. Neochloris oleoabundans grown on anaerobically digested dairy manure for concomitant nutrient removal and biodiesel feedstock production. Biomass Bioenerg. 35 (1), 40–49. Morken, J., Sapci, Z., Strømme, J.E.T., 2013. Modeling of biodiesel production in algae cultivation with anaerobic digestion (ACAD). Energ. Policy. 60, 98–105. Park, J., Jin, H.F., Lim, B.R., Park, K.Y., Lee, K., 2010. Ammonia removal from anaerobic digestion effluent of livestock waste using green alga Scenedesmus sp. Bioresour. Technol. 101 (22), 8649–8657. Peccia, J., Haznedaroglu, B., Gutierrez, J., Zimmerman, J.B., 2013. Nitrogen supply is an important driver of sustainable microalgae biofuel production. Trends Biotech. 31 (3), 134–138. Pittman, J.K., Dean, A.P., Osundeko, O., 2011. The potential of sustainable algal biofuel production using wastewater resources. Bioresour. Technol. 102 (1), 17–25. Rippka, R., Deruelles, J., Waterbury, J.B., Herdman, M., Stanier, R.Y., 1979. Generic assignments, strain histories and properties of pure cultures of Cyanobacteria. J. Gen. Microbiol. 111, 1–61. Salminen, E., Rintala, J., Härkönen, J., Kuitunen, M., Högmander, H., Oikari, A., 2001. Anaerobically digested poultry slaughterhouse wastes as fertiliser in agriculture. Bioresour. Technol. 78 (1), 81–88. Sander, K., Murthy, G.S., 2010. Life cycle analysis of algae biodiesel. Int. J. Life Cycle Assess. 15 (7), 704–714. Senthil, C., Ashish, B., Hunt, R.W., Das, K.C., 2010. Microalgae cultivation in a wastewater dominated by carpet mill effluents for biofuel applications. Bioresour. Technol. 101 (9), 3097–3105. Stephens, E., Ross, I.L., King, Z., Mussgnug, J.H., Kruse, O., Posten, C., Borowitzka, M.A., Hankamer, B., 2010. An economic and technical evaluation of microalgal biofuels. Nat. Biotechnol. 28, 126–128. Su, Y., Mennerich, A., Urban, B., 2012. Comparison of nutrient removal capacity and biomass settleability of four high-potential microalgal species. Bioresour. Technol. 124, 157–162.
F. Ji et al. / Bioresource Technology 161 (2014) 200–207 Subhadra, B.G., 2011. Water management policies for the algal biofuel sector in the Southwestern United States. Appl. Energ. 88 (10), 3492–3498. Turenne, C.Y., Sanche, S.E., Hoban, D.J., Karlowsky, J.A., Kabani, A.M., 1999. Rapid identification of fungi by using the ITS2 genetic region and an automated fluorescent capillary electrophoresis system. J. Clin. Microbiol. 37 (6), 1846–1851. Wang, B., Li, Y., Wu, N., Lan, C.Q., 2008. CO2 bio-mitigation using microalgae. Appl. Microbiol. Biotechnol. 79, 707–718. Wang, B., Lan, C.Q., 2011. Biomass production and nitrogen and phosphorus removal by the green alga Neochloris oleoabundans in simulated wastewater and secondary municipal wastewater effluent. Bioresour. Technol. 102 (10), 5639– 5644. Wang, L., Li, Y., Chen, P., Min, M., Chen, Y., Zhu, J., Ruan, R.R., 2010. Anaerobic digested dairy manure as a nutrient supplement for cultivation of oil-rich green microalgae Chlorella sp. Bioresour. Technol. 101 (8), 2623–2628.
207
Wei, F., Qi, W., Bi, T., Sun, Z., Huang, Y., Shen, Y., 2002. Water and Wastewater Monitoring and Analysis Method, fourth ed. China Environmental Science Press, Beijing. Wijffels, R.H., Barbosa, M.J., 2010. An outlook on microalgal biofuels. Science 329, 796–799. Wu, L.F., Chen, P.C., Huang, A.P., Lee, C.M., 2012. The feasibility of biodiesel production by microalgae using industrial wastewater. Bioresour. Technol. 113, 14–18. Yan, C., Zheng, Z., 2013. Performance of photoperiod and light intensity on biogas upgrade and biogas effluent nutrient reduction by the microalgae Chlorella sp. Bioresour. Technol. 139, 292–299.
