TISSUE ENGINEERING: Part A Volume 21, Numbers 17 and 18, 2015 ª Mary Ann Liebert, Inc. DOI: 10.1089/ten.tea.2015.0168

ORIGINAL ARTICLE

Biomechanical Screening of Cell Therapies for Vocal Fold Scar Rebecca S. Bartlett, PhD,1 Joel D. Gaston, PhD,2 Tom Y. Yen, PhD,2 Shuyun Ye, MS,3 Christina Kendziorski, PhD,3 and Susan L. Thibeault, PhD1,2

Candidate cell sources for vocal fold scar treatment include mesenchymal stromal cells from bone marrow (BM-MSC) and adipose tissue (AT-MSC). Mechanosensitivity of MSC can alter highly relevant aspects of their behavior, yet virtually nothing is known about how MSC might respond to the dynamic mechanical environment of the larynx. Our objective was to evaluate MSC as a potential cell source for vocal fold tissue engineering in a mechanically relevant context. A vibratory strain bioreactor and cDNA microarray were used to evaluate the similarity of AT-MSC and BM-MSC to the native cell source, vocal fold fibroblasts (VFF). Posterior probabilities for each of the microarray transcripts fitting into specific expression patterns were calculated, and the data were analyzed for Gene Ontology (GO) enrichment. Significant wound healing and cell differentiation GO terms are reported. In addition, proliferation and apoptosis were evaluated with immunohistochemistry. Results revealed that VFF shared more GO terms related to epithelial development, extracellular matrix (ECM) remodeling, growth factor activity, and immune response with BM-MSC than with AT-MSC. Similarity in glycosaminoglycan and proteoglycan activity dominated the ECM analysis. Analysis of GO terms relating to MSC differentiation toward osteogenic, adipogenic, and chondrogenic lineages revealed that BM-MSC expressed fewer osteogenesis GO terms in the vibrated and scaffold-only conditions compared to polystyrene. We did not evaluate if vibrated BM-MSC recover osteogenic expression markers when returned to polystyrene culture. Immunostaining for Ki67 and cleaved caspase 3 did not vary with cell type or mechanical condition. We conclude that VFF may have a more similar wound healing capacity to BM-MSC than to ATMSC in response to short-term vibratory strain. Furthermore, BM-MSC appear to lose osteogenic potential in the vibrated and scaffold-only conditions compared to polystyrene, potentially attenuating the risk of osteogenesis for in vivo applications.

Introduction

O

ver 15 years ago, Hirano identified vocal fold scarring as a major clinical issue awaiting improvement,1 yet there is currently not a gold standard of treatment.2–4 Cell-based therapies have been proposed, but it is unknown which cell type is best suited to regenerate vocal fold mucosa. In the only published clinical trial of a cell-based therapy for the vocal fold scar to date, Chhetri and Burke found that multiple injections of autologous buccal fibroblasts into the vocal fold lamina propria improved mucosal wave grade and Voice Handicap Index scores in a small cohort (n = 5).5 Another cell source, mesenchymal stromal cells from adipose tissue (AT-MSC) and bone marrow (BM-MSC), has a number of favorable properties,6–8 including efficacy for regenerating scarred tissue in the myocardium, central nervous system, and

skin.9–12 Currently, little is known about their potential as replacements for vocal fold fibroblasts (VFF) in vocal fold scar.13–15 The target of vocal fold scar treatment is the fibrotic extracellular matrix (ECM).16 AT- and BM-MSC differ in their expression and secretion levels of growth factors and cytokines that repair ECM when grown on polystyrene.17,18 Recent evidence suggests that MSC and fibroblasts remodel their ECM in response to tissue-specific mechanical forces through mechanotransductive processes.19–21 Currently, little is known regarding how the high vibratory rates and dynamic tensile stress in the larynx influence ECM repair in native cells (VFF) or in cell therapy candidates (AT- and BM-MSC). Another critical area of investigation for vocal fold scar treatment is MSC differentiation. Literature suggests that tissue-relevant mechanical forces (e.g., compressive stress for

Departments of 1Surgery, 2Engineering, and 3Biostatistics, University of Wisconsin Madison, Madison, Wisconsin.

2437

2438

bone tissue) influence MSC lineage selection.22–24 Osteogenic, myogenic, or chondrogenic differentiation of MSC after injection into the vocal fold could disrupt vocal fold tissue viscoelasticity through undesirable ECM remodeling. Most preclinical MSC treatment studies in the vocal folds are biased toward evaluating known fibrous proteins and proteoglycans of the lamina propria and have typically ignored markers of other mesenchymal tissues. Our objective was to use a mechanically relevant model and a gene expression assay to evaluate AT- and BM-MSC as cell therapeutics for the vocal fold scar. Specifically, following culture in a vibratory strain bioreactor, the similarity of AT- and BM-MSC to VFF with regard to ECM remodeling and cell differentiation was evaluated. Materials and Methods

In this study, three cell types (AT-MSC, BM-MSC, VFF), three donors per cell type, and three mechanical culture conditions were included, for a total of 27 samples. Culture conditions included vibratory strain (VIB), stationary scaffolds (SCA), and polystyrene (POLY). Two replicates were included for each sample, with one replicate reserved for gene expression analysis and one replicate reserved for immunohistochemistry. Cells and scaffolds