Contents lists available at ScienceDirect
Bioresource Technology journal homepage: www.elsevier.com/locate/biortech
Biomass production and nutrients removal by a new microalgae strain Desmodesmus sp. in anaerobic digestion wastewater Fang Ji a,e, Ying Liu b,e, Rui Hao c, Gang Li d,e, Yuguang Zhou a,e,⇑, Renjie Dong a,e a
College of Engineering/Biomass Engineering Center, China Agricultural University, PR China College of Agriculture and Biotechnology, China Agricultural University, PR China c College of Food Science and Nutritional Engineering, China Agricultural University, PR China d College of Water Resources and Civil Engineering, China Agricultural University, PR China e Key Laboratory of Clean Production and Utilization of Renewable Energy, Ministry of Agriculture, PR China b
h i g h l i g h t s
g r a p h i c a l a b s t r a c t
A new strain of algae was isolated
from fresh water. This novel strain was identified as
Desmodesmus sp. by 18s rRNA and ITS1 analysis. This strain could grow in anaerobic digestion wastewater (ADW). Maximum nutrients removal was observed at 10.0% ADW. This strain could remove 100% NH4– N, TP and PO4–P, and 75.50% TN at 10.0% ADW.
a r t i c l e
i n f o
Article history: Received 9 January 2014 Received in revised form 27 February 2014 Accepted 4 March 2014 Available online 18 March 2014 Keywords: Desmodesmus sp. Anaerobic digestion wastewater (ADW) Nutrient removal Biomass production
a b s t r a c t Anaerobic digestion wastewater (ADW), which contains large amount of nitrogen and phosphorus, particularly high concentration of ammonium, might lead to severely environmental pollution. A new unicellular green microalgae species from a wetland at the Olympic Forest Park, Beijing, China was screened based on its growth rates and nutrients removal capability under ADW. Results of 18s rDNA and ITS1 analysis indicated that this strain have a close relationship with Desmodesmus sp., named as EJ9-6. Desmodesmus sp. EJ9-6 could remove 100% NH4–N (68.691 mg/L), TP (4.565 mg/L) and PO4–P (4.053 mg/L), and 75.50% TN (84.236 mg/L) at 10.0% ADW, which the highest biomass production was 0.412 g/L after 14 d cultivation. Maximum nutrients removal was observed at 10.0% ADW with daily removal rates of TN, NH4–N, TP and PO4–P at 4.542, 5.284, 0.326 and 0.290 mg/L/d, respectively. Ó 2014 Elsevier Ltd. All rights reserved.
1. Introduction With the rapid increasing of globally energy demands and fossil fuel crisis, more attention has been paid on the production of the substitute energy sources (Pittman et al., 2011). Microalgae,
⇑ Corresponding author at: PO Box 50, No. 17 Qinghua Donglu, Haidian District, Beijing 100083, PR China. Tel.: +86 10 6273 7858; fax: +86 10 6273 7885. E-mail address: [email protected] (Y. Zhou).
http://dx.doi.org/10.1016/j.biortech.2014.03.034 0960-8524/Ó 2014 Elsevier Ltd. All rights reserved.
especially unicellular eukaryotic algae have higher oil production yield than that of the best oilseed crops in terms of land area that required for cultivation (Brennan and Owende, 2010; Stephens et al., 2010). Therefore, energy from microalgae could be a potential bioenergy in future (Wijffels and Barbosa, 2010). However, the formidable cost for microalgae biofuel production has constrained on the development in industrialized production (Hu et al., 2012). A large quantity of water is consumed during microalgae cultivation, which occupies 10–20% of the total cost of algae production (Subhadra, 2011; Sander and Murthy, 2010). Hence,
201
F. Ji et al. / Bioresource Technology 161 (2014) 200–207
combining algae biomass production with organic wastewater treatment can mitigate costs in algae-oriented biofuel industry. Anaerobic digestion is an efficient approach for waste treatment where organic materials are converted into biogas (methane), with the production of clean energy. At the same time, this process also produces digestate (Morken et al., 2013). Biogas digested effluent is a new type of green fertilizer with comprehensive nutrients, which can promote the growth of crops. However, without sufficient treatment, that wastewater might create severely environmental pollution (Salminen et al., 2001). Therefore, the integration of anaerobic digestion wastewater (ADW) treatment and algae biomass production could be one of viable ways to reduce the risk of nitrogen and phosphorus pollutions from anaerobic digestion. Many studies have focussed on nutrient removal form municipal wastewater, agricultural wastewater and Industrial wastewater by microalgae (Wang and Lan, 2011; Senthil et al., 2010; Wu et al., 2012), whereas, it is less reported for the cultivation of microalgae in ADW (Table 1) because the process of digestion would consume a large of organic nutrients and produce high concentration of ammonium (Cai et al., 2013b). Only a few species of microalgae has been found and can grow in ADW (e.g. Chlorella sp. and Scenedesmus sp.). It is necessary to isolate potential microalgae species in order to investigate the coupling of advanced ADW treatment and biomass production. This work studies the potential of a new species of microalgae isolated from wild in order to promote biomass production, which is context of the removal of nitrogen and phosphorus from ADW.
microalgae Desmodesmus sp. EJ9-6 was selected based on its growth rates and nutrients removal capability under ADW. Desmodesmus sp. EJ9-6 was purified by serial dilutions and plate streaking in 1.5% agar Blue–Green (BG-11) medium (Rippka et al., 1979) containing following components (per liter) 1500 mg NaNO3, 40 mg K2HPO4, 75 mg MgSO47H2O, 36 mg CaCl22H2O, 6 mg citric acid, 6 mg ferric ammonium citrate, 1 mg EDTANa2, 20 mg Na2CO3, 2.86 mg H3BO3, 1.86 mg MnCl24H2O, 0.22 mg ZnSO47H2O, 0.39 mg Na2MoO42H2O, 0.08 mg CuSO45H2O, and 0.05 mg Co(NO3)26H2O. The pH value of medium was titrated to 7.0 with 1 mol/L HCl. The plates were incubated for 2–3 weeks and after the colony formation, isolated single colonies were picked up. The microalgae seed were cultivated in 50 mL autoclaved BG-11 medium in 100 mL Erlenmeyer flasks. Individual colonies were inoculated into medium within a forced ventilation clean bench (SW-CJ-2FD, Suzhou Antai Airtech, China). The flasks were then incubated in a growth chamber at 24 ± 1 °C under light intensity of 120 ± 2 lmol/(m2 s)1 by fluorescent lights and light/dark cycles (L:D) of 15:9 h for 14 d. Periodic agitations were performed for three times each day. 2.2. Amplification and sequencing of 18S rDNA and ITS1 Although rRNA genes are present in high copy numbers and the sensitivity of their detection on many dramatically increased by use of PCR, internal transcribed spacer (ITS) regions are divergent and distinctive (Turenne et al., 1999). Polymeric Chain Reaction (PCR) primers for 18S rDNA and ITS1 (Table 2) were synthesized by the Sangon Biotech (Shanghai) Co., Ltd., China. The DNA of microalgae was extracted using the NuClean PlantGen DNA kit (Beijing ComWin Biotech Co., Ltd., China) according to the manufacturer’s instructions. The 18S rDNA PCR reaction mixture contained 1 lL of DNA template, 1 lL of each primer, 4 lL of dNTP, 10 lL of 5 Q5 buffer,
2. Methods 2.1. Species sampling and microalgae pre-cultures Desmodesmus sp. EJ9-6 was isolated in August 2011 from the Olympic Forest Park (40°70 2900 N, 116°2300 3300 E), Beijing, China. In this study, totally 20 strains of microalgae were isolated and green
Table 1 Comparison of major nutrient removal rates by microalgae cultivation in various ADW conditions. Wastewater category
Gas source
Microalgae species
Cultivation period (d)
Initial nutrient (mg/L)
Nutrient removal (mg/L/d)
Dry cell weight (g/L/d)
References
Digested dairy manure (20 dilution)
CO2
Chlorella sp.
21
NH4–N = 89.1 TKNa = 172.8 TP = 12.485
4.24b 6.44c 0.20d
0.0814e
Wang et al. (2010)
Anaerobically digested dairy manure (50 dilution)
2–3% CO2
Neochloris oleoabundans
16
NH4–N = 42
6.48f
0.0883
Levine et al. (2011)
Scenedesmus accuminatus
10
NH4–N = 120
5.20
0.0458
Park et al. (2010)
Anaerobic digestion effluent from piggery farm (10 dilution)
a b c d e f g h i j k m
Biogas effluent from an anaerobic digester (6 dilution)
Biogas
Chlorella sp.
6
TN = 59.57 TP = 6.21
8.33g 0.83h
0.1026i
Yan and Zheng (2013)
Anaerobically digested cattle slurry and whey (20 dilution)
CO2
Chlorella vulgaris
21
NH4–N = 81.7 PO4–P = 3.65
5.2 0.19
0.25
Franchino et al. (2013)
Anaerobic digestion effluent
3% air
Synechocystis sp.
10
TN = 80 NH4–N = 68 TP = 11.43
8.0j 6.8k 1.143m
0.1509
Cai et al. (2013a)
Total Kjeldahl nitrogen (TKN). Estimated from 100% removal of NH4–N after 21 d. Estimated from 78.3% removal of TKN after 21 d. Estimated from 34.3% removal of TP after 21 d. Estimated from biomass production of 1.71 g/L after 21 d. Estimated from 90% to 95% removal of initial N after 6 d. Estimated from 83.94% removal of TN after 6 d. Estimated from 80.43% removal of TP after 6 d. Estimated from biomass production of 615.84 mg/L after 6 d. Estimated from 100% removal of TN after 10 d. Estimated from 100% removal of NH4–N after 10 d. Estimated from 100% removal of TP after 10 d.