AT-MSC and BM-MSC were purchased from Lonza (PT2501, PT-5006, respectively; Walkersville, MD). AT-MSC donors included 38- and 40-year-old females and a 51-yearold male. BM-MSC donors included a 19-year-old female, a 22-year-old male, and a 43-year-old male. MSC were cultured according to the manufacturer’s instructions. Briefly, cells were maintained in a 37C incubator (5% CO2, 95% humidity), and fresh media was replaced every 3 days. ATMSC media included ADSC-Growth Media SingleQuot and ADSC-Basal Media (PT-4503, PT-3273; Lonza Poietics). BM-MSC media included MSC Growth Media SingleQuot and MSC Basal Media (PT-4105, PT-3238; Lonza Poietics). Primary human VFF were obtained from existing banks that were derived with institutional review board approval.25,26 Human vocal fold tissues were originally obtained from healthy cadavers within 4 hours of death (21- and 59-year-old males) and from unaffected true vocal fold tissue associated with supraglottic cancer resection (77-year-old female). VFF were cultured according to established protocols.26 VFF were maintained in Dulbecco’s Modified Eagle’s Medium (Sigma Aldrich, St. Louis, MO) that was supplemented with 10% fetal bovine serum (Hyclone, Logan, UT), 100 U/mL penicillin, 0.01 mg/mL streptomycin sulfate, and 1· nonessential amino acids (Sigma, St. Louis, MO). VFF, BM-MSC, and AT-MSC in the VIB and SCA conditions were seeded onto polyether polyurethane elastomeric scaffolds that were each 25 · 10 · 2 mm. The scaffolds were formulated at a 5% w/v mass concentration.27 This formulation was selected for its mechanical properties that better approximate human vocal fold viscoelasticity than higher mass concentrations.27,28 In addition, the porosity of this material is adequate for cell seeding.27 To facilitate cell attachment, scaffolds were soaked in human fibronectin in a phosphate-buffered saline solution (20 mg/ mL; Sigma Aldrich) overnight before cell seeding. The

BARTLETT ET AL.

following day, 1 · 106 cells were suspended in 100 mL of media and added dropwise to the scaffold. Twenty-four hours later, the procedure was repeated on the second side. The following day, VIB strips were mounted in the bioreactor, and SCA strips were placed in new dishes. POLY cells were seeded at 5000 cells/cm2. Mechanical conditions

At the beginning of mechanical stimulation for all conditions (VIB, SCA, POLY), AT-MSC, BM-MSC, and VFF were at passage 4–5. Cells in the VIB condition were exposed to a single 24-h stimulation paradigm. During the first 12 h, VIB cells were exposed to 200 Hz vibration and 20% longitudinal tensile strain simultaneously for *30% of every hour. Specifically, the scaffolds were first stretched to a static 20% strain and then vibrated at 200 Hz for 1 min. This was followed by 2 min of rest, where the vibration was stopped and the tensile strain was reduced from 20% to 0%. This cycle (1 min of vibration/tensile strain, 2 min of rest) was repeated for 12 h. During the second 12-h period, the scaffolds were exposed to 12 h of rest (no vibration, 0% tensile strain). Frequency and tensile strain levels were chosen to reflect female voice use, as females have a higher prevalence of voice disorders than males.29–33 Mechanical stimulation was designed according to a report that heavy voice users phonate *30% of each hour.34 As such, the bioreactor exposed cells to vibratory strain one of every 3 min for 12 h. The subsequent 12 h of rest mimicked the periods of relative vocal rest that occur when an individual is not at work. Cells in the SCA condition were evaluated after sustained stationary culture in the scaffolds to determine the effect of matrix stiffness alone. This condition was included because it is known that the behavior of MSC and fibroblasts is influenced by the mechanical properties of the substrate to which they are adhered.21,35,36 Cells in the POLY condition were grown on stationary polystyrene dishes. Bioreactor

A bioreactor was used to simulate the human vocal fold environment by subjecting pairs of cell-seeded strips to vibration and tensile strain (Fig. 1). Vibration was generated with a linear voice coil actuator. The axial tensile strain was controlled by a linear servo motor to reflect vocal fold elongation. Cell-seeded strips were mounted to the bioreactor within open-faced, sterile culture dishes and covered with cell culture media. The bioreactor was housed within a standard cell culture incubator and connected to the electronic controller and computer to control mechanical conditions. RNA extraction and microarray

Following the 12-h rest period, scaffolds were submerged in 0.25% trypsin at 37C, and cells were dissociated with plastic pestles. POLY cells were *80% confluent when harvested. Cells from all conditions were homogenized in QIAshredder columns (Qiagen, Valencia, CA). RNeasy Plus Mini Kit (Qiagen) was used to extract total RNA from all samples. Adequate RNA quality was identified with two clear ribosomal peaks (28S and 18S) and low extraneous noise on

VOCAL FOLD BIOREACTOR THERAPEUTICS

2439

the conditions included. For example, when analyzing within a mechanical condition for the present work, the patterns (P) for the mean (m) expression of each of the 53,617 probes included P1: mAT-MSC = mBM-MSC = mVFF, P2: mAT-MSC = mBM-MSCsmVFF, P3:=mAT-MSC =mVFFsmBM-MSC,P4: mAT-MSCsmBM-MSC =mVFF, and P5: mAT-MSCsmBM-MSCsmVFF. The fitted model provided information on the number of genes expected in each expression pattern as well as assigned probability distributions to every gene. Each genespecific distribution gives the posterior probability that the given gene belongs to each of the five expression patterns. Thresholds were chosen to control the false discovery rate at 5%. Test for enrichment

FIG. 1. Bioreactor schematic, including the linear voice coil actuator (A), linear servo motor (B), and two cell scaffolds (C). an Agilent 2100 Bioanalyzer electropherogram.37 cDNA was generated from the RNA, labeled, and hybridized to microarray chips (Affymetrix GeneChip Human Gene 2.0 ST; Affymetrix, Santa Clara, CA). Twenty-seven microarrays were run, with one sample per chip. All chip processing was performed at the University of Wisconsin Biotechnology Gene Expression Center according to the manufacturer’s instructions. Fluorescence data were extracted with Affymetrix Command Console Software (AGCC Version 3.2.4.1515W, Expression Console Build 1.2.0.20). Microarray statistical analyses

All analyses were performed in R.38 Software packages used in analyses (affy, ebarrays) were obtained from Bioconductor.39 Affymetrix probe level data were processed using the Robust Multiarray Average in the affy package to obtain normalized summary scores of expression for each probe set on each array.40 The probe sets will loosely be referred to as genes. EBarrays was used to identify genes fitting into specific expression patterns across the cell types and mechanical conditions.41,42 EBArrays is an empirical Bayes approach that models the probability distribution of a set of expression measurements. An expression pattern is an arrangement of the true underlying probe intensities (m) in each condition. The number of patterns for a given experiment varies according to

Once differentially expressed genes were identified, we investigated evidence for enrichment of common functions. A random-set testing method, allez, was used to assess enrichment for each Gene Ontology (GO) term.43 The default threshold in allez (normal score jZj >5) was used to assess significance; this threshold controls the false discovery rate below 5%. Confirmatory real-time polymerase chain reaction

Confirmatory real-time polymerase chain reaction (RTPCR) was completed on a subset of significant genes that are biologically important to vocal fold wound healing and had a posterior probability of >0.95 for fitting into relevant expression patterns. First-strand cDNA was generated from total RNA using the QuantiTect Reverse Transcription Kit (Qiagen, Valencia, CA). Real-time amplification was performed using an Applied Biosystems 7500 Fast Real-Time PCR instrument for 40 cycles (95C for 15 s, 95C for 2 min, annealing temperature for 15 s, 72C for 1 min) with SYBR Select Master Mix (Life Technologies, Grand Island, NY). Primer pairs for transforming growth factor beta 1 (TGFb1), fibromodulin, versican, collagen 3 alpha 1 (COL3A1), matrix metalloproteinase 1 (MMP1), and beta actin were included (Table 1). Primer specificity was confirmed with PCR. The delta–delta CT (DDCt) method was used for quantification of gene expression for all samples in triplicate.44 Results are reported as fold change or the ratio of the gene of interest to beta actin mRNA. Proliferation and apoptosis

Immunohistochemistry staining of Ki-67 and cleaved caspase three (CC3) was performed to evaluate proliferation and apoptosis, respectively. Cell-seeded strips were frozen overnight (-80C) in Tissue-Tek optimal temperature

Table 1. Primers for Confirmatory Real-Time Polymerase Chain Reaction Gene TGFB1 Fibromodulin Versican COL3A1 MMP1

GenBank#

Forward (5¢-3¢)

Reverse (5¢-3¢)

Product (bp)

NM_000660 NM_002023 NM_004385 NM_000090 NM_002421

TGCTCGCCCTGTACAACAGCA AACCTCAAGTACCTGCCCTTCGTT CTGGTACAGCTTCCTCCATTATC CCATTGCTGGGATTGGAGGTGAAA TGCAACTCTGACGTTGATCCCAGA

CGTTGTGGGTTTCCACCATTAGCA TATCACTGGTGATCTGGTTGCCGT ACTGTGCCACTGACCTTTAC TTCAGGTCTCTGCAGTTTCTAGCGG ACTGCACATGTGTTCTTGAGCTGC

126 148 151 187 122

2440

BARTLETT ET AL.

Table 2. Overview of Probes Discovered for Each Expression Pattern Analysis VIB SCA POLY

P1 AT = BM = VFF

P2 AT = BMsVFF

P3 AT = VFFsBM

P4 ATsBM = VFF

P5 ATsBMsVFF

44,914 41,484 35,750

523 476 1075

234 467 706

217 458 475

87 76 110

AT, adipose-derived mesenchymal stromal cell; BM, bone marrow-derived mesenchymal stromal cell; P, expression pattern; POLY, polystyrene; SCA, scaffold only; VIB, vibratory strain; VFF, vocal fold fibroblasts.

compound (Fisher Scientific, Waltham, MA). Eight micrometer cryosections were mounted on Tissue Path Superfrost Plus Gold Slides (Fisher Scientific) and fixed with acetone. A 10% goat serum solution blocked nonspecific binding. Sections were incubated with a rabbit monoclonal Ki-67 antibody (1:50 dilution, RM-9106-S; Neomarkers, Fremont, CA) in 1% goat serum and 0.01% Triton X-100 solution for 1 h. Separate sections were incubated with a rabbit polyclonal CC3 antibody (1:500 dilution, Asp175 #9661; Cell Signaling, Beverly, MA) in 1% goat serum and 0.01% Triton X-100 solution at 4C overnight. Immunoreactivity was detected with the ImmPRESS AntiRabbit Ig (peroxidase) Polymer Detection Kit (Vector Laboratories, Burlingame, CA) and BD Pharmingen DAB Substrate Kit (BD Biosciences, San Jose, CA). Sections were counterstained with Fisher HealthCare Pinnacle Portfolio Hematoxylin + (1:2 dilution; Thermo Scientific, Waltham, MA) for 2 min and rinsed in tap water before coverslipping. One sample from each of the nine cell donors was included for each mechanical condition. Three sections were included for each sample, and three photographs were taken of each section, for a total of nine photographs per cell donor. Sections were imaged with a Nikon Eclipse E600 microscope and an Olympus DP70 Digital Microscope Camera at 40x magnification.

did not vary with mechanical condition. Approximately 3% of all probes were differentially expressed according to the mechanical condition (P2–P5). Gene Ontology

Significant GO data associated with P2–P4 for the VIB, SCA, and POLY analyses were manually sorted for wound healing and differentiation terms. VFF shared more significant wound healing terms with BM-MSC than with AT-MSC for each mechanical condition (VIB, SCA, POLY; Fig. 2).