202
F. Ji et al. / Bioresource Technology 161 (2014) 200–207
Table 2 PCR primers used in this study. Primers
Target a
18S rDNA FW
18S0 rDNA RV ITS1 FWb ITS2 RVb a b
a
18S 18S ITS1 ITS1
Table 3 Physicochemical characteristics of ADW.
Sequence 0
5 30 50 50 50
AAGTATAAACTGCTTATACTGTGAA 0
CCTACGGAAACCTTGTTACGACT 3 AGTCGTAACAAGGTTTCCGTAGG 30 TATGCTTAAGTTCAGCGGGTAAT 30
Direction
Parameter
Unit
Concentration
Forward
pH COD TN NH4–N NO3–N NO2–N TP PO4–P
– mg/L mg/L mg/L mg/L mg/L mg/L mg/L
9.18 6900 ± 53 928.46 ± 4.64 824.55 ± 4.20 84.46 ± 2.86 N.D.a 45.72 ± 0.55 39.68 ± 0.37
Reverse Forward Reverse
Designed by DNAMAN (USA) and Primer 5.0 (Canada). Ji et al. (2013). a
0.5 lL of Q5 DNA Polymerase (New England Biolabs, USA) and 10 lL of 5 Q5 High GC Enhancer in a volume of 50 lL. PCR thermal program included an initial pre-heating denaturation at 98 °C for 60 s, followed by 37 cycles of denaturation at 98 °C for 20 s, annealing at 58 °C for 30 s and extension at 72 °C for 45 s, and a final 180 s extension at 72 °C with a thermal cycler (Biometra TGRADIENT, Germany). The ITS1 PCR thermal program was also the same as the above except temperature of primer annealing at 52 °C. PCR products were sequenced by the Life Technologies Corporation (China). Comparisons for similar sequences were carried out using the BLAST Program (NCBI BLAST, USA). 2.3. ADW collection The ADW employed in this study, was collected from Beilangzhong pig farm biogas plant, Beijing, China. The ADW sample was immediately filtered using 1.2 lm glass microfiber filters (Whatman Inc., USA) to remove large particles and microorganisms, then stored at 4 °C to avoid variation of wastewater composition. 2.4. Experimental procedures
Where: Ri is the removal efficiency of substrate i (TN, NH4–N, TP, or PO4–P); Si0 is the initial concentration of i; and Sit is the final concentration of i after t days cultivation. The rate of nutrient removal was calculated according to Eq. (2):
ri ¼ ðSi0 Sit Þ=ðt i t0 Þ
ð2Þ
Where: ri (g/L/d) is the removal rate of substrate i (TN, NH4–N, TP, or PO4–P); Si0 is the initial concentration of i; and Sit is the final concentration of i at time t. 2.6. Determination of microalgae growth Microalgae production was determined by measuring the optical density of samples at 680 nm (OD680) using a spectrophotometer (UV-7504PC, Xinmao Instrument, Shanghai, China) as an indicator of cell density. Biomass concentration was evaluated using the method of dry cell weight (DCW; Ho et al., 2010). The DCW showed a linear relationship with OD680, as follows:
y ¼ 0:2706x 0:0178ðR2 ¼ 0:991; P < 0:05Þ
ð3Þ
Where: y (g/L) is the DCW; x is the absorbance at 680 nm.
Batch experiments were performed after microalgae strain was cultivated in 5.0% ADW for one month to obtain stable characteristics. Three levels of ADW concentration were chosen, 2.5%, 5.0% and 10.0% ADW allowed by the initial concentration used. The other conditions were prepared as mentioned in Section 2.1 and biomass concentration was controlled at around OD 0.1 after inoculation. The other flasks filled with same concentration ADW without algae addition were set up for control experiments. All the experiments were carried out in three replicates. 2.5. Nutrients analysis For physicochemical analysis of ADW, the solution pH was measured with a pH meter (Orion-3 STAR, Orion Corporation, USA). Samples were filtered using a 0.45 lm glass microfiber filters (Whatman, USA). Then the filtrates were appropriately diluted and analyzed chemical oxygen demand (COD) according to the Hach DR 2700 Spectrophotometer Manual (Hach Company, USA; Hach, 2008). Total nitrogen (TN) and total phosphorus (TP) were determined colorimetrically as nitrate and phosphate after the samples had been oxidized. Ammonia nitrogen (NH4–N) and phosphate (PO4–P) were measured following the UV/Vis-spectrophotometric method (National Standard Method of China; Wei et al., 2002). The amounts of nitrite nitrogen (NO2–N) and nitrate nitrogen (NO3–N) were determined with a flow injection analyzer (AA3, Seal Analytical, Ltd., UK). The physicochemical characteristics of the ADW are presented in Table 3. Nutrient removal efficiencies were calculated using in Eq. (1):
Ri ¼ ðSi0 Sit Þ=Si0
N.D., Not detected.