Statistical methods for immunohistochemistry

Two blinded independent raters counted the Ki-67- or CC3-positive cells (brown) and hematoxylin-stained cells (purple) in each image. For each photograph, the percentage of positive cells over the total number of cells was calculated. Ten percent of the images selected at random were recounted to obtain an estimate of the intrarater reliability. Inter- and intrarater agreement estimates were produced using a mixed-effects model with the SAS software procedure PROC MIXED. Two-way analysis of variance was used to determine if the percentage of positive cells differed with cell type or mechanical condition. An interaction effect (between cell type and mechanical condition) was also included in the model. p-Values < 0.05 were considered significant. Results were obtained using SAS statistical software (Version 9.2; SAS Institute, Inc., Cary, NC). Results Microarray

The number of probes found in each expression pattern is provided in Table 2. Data are separated for each mechanical condition (POLY, SCA, VIB). In each analysis, the majority of genes fit P1 (AT = BM = VFF), suggesting that most genes

FIG. 2. Heatmap of significant wound healing Gene Ontology (GO) terms. Within expression pattern 4 (P4; BM = VFFsAT), all significant GO terms related to wound healing were culled from the list of all significant GO terms. Intensities of enrichment z scores from expression pattern 2 (AT = BMsVFF) and expression pattern 3 (AT = VFFsBM) are provided as a comparison. Data are organized by mechanical condition (POLY, polystyrene; SCA, scaffold only, VIB, vibrated) and wound healing activity (ECM, ECM remodeling; Epi, epithelial activity; GF, growth factor activity; Im, immune response/other) (-5 > z > 5). ECM, extracellular matrix; VFF, vocal fold fibroblasts.

VOCAL FOLD BIOREACTOR THERAPEUTICS

Significant wound healing terms were primarily associated with epithelial development, ECM remodeling, growth factor activity, and immune response. Significant GO data for P2–P4 for the VIB, SCA, and POLY analyses were also manually sorted for terms related to osteogenesis, adipogenesis, and chondrogenesis (Fig. 3). The majority of the significant GO terms for osteogenesis fit the third expression pattern (VFF = ATsBM, 28/33 of the significant terms). While the analysis does not indicate whether the significant GO terms represent an up- or downregulation of

2441

osteogenesis, the BM-MSC uniquely expressed many more osteogenic terms compared to AT-MSC and VFF. Among the 28 significant osteogenic terms in P3, there were fewer in the scaffold and vibrated conditions than in the polystyrene condition (POLY = 16 GO terms, SCA = 7 GO terms, VIB = 5 GO terms). Significant expression of adipogenesis GO terms was generally equally shared across the three expression patterns (P2–P4). Significant expression of chondrogenic GO terms was only found in P4 (BM = VFFsAT) in the polystyrene condition.

FIG. 3. All significant GO differentiation terms. Enrichment z scores of all significant osteogenesis, adipogenesis, and chondrogenesis GO terms from expression patterns 2–4 (AT = BMsVFF, AT = VFFsBM, BM = VFFsAT, respectively) are included. Data are organized by expression pattern (e.g., AT = BMsVFF) and mechanical condition (VIB, SCA, POLY) (-5 > z > 5).

2442 Confirmatory RT-PCR

RT-PCR data confirmed the direction and relationship of expression for all selected genes (TGF-b1, fibromodulin, versican, collagen 3 alpha 1-COL3A1, and MMP1) (Fig. 4). RT-PCR detected larger fold changes than were found in the microarray data. Immunohistochemistry

The percentage of Ki67-positive cells varied from 15% to 23% of the total cells for each group (Fig. 5). Two-way ANOVA determined that the percentage of Ki67-positive cells did not differ with cell type or mechanical condition, and there was no interaction effect ( ps = 0.822, 0.625, 0.985,

FIG. 4. Real-time polymerase chain reaction (RT-PCR) confirmed microarray results. Expression of selected genes from (A) microarray analysis was confirmed with (B) RTPCR for the scaffold (SCA) and vibrated (VIB) conditions. Fold changes are reported with respect to beta actin expression. One sample from each of the nine cell donors was included for each mechanical condition.

BARTLETT ET AL.

respectively). For cell counts, inter-rater reliability was 0.90 and averaged intrarater reliability was 0.84. The percentage of CC3-positive cells varied from 2% to 7% of the total cells for each group (Fig. 5). Two-way ANOVA revealed that there was no main effect for cell type or mechanical condition and no interaction effect ( ps = 0.558, 0.231, 0.174, respectively). For cell counts, inter-rater reliability was 0.93 and averaged intrarater reliability was 0.91. Discussion Wound healing

As VFF maintain ECM while subjected to the complex mechanical forces inherent to vocal mucosa, we assume that vocal fold scar treatment requires replacement cells that mimic the VFF response to vibration and tensile stress. The microarray data demonstrated that VFF shared more wound healing GO terms with BM-MSC than with AT-MSC, including a greater number of shared terms in the VIB condition than in the SCA and POLY conditions (Fig. 2). Significant GO terms for ECM remodeling shared by vibrated BM-MSC and VFF primarily related to glycosaminoglycan (GAG) and proteoglycan activity, two ECM components known to contribute to tissue viscoelasticity. Heparan sulfate and chondroitin sulfate GAGs are found in normal vocal fold tissue, and their associated proteoglycans are thought to contribute to the unique viscoelastic properties of the lamina propria.45,46 Elevated concentrations of sulfated GAGs and proteoglycans are found in dermal, myocardial, hepatic, and vocal fold scar, and these molecules are known to interact with collagen.47–50 For example, chondroitin sulfate prevents breakdown of human scar tissue by blocking collagen fibers from collagenase as well as increases the tensile strength of collagen fibers during fibrillogenesis.51,52 With respect to the vocal fold, prevention of collagen catabolism may contribute to the abnormally high collagen levels observed in scarred lamina propria. The relationship between mechanical forces and GAG production is not yet understood. Vibrated tracheal fibroblasts (100 Hz, 10% tensile strain, 8 h/day, 3 weeks)53 and vibrated dermal fibroblasts (100 Hz, 4 h/day, 10 days)54 produce higher levels of sulfated GAGs than static controls, but BM-MSC do not (200 Hz, 1 h on, 1 h off/12 h a day, 3 days).55 We found that vibrated VFF shared more significant GO terms relating to GAGs and proteoglycans (e.g., GO:0030200 heparan sulfate catabolic process, GO:0030305 heparanase activity, GO:0035374 chondroitin sulfate binding) with BM-MSC than with AT-MSC, suggesting a shared capacity for effecting GAGrelated control of vocal fold tissue viscosity and regulation of collagen remodeling in a vibratory context. Two genes integral to these GO terms, chondroitin sulfate synthase 1 and versican (a chondroitin sulfate proteoglycan), were expressed at higher levels in vibrated AT-MSC than BM-MSC and VFF. Given the higher levels of GAGs found in scar tissue and their undesirable interaction with collagen, this finding suggests that AT-MSC may not provide as desirable a GAG environment for vocal fold scar repair as BM-MSC. However, as each GO term represents expression of a few genes up to hundreds of genes, caution should be taken when interpreting results for individual genes. Given our interest in wound healing for the entire vocal fold mucosa, we noted that there were several significant epithelial GO terms for expression patterns 2, 3, and 4. Interestingly,

VOCAL FOLD BIOREACTOR THERAPEUTICS

2443

FIG. 5. Ki67 and CC3 staining did not differ with cell type or mechanical condition. Representative histological images of cells positively stained for Ki67 (A) and CC3 (B) are shown (arrow). Data are shown as mean – standard deviation. Three biological replicates (donors) are included per cell type.

these epithelial GO terms were confined to the vibrated and scaffold conditions and were not found in the polystyrene condition. Differentiation of MSC toward an epithelial lineage is thought to occur through paracrine mechanisms (through epithelial cell coculture or induction media) or through culture near an air–liquid interface.56–58 In our study, the cells were maintained much closer to the air–media interface in VIB and SCA than in POLY. As such, our data may provide support for the importance of an air–liquid interface in epithelial tissue engineering. Alternatively, the findings may have been influenced by the material properties of the scaffolds or twodimensional (POLY) versus three-dimensional culture (VIB, SCA). In addition, a difference in cells per unit volume of media in the POLY condition compared to the scaffold conditions (VIB, SCA) could have exposed the cells to an altered concentration of key paracrine signaling molecules in the media, affecting gene expression. Cell differentiation

Two of the most striking findings in our differentiation analysis are related to osteogenic differentiation. First, the great majority of significant osteogenic GO terms (28/33) were expressed uniquely by BM-MSC among the three cell types (Fig. 3; P3, AT = VFFsBM). Osteogenic differentiation of MSC within the vocal mucosa is assumed to be harmful, given the importance of vocal fold viscoelasticity for voice production. The second striking finding was that within this same expression pattern (AT = VFFsBM), BM-MSC lost osteogenic priming in the vibrated and scaffold conditions compared to cells grown in on polystyrene, at least temporarily (Fig. 3). The effects of matrix stiffness, vibration, cell/media concentration differences, or two-dimensional versus three-dimensional culture may have contributed to these findings.

Matrix stiffness is known to influence MSC lineage specification.19,59 For example, MSCs cultured in stiff scaffolds compared to softer scaffolds have transcriptional profiles and morphology consistent with osteogenesis.19,59 Relative to the stiff matrices of human bone (storage modulus of 9.4 GPa tested at 1 Hz) and polystyrene, our more elastic cell scaffolds (39.1 kPa at 1 Hz) likely provided fewer osteogenic mechanotransductive cues to the BMMSC, resulting in fewer significant osteogenic GO terms in SCA and VIB than in POLY.27,60 The soft matrix of the vocal fold lamina propria28 may similarly attenuate the osteogenic potential of the BM-MSC in vivo. BM-MSC also lost priming for osteogenic lineage in response to the vibratory strain, at least temporarily. The relationship between vibration and bone development is an ongoing area of research and development. Vibration therapy, involving standing on a platform that provides high-frequency, low-magnitude vibration (30–90 Hz, *0.3 g, 10–20 min/day), results in increased bone mineral density in a variety of clinical populations.61–66 These data appear to contradict our microarray findings. A potential explanation is that osteocytes, rather than BM-MSC, may be the primary mechanosensing cells in the stem cell niche responsible for osteogenesis.67–71 In support of this, BM-MSC exposed to high-frequency, low-magnitude vibration do not have increased alkaline phosphatase activity, mRNA levels of osteogenic markers, or matrix mineralization.55,72 Another potential explanation for BM-MSC expressing fewer osteogenic GO terms in the VIB condition relates to the duration of mechanical stimulation. Mice exposed to a high-frequency, low-magnitude vibration regimen (5 days a week of 15 min/day of 90 Hz, 0.2 g acceleration) for 6 weeks had a 72% upregulation of Runx2 transcription factor over controls, and by 14 weeks, there was a trabecular bone