ð1Þ
3. Results and discussion 3.1. Isolation and identification of microalgae The cells of Desmodesmus sp. EJ9-6 are few in number, varying from two to four, and united into a frond by a hyaline matrix. The cell was ellipse in shape, smooth surface and cell size is approximately 5.0–7.0 lm in length, and 2.0–4.0 lm in width under optical microscope (Fig. 1). The 18S rRNA gene sequence amplified from this strain is 1097 bp in length with no heterogeneity while the ITS1 was 600 bp, and showed similarities with other known sequences from green algae based on the BLAST results, ranging in homology from 99% with Desmodesmus sp. Mary 6/3 T-2d and Desmodesmus sp. Tow 10/11 T-2W (Johnson et al., 2007). The phylogenetic analysis indicated that this strain have a close relationship with Desmodesmus sp., named EJ9-6 (Fig. 1). 3.2. ADW nutrients removal by algae growth As shown in Table 3, the ADW contains relatively high levels of TN, especially NH4–N while NO3–N, NO2–N and PO4–P are very low. Generally, a proper NH4–N concentration was reported as 20 mg/L for microalgae growth (Azov and Goldman, 1982). The ADW needs to be diluted first due to toxic effect of high concentration ammonium on microalgae growth (Chen et al., 2011; Peccia et al., 2013). The removal of nitrogen (TN and NH4–N) and phosphorus (TP and PO4–P) from ADW by Desmodesmus sp. EJ9-6 cultivation as a function of incubation time are shown in Figs. 2 and 3, respectively.
F. Ji et al. / Bioresource Technology 161 (2014) 200–207
203
Fig. 1. Phylogenetic tree of Desmodesmus sp. EJ9-6 based on partial ITS1 sequences (MEGA5.10) and morphological graph under optical microscope.
Nitrogen is an important nutrient during the process of microalgae growth. Since nitrogen can be utilized as nitrate, nitrite or ammonium, the production of microalgae biomass response varied with different sources and amounts (Costa et al., 2001). In this study, nitrogen removal analysis carried out only for TN and NH4–N, because of low NO3–N concentration in the diluted ADW (2.5–8 ppm). The ADW concentration higher than 10.0% were not tested, since high NH4–N concentrations (12.0% AWD, the content of NH4–N was approximately 100 mg/L) were apparently toxic to Desmodesmus sp., which microalgae was completely bleached after three days. The results of NH4–N and TN removal by Desmodesmus sp. EJ9-6 cultured in different concentrations of ADW are shown in Fig. 2a and b, respectively. For all conditions, nearly all NH4–N was removed within 9, 13 and 13 d for 2.5%, 5.0% and 10.0% ADW cultivation, respectively. The tendency for TN removal in all concen-
trations was similar to that for NH4–N removal in this study. Comparing to the condition that all the TN had been removed with 2.5% ADW, 87.71% and 75.50% of TN were accordingly removed from the 5.0% and 10.0% ADW when the tests came to an end, respectively. Similar results were also observed by Hu et al. (2012) who cultured Chlorella sp. in liquid swine manure, indicating that there were still some organic compounds that could not be converted to ammonium and assimilated by microalgae. Phosphorus is found in nucleic acids, lipids, proteins, and the intermediates of carbohydrate metabolism and is also an essential macro-nutrient for microalgae growth. Fig. 3a and b shows the removal of PO4–P and TP contaminants form diluted ADW. It was observed that the concentrations of PO4–P and TP decreased dramatically due to their fast assimilation by Desmodesmus sp. EJ9-6 in the first three days, the removal rate of PO4–P could
204
F. Ji et al. / Bioresource Technology 161 (2014) 200–207
(a)
90.000 80.000 2.5% control
NH4-N (mg/L)
70.000
2.5%
60.000
5.0% control
50.000
5.0% 10.0% control
40.000
10.0%
30.000 20.000 10.000 0.000
0
1
2
3
4
5
6
7
8
9 10 11 12 13 14 15
Days (d)
(b)
90.000 80.000 2.5% control
TN (mg/L)
70.000
2.5%
60.000
5.0% control
50.000
5.0% 10.0% control
40.000
10.0%
30.000 20.000 10.000 0.000
0
1
2
3
4
5
6
7
8
9 10 11 12 13 14 15
Days (d) Fig. 2. Nitrogen evolution during the culturing period: (a) trends of NH4–N in the different concentrations of ADW; (b) trends of TN in different ADW concentrations.