2444

volume increase of 11%.73 As our scaffolds were vibrated for 30% of an hour for only 12 h, perhaps the duration of the stimulus was not great enough to encourage osteogenesis. The influence of timing and duration of vibration therapy on MSC differentiation is complex. Recent in vitro and in vivo investigations have concluded that bone tissue and cells adapt quickly to mechanical stimuli and demonstrate greater magnitude of osteogenic changes when short bouts of vibration therapy are interspersed with rest periods over the course of several days.74–77 As human voicing occurs according to a similar schedule (short bouts interspersed with rest periods over the course of several days), evaluating BMMSC exposure to bioreactor-induced vocal fold mechanical force time periods longer than the current project (1 day) should be pursued to determine if a stronger osteogenic response is elicited. Proliferation/apoptosis

Similar to other short-term investigations (less than 3 days) of vocal fold bioreactors, we did not find that proliferation or apoptosis differed by cell type or mechanical condition55,78,79 (Fig. 5). We anticipated high cell viability, consistent with our previous investigation.80 As AT- and BM-MSC had similar rates of proliferation (15–23%) and apoptosis (2–7%) in response to short-term vibration, neither should be disqualified from consideration for vocal fold cell therapeutics for this reason. Vocal fold bioreactor investigations lasting longer than 3 days have yielded mixed results for cell viability for fibroblasts and MSC.54,78,79,81 After at least 7 days of vibration, viability has ranged from 55% (hydrogel-encapsulated dermal fibroblasts) to a 2.5fold increase of cells (BM-MSC).54,81 The heterogeneity of vibrational paradigms, durations, cell types, and scaffolds likely contributes to these findings. In future investigations, standardizing these parameters may clarify rates of vibration-associated cell fate processes. Limitations

We selected cell donors of both sexes and across a range of ages to serve as biological replicates, potentially yielding insights that are generalizable to the population across the lifespan. The disadvantage to this approach is that MSCs and fibroblasts are known to vary with age and sex, therefore results may not translate to any specific population.82–85 For example, VFF from older donors produce lower mRNA levels of procollagen and higher levels of elastin,82 while BM-MSC from older donors have a reduced bone formation capacity in response to osteogenic conditions.84 Other study limitations are that a condition involving vibration without tensile strain was not included, a longer duration of mechanical stimulation was not included, and the cell culture media were supplemented with serum. There are a number of disadvantages associated with serum supplementation,86 including the concept that in native tissues cells are only exposed to serum when vasculature is disrupted; therefore, the gene expression in this study may be more representative of that found in an active wound than in normal tissue. Given the need for serum supplementation for cell growth and proliferation, we attempted to minimize this limitation by including serum in the media for all three cell types.

BARTLETT ET AL. Conclusion

Cell-based therapies for vocal fold scar are becoming a clinical reality. Our findings potentially contribute to the understanding of cell sourcing for these endeavors. Our microarray data suggested that VFF had a more similar mechanotransductive wound healing profile with BM-MSC than with AT-MSC. Furthermore, the threat of producing undesirable MSC derivatives in response to the mechanical forces of the human larynx appears to be low, as BM-MSC lost much of their capacity for osteogenic differentiation in the vibrated and scaffold conditions. Future investigations involving longer vibration durations and varied frequencies are warranted to better understand these relationships. Acknowledgments

The authors thank Glen E. Leverson, PhD, for statistical analysis and Xia Chen, MD, PhD, Craig Berchtold, PhD, and Drew Roennenberg, MA, for technical assistance. This work was supported with grants F31 DC012973 and R01 DC4336. Disclosure Statement

No competing financial interests exist. References

1. Hirano, M., and Jackson, L.C. Phonosurgery: past, present, and future. Transactions ABEA 25, 22, 1995. 2. Woo, P., Casper, J., Colton, R., and Brewer, D. Diagnosis and treatment of persistent dysphonia after laryngeal surgery: a retrospective analysis of 62 patients. Laryngoscope 104, 1084, 1994. 3. Welham, N., Choi, S.H., Dailey, S.H., Ford, C.N., Jiang, J.J., and Bless, D.M. Prospective multi-arm evaluation of surgical treatments for vocal fold scar and pathologic sulcus vocalis. Laryngoscope 121, 1252, 2011. 4. Hsiung, M.W., Woo, P., Minasian, A., and Schaefer Mojica, J. Fat augmentation for glottic insufficiency. Laryngoscope 110, 1026, 2000. 5. Chhetri, D.K., and Berke, G.S. Injection of cultured autologous fibroblasts for human vocal fold scars. Laryngoscope 121, 785, 2011. 6. Uccelli, A., Moretta, L., and Pistoia, V. Mesenchymal stem cells in health and disease. Nat Rev Immunol 8, 726, 2008. 7. Poll, D., Parekkadan, B., Borel Rinkes, I.H.M., Tilles, A.W., and Yarmush, M.L. Mesenchymal stem cell therapy for protection and repair of injured vital organs. Cell Mol Bioeng 1, 42, 2008. 8. Pittenger, M.F., Mackay, A.M., Beck, S.C., Jaiswal, R.K., Douglas, R., Mosca, J.D., Moorman, M.A., Simonetti, D.W., Craig, S., and Marshak, D.R. Multilineage potential of adult human mesenchymal stem cells. Science 284, 143, 1999. 9. Lau, K., Paus, R., Tiede, S., Day, P., and Bayat, A. Exploring the role of stem cells in cutaneous wound healing. Exp Dermatol 18, 921, 2009. 10. Jaquet, K., Krause, K.T., Denschel, J., Faessler, P., Nauerz, M., Geidel, S., Boczor, S., Lange, C., Stute, N., and Zander, A. Reduction of myocardial scar size after implantation of mesenchymal stem cells in rats: what is the mechanism? Stem Cells Dev 14, 299, 2005. 11. Makkar, R.R., Price, M.J., Lill, M., Frantzen, M., Takizawa, K., Kleisli, T., Zheng, J., Kar, S., McClelan, R., and