almost totally removed in the 2.5% and 5.0% ADW for four days while 51.24% in 10.0% ADW. The significant reduction of PO4–P was also reported by Franchino et al. (2013) who achieved around 94% PO4–P reduction when treating agro-zootechnical digestate with algae starting. Fig. 3b illustrates that the removal pattern of the TP was similar to the removal pattern of PO4–P in diluted ADW. After 14 days, the TP content was reduced from 0.940, 2.503 and 4.565 mg/L (control) to zero in 2.5%, 5.0% and 10.0% ADW, respectively. It should be noted that phosphorus removal in wastewater is not only utilized by algae cell, but also by external conditions such as pH and dissolved oxygen (DO) (Cai et al., 2013b). In general, pH increased approximately from 9 to 10 during Desmodesmus sp. EJ96 growth in diluted ADW. Thus, phosphate will precipitate from ADW as a result of elevated pH and high DO concentration. Although the proportion of abiotic precipitation is hard to quantify, it did not affect the efficiency of result that the algae uptake is still the main mechanism of phosphorus removal (Su et al., 2012). The Desmodesmus sp. EJ9-6 biomass production and nutrients removal performance in different concentrations ADW were investigated (Table 4). TN and TP daily removal rate rose as the ADW
concentration increased. Maximum nutrients removal was observed at 10.0% ADW with TN, and TP daily removal rate of 14.759 and 1.123 mg/L/d while the average daily was 4.542 and 0.326 mg/L/d, respectively. The initial N/P ratio did not only affect microalgae growth, but also directly affected the removal capacities of nitrogen and phosphorus. According to this study, the concentration of ammonia is high while the initial N/P ratio is approximate 20:1. Kim et al. (2013) reported that, the proper N/P ratio depending on the nitrogen source would be 16:1 for ammonia in advanced wastewater treatment; and it was expected that a proper N/P ratio would increase microalgae growth and removal rates of nitrogen and phosphorus. 3.3. Microalgae biomass production The growth characteristics of Desmodesmus sp. EJ9-6 under different concentration ADW were investigated (as shown in Fig. 4). Compared with the serial dilutions, microalgae grew faster in 2.5% ADW during the first seven days, after then, the growth started to level off due to earlier exhaustion of less amount of
205
F. Ji et al. / Bioresource Technology 161 (2014) 200–207
(a)
6.000 5.000
2.5% control
PO4-P (mg/L)
2.5% 4.000
5.0% control 5.0%
3.000
10.0% control 10.0%
2.000 1.000 0.000
0
1
2
3
4
5
6
7
8
9 10 11 12 13 14 15
Days (d)
(b)
6.000 5.000
2.5% control 2.5%
TP (mg/L)
4.000
5.0% control 5.0%
3.000
10.0% control 10.0%
2.000 1.000 0.000
0
1
2
3
4
5
6
7
8
9 10 11 12 13 14 15
Days (d) Fig. 3. Phosphorus evolution during the culturing period: (a) trends of PO4–P in the different concentrations of ADW; (b) trends of TP in the different concentrations of ADW.
Table 4 Microalgae biomass productivities and nutrients removal performance in different ADW concentrations Table 1. ADW concentrations (%)
2.5 5.0 10.0 a b
Assimilation days (d)
a
Average daily removal rate (mg/L/d)
Maximum daily removal rate (mg/L/d)
TN
NH4–N
TP
PO4–P
TN
NH4–N
TP
PO4–P
TN
NH4–N
TP
PO4–P
12 14 14
9 13 13
4 8 14
4 8 14
1.671 2.916 4.542
2.257 3.371 5.284
0.235 0.313 0.326
0.214 0.300 0.290
3.585 8.877 14.759
3.914 7.212 12.827
0.423 1.487 1.123
0.395 1.460 0.843
Biomass production (g/L/d)
b
0.019 0.025 0.029
The number of days when the residue nutrients in culture decreased to a undetectable or became constant. The biomass production is the average daily productivity when cultivated 14 d.
nitrogen and phosphorus. In the contrast, microalgae in 5.0% and 10.0% growth started slower and picked up in the latter part of cultivation period. A similar result was reported for Cholrella sp. cultivation by Wang et al. (2010). After the first 7 d cultivation, average dry biomasses of 0.210 ± 0.007, 0.157 ± 0.007 and 0.120 ± 0.001 g/L were found in 2.5%, 5.0% and 10.0% ADW conditions, as cultivated time goes on, after 14 d, the dry biomass increased to 0.272 ± 0.006, 0.351 ± 0.011 and 0.412 ± 0.005 g/L, respectively. It
can be observed from Table 4 that 10.0% ADW is better than other two concentrations when cultivated time increased, the maximum biomass production was 0.029 g DCW/L/d after 14 d. However, the microalgae biomass was not high compared to the biomass levels (0.025–0.7 g/L) commonly reported in other wastewater cultivation (Pittman et al., 2011). This result might be attributed to the high NH4–N and low PO4–P concentration in ADW (Wang et al., 2008).
206
F. Ji et al. / Bioresource Technology 161 (2014) 200–207
0.500 0.450 0.400
Biomass (g/L)
0.350 0.300 0.250 0.200 0.150
2.5% 5.0% 10.0%
0.100 0.050 0.000 0
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
Days (d) Fig. 4. Dry biomass of Desmodesmus sp. EJ9-6 cultivated in different concentrations of ADW for 14 d.
4. Conclusion A new unicellular green microalgae species, Desmodesmus sp. EJ9-6, was isolated and identified from fresh water. It was trained for ADW treatment and biomass productivity. Desmodesmus sp. EJ9-6 is in capable of completely depleting nitrogen and phosphorus form ADW containing high concentration of NH4–N. Maximum nutrients removal was observed at 10.0% ADW with TN, NH4–N, TP and PO4–P daily removal rate of 4.542, 5.284, 0.326 and 0.290 mg/ L/d, respectively, which the highest biomass production was 0.412 g/L after 14 d cultivation. Acknowledgements This investigation was financially supported by The Chinese National Advanced Technology Development Program (Grant No. 2013AA065802), The Chinese National ‘‘Twelfth Five-Year’’ Plan for Science & Technology Supporting Project (Grant No. 2012BAD47B03), The China Scholarship Council Fund, The Chinese Universities Scientific Fund (Grant No. 2013YJ007), and Beijing Municipal Key Discipline of Biomass Engineering. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.biortech.2014. 03.034. References Azov, Y., Goldman, J.C., 1982. Free ammonia inhibition of algal photosynthesis in intensive cultures. Appl. Environ. Microbiol. 43 (4), 735–739. Brennan, L., Owende, P., 2010. Biofuels from microalgae—a review of technologies for production, processing, and extractions of biofuels and co-products. Renew. Sust. Energ. Rev. 14 (2), 557–577. Cai, T., Ge, X., Park, S.Y., Li, Y., 2013a. Comparison of Synechocystis sp. PCC6803 and Nannochloropsis salina for lipid production using artificial seawater and nutrients from anaerobic digestion effluent. Bioresour. Technol. 144, 255–260. Cai, T., Park, S.Y., Li, Y., 2013b. Nutrient recovery from wastewater streams by microalgae: status and prospects. Renew. Sust. Energ. Rev. 19, 360–369. Chen, M., Tang, H., Ma, H., Holland, T.C., Simon Ng, K.Y., Salley, S.O., 2011. Effect of nutrients on growth and lipid accumulation in the green algae Dunaliella tertiolecta. Bioresour. Technol. 102 (2), 1649–1655.
Costa, J.A.V., Cozza, K.L., Oliveira, L., Magagnin, G., 2001. Different nitrogen sources and growth responses of Spirulina platensis in microenvironments. World J. Microbiol. Biotechnol. 17 (5), 439–442. Franchino, M., Comino, E., Bona, F., Riggio, V.A., 2013. Growth of three microalgae strains and nutrient removal from an agro-zootechnical digestate. Chemosphere 92 (6), 738–744. Hach, 2008. Procedure Manual. Hach, Loveland, CO, USA. Ho, S.H., Chen, C.Y., Yeh, K.L., Chen, W.M., Lin, C.Y., Chang, J.S., 2010. Characterization of photosynthetic carbon dioxide fixation ability of indigenous Scenedesmus obliquus isolates. Biochem. Eng. J. 53 (1), 57–62. Hu, B., Min, M., Zhou, W., Du, Z., Mohr, M., Chen, P., Zhu, J., Cheng, Y., Liu, Y., Ruan, R., 2012. Enhanced mixotrophic growth of microalga Chlorella sp. on pretreated swine manure for simultaneous biofuel feedstock production and nutrient removal. Bioresour. Technol. 126, 71–79. Ji, F., Hao, R., Liu, Y., Li, G., Zhou, Y., Dong, R., 2013. Isolation of a novel microalgae strain Desmodesmus sp. and optimization of environmental factors for its biomass production. Bioresour. Technol. 148, 249–254. Johnson, J.L., Fawley, M.W., Fawley, K.P., 2007. The diversity of Scenedesmus and Desmodesmus (Chlorophyceae) in Itasca State Park, Minnesota, USA. Phycologia 46 (2), 214–229. Kim, S., Lee, Y., Hwang, S.J., 2013. Removal of nitrogen and phosphorus by Chlorella sorokiniana cultured heterotrophically in ammonia and nitrate. Int. Biodeterior. Biodegrad. 