VOCAL FOLD BIOREACTOR THERAPEUTICS

12.

13.

14.

15.

16. 17.

18.

19. 20. 21. 22.

23.

24.

25. 26.

27.

Miyamota, T. Intramyocardial injection of allogenic bone marrow-derived mesenchymal stem cells without immunosuppression preserves cardiac function in a porcine model of myocardial infarction. J Cardiovasc Pharmacol Ther 10, 225, 2005. Li, Y.I., Chen, J., Zhang, C.L., Wang, L., Lu, D., Katakowski, M., Gao, Q., Shen, L.H., Zhang, J., and Lu, M. Gliosis and brain remodeling after treatment of stroke in rats with marrow stromal cells. Glia 49, 407, 2005. Hertega˚rd, S., Cedervall, J., Svensson, B., Forsberg, K., ¨ hrlund-Richter, Maurer, F.H.J., Vidovska, D., Olivius, P., A L., and Blanc, K. Le Viscoelastic and histologic properties in scarred rabbit vocal folds after mesenchymal stem cell injection. Laryngoscope 116, 1248, 2006. Johnson, B.Q., Fox, R., Chen, X., and Thibeault, S. Tissue regeneration of the vocal fold using bone marrow mesenchymal stem cells and synthetic extracellular matrix injections in rats. Laryngoscope 120, 537, 2010. Svensson, B., Nagubothu, R.S., Cedervall, J., Blanc, K. Le, ¨ hrlund-Richter, L., Tolf, A., and Hertega˚rd, S. Injection of A human mesenchymal stem cells improves healing of scarred vocal folds: analysis using a xenograft model. Laryngoscope 120, 1370, 2010. Hansen, J.K., and Thibeault, S. Current understanding and review of the literature: vocal fold scarring. J Voice 20, 110, 2006. Dmitrieva, R.I., Minullina, I.R., Bilibina, A.A., Tarasova, O.V., Anisimov, S.V., and Zaritskey, A.Y. Bone marrow- and subcutaneous adipose tissue-derived mesenchymal stem cells: differences and similarities. Cell Cycle 11, 377, 2012. Wagner, W., Wein, F., Seckinger, A., Frankhauser, M., Wirkner, U., Krause, U., Blake, J., Schwager, C., Eckstein, V., Ansorge, W., and Ho, A.D. Comparative characteristics of mesenchymal stem cells from human bone marrow, adipose tissue, and umbilical cord blood. Exp Hematol 33, 1402, 2005. Engler, A., Sen, S., Sweeney, H.L., and Discher, D.E. Matrix elasticity directs stem cell lineage specification. Cell 126, 677, 2006. Ingber, D. Cellular mechanotransduction: putting all the pieces together again. FASEB J 20, 811, 2006. Chiquet, M. Regulation of extracellular matrix gene expression by mechanical stress. Matrix Biol 18, 417, 1999. Altman, G., Horan, R., Martin, I., Farhadi, J., Stark, P., Volloch, V., Vunjak-Novakovic, G., Richmond, J., and Kaplan, D.L. Cell differentiation by mechanical stress. FASEB J 16, 270, 2002. Knippenberg, M., Helder, M.N., Zandieh Doulabi, B., Semeins, C.M., Wuisman, P.I.J.M., and Klein-Nulend, J. Adipose tissue-derived mesenchymal stem cells acquire bone cell-like responsiveness to fluid shear stress on osteogenic stimulation. Tissue Eng 11, 1780, 2005. Michalopoulos, E., Knight, R.L., Korossis, S., Kearney, J.N., Fisher, J., and Ingham, E. Development of methods for studying the differentiation of human mesenchymal stem cells under cyclic compressive strain. Tissue Eng Part C Methods 18, 252, 2011. Thibeault, S., Li, W., and Bartley, S. A method for identification of vocal fold lamina propria fibroblasts in culture. Otolaryngol Head Neck Surg 139, 816, 2008. Chen, X., and Thibeault, S. Novel isolation and biochemical characterization of immortalized fibroblasts for tissue engineering vocal fold lamina propria. Tissue Eng Part C Methods 15, 201, 2009. Gaston, J., Bartlett, R., Klemuk, S.A., and Thibeault, S. Formulation and characterization of a porous, elastomeric

2445

28. 29. 30.

31.

32.

33. 34.

35. 36. 37.

38. 39.

40.

41.

42.

43.