85, 511–516. Levine, R.B., Costanza-Robinson, M.S., Spatafora, G.A., 2011. Neochloris oleoabundans grown on anaerobically digested dairy manure for concomitant nutrient removal and biodiesel feedstock production. Biomass Bioenerg. 35 (1), 40–49. Morken, J., Sapci, Z., Strømme, J.E.T., 2013. Modeling of biodiesel production in algae cultivation with anaerobic digestion (ACAD). Energ. Policy. 60, 98–105. Park, J., Jin, H.F., Lim, B.R., Park, K.Y., Lee, K., 2010. Ammonia removal from anaerobic digestion effluent of livestock waste using green alga Scenedesmus sp. Bioresour. Technol. 101 (22), 8649–8657. Peccia, J., Haznedaroglu, B., Gutierrez, J., Zimmerman, J.B., 2013. Nitrogen supply is an important driver of sustainable microalgae biofuel production. Trends Biotech. 31 (3), 134–138. Pittman, J.K., Dean, A.P., Osundeko, O., 2011. The potential of sustainable algal biofuel production using wastewater resources. Bioresour. Technol. 102 (1), 17–25. Rippka, R., Deruelles, J., Waterbury, J.B., Herdman, M., Stanier, R.Y., 1979. Generic assignments, strain histories and properties of pure cultures of Cyanobacteria. J. Gen. Microbiol. 111, 1–61. Salminen, E., Rintala, J., Härkönen, J., Kuitunen, M., Högmander, H., Oikari, A., 2001. Anaerobically digested poultry slaughterhouse wastes as fertiliser in agriculture. Bioresour. Technol. 78 (1), 81–88. Sander, K., Murthy, G.S., 2010. Life cycle analysis of algae biodiesel. Int. J. Life Cycle Assess. 15 (7), 704–714. Senthil, C., Ashish, B., Hunt, R.W., Das, K.C., 2010. Microalgae cultivation in a wastewater dominated by carpet mill effluents for biofuel applications. Bioresour. Technol. 101 (9), 3097–3105. Stephens, E., Ross, I.L., King, Z., Mussgnug, J.H., Kruse, O., Posten, C., Borowitzka, M.A., Hankamer, B., 2010. An economic and technical evaluation of microalgal biofuels. Nat. Biotechnol. 28, 126–128. Su, Y., Mennerich, A., Urban, B., 2012. Comparison of nutrient removal capacity and biomass settleability of four high-potential microalgal species. Bioresour. Technol. 124, 157–162.
F. Ji et al. / Bioresource Technology 161 (2014) 200–207 Subhadra, B.G., 2011. Water management policies for the algal biofuel sector in the Southwestern United States. Appl. Energ. 88 (10), 3492–3498. Turenne, C.Y., Sanche, S.E., Hoban, D.J., Karlowsky, J.A., Kabani, A.M., 1999. Rapid identification of fungi by using the ITS2 genetic region and an automated fluorescent capillary electrophoresis system. J. Clin. Microbiol. 37 (6), 1846–1851. Wang, B., Li, Y., Wu, N., Lan, C.Q., 2008. CO2 bio-mitigation using microalgae. Appl. Microbiol. Biotechnol. 79, 707–718. Wang, B., Lan, C.Q., 2011. Biomass production and nitrogen and phosphorus removal by the green alga Neochloris oleoabundans in simulated wastewater and secondary municipal wastewater effluent. Bioresour. Technol. 102 (10), 5639– 5644. Wang, L., Li, Y., Chen, P., Min, M., Chen, Y., Zhu, J., Ruan, R.R., 2010. Anaerobic digested dairy manure as a nutrient supplement for cultivation of oil-rich green microalgae Chlorella sp. Bioresour. Technol. 101 (8), 2623–2628.
207
Wei, F., Qi, W., Bi, T., Sun, Z., Huang, Y., Shen, Y., 2002. Water and Wastewater Monitoring and Analysis Method, fourth ed. China Environmental Science Press, Beijing. Wijffels, R.H., Barbosa, M.J., 2010. An outlook on microalgal biofuels. Science 329, 796–799. Wu, L.F., Chen, P.C., Huang, A.P., Lee, C.M., 2012. The feasibility of biodiesel production by microalgae using industrial wastewater. Bioresour. Technol. 113, 14–18. Yan, C., Zheng, Z., 2013. Performance of photoperiod and light intensity on biogas upgrade and biogas effluent nutrient reduction by the microalgae Chlorella sp. Bioresour. Technol. 139, 292–299.