44.

biomaterial for vocal vold tissue engineering research. Ann Otol Rhinol Laryngol 123, 866, 2014. Chan, R.W., and Titze, I. Viscoelastic shear properties of human vocal fold mucosa: measurement methodology and empirical results. J Acoust Soc Am 106, 2008, 1999. Linke, C.E. A study of pitch characteristics of female voices and their relationship to vocal effectiveness. Folia Phoniatr 25, 173, 1973. Nishizawa, N., Sawashima, M., and Yonemoto, K. Vocal fold length in vocal pitch change. In: Osamu Fujimura, ed. Vocal Physiology: Voice Production, Mechanisms and Functions. New York, NY: Raven Press, 1988. Nishizawa, N. Stereoendoscopic observation of the larynx—vocal fold length in respiration and in phonation with vocal pitch change. Nihon Jibiinkoka Gakkai Kaiho 92, 1239, 1989. Roy, N., Merrill, R.M., Thibeault, S., Parsa, R.A., Gray, S.D., and Smith, E.M. Prevalence of voice disorders in teachers and the general population. J Speech Lang Hear Res 47, 281, 2004. Roy, N., Merrill, R.M., Gray, S.D., and Smith, E.M. Voice disorders in the general population: prevalence, risk factors, and occupational impact. Laryngoscope 115, 1988, 2005. Hunter, E.J., and Titze, I. Variations in intensity, fundamental frequency, and voicing for teachers in occupational versus nonoccupational settings. J Speech Lang Hear Res 53, 862, 2010. Discher, D.E., Janmey, P., and Wang, Y. Tissue cells feel and respond to the stiffness of their substrate. Science 310, 1139, 2005. Even-Ram, S., Artym, V., and Yamada, K.M. Matrix control of stem cell fate. Cell 126, 645, 2006. Imbeaud, S., Graudens, E., Boulanger, V., Barlet, X., Zaborski, P., Eveno, E., Mueller, O., Schroeder, A., and Auffray, C. Towards standardization of RNA quality assessment using user-independent classifiers of microcapillary electrophoresis traces. Nucleic Acids Res 33, e56, 2005. R Development Core Team. R: A Language and Environment for statistical Computing. Vienna, Austria: R Foundation for Statistical Computing, 2007. Gentleman, R.C., Carey, V.J., Bates, D.M., Bolstad, B., Dettling, M., Dudoit, S., Ellis, B., Gautier, L., Ge, Y., and Gentry, J. Bioconductor: open software development for computational biology and bioinformatics. Genome Biol 5, R80, 2004. Irizarry, R.A., Hobbs, B., Collin, F., Beazer-Barclay, Y.D., Antonellis, K.J., Scherf, U., and Speed, T.P. Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics 4, 249, 2003. Kendziorski, C.M., Newton, M.A., Lan, H., and Gould, M.N. On parametric empirical Bayes methods for comparing multiple groups using replicated gene expression profiles. Stat Med 22, 3899, 2003. Newton, M.A., Kendziorski, C.M., Richmond, C.S., Blattner, F.R., and Tsui, K.W. On differential variability of expression ratios: improving statistical inference about gene expression changes from microarray data. J Comput Biol 8, 37, 2001. Newton, M.A., Quintana, F.A., Boon, J.A., den,Sengupta, S., and Ahlquist, P. Random-set methods identify distinct aspects of the enrichment signal in gene-set analysis. Ann Appl Stat 1, 85, 2007. Schmittgen, T.D., and Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3, 1101, 2008.

2446

45. Gray, S.D., Titze, I., Chan, R., and Hammond, T.H. Vocal fold proteoglycans and their influence on biomechanics. Laryngoscope 109, 845, 1999. 46. Pawlak, A.S., Hammond, T., Hammond, E., and Gray, S.D. Immunocytochemical study of proteoglycans in vocal folds. Ann Otol Rhinol Laryngol 105, 6, 1996. 47. Swann, D.A., Garg, H.G., Jung, W., and Hermann, H. Studies on human scar tissue proteoglycans. J Invest Dermatol 84, 527, 1985. 48. Ohkawa, S., Sugiura, M., Hata, R., and Nagai, Y. Acidic glycosaminoglycans in urine, serum and myocardium of aged patients with myocardial infarction. J Mol Cell Cardiol 9, 541, 1977. 49. Koizumi, T., Nakamura, N., and Hiroshi, A. Changes in acid mucopolysaccharide in the liver in hepatic fibrosis. Biochim Biophys Acta 148, 749, 1967. 50. Hirano, S., Bless, D.M., Rousseau, B., Welham, N., Scheidt, T., and Ford, C.N. Fibronectin and adhesion molecules on canine scarred vocal folds. Laryngoscope 113, 966, 2003. 51. Garg, A.K., Berg, R.A., Silver, F.H., and Garg, H.G. Effect of proteoglycans on type I collagen fibre formation. Biomaterials 10, 413, 1989. 52. Linares, H.A., and Larson, D.L. Proteoglycans and collagenase in hypertrophic scar formation. Plast Reconstr Surg 62, 589, 1978. 53. Wolchok, J., and Tresco, P. Using vocally inspired mechanical conditioning to enhance the synthesis of a cellderived biomaterial. Ann Biomed Eng 41, 2358, 2013. 54. Kutty, J.K., and Webb, K. Vibration stimulates vocal mucosa-like matrix expression by hydrogel-encapsulated fibroblasts. J Regen Med Tissue Eng 4, 62, 2010. 55. Tong, Z., Zerdoum, A., Duncan, R., and Jia, X. Dynamic vibration cooperates with connective tissue growth factor to modulate stem cell behaviors. Tissue Eng Part A 20, 1922, 2014. 56. Singaravelu, K., and Padanilam, B.J. In vitro differentiation of MSC into cells with a renal tubular epithelial-like phenotype. Ren Fail 31, 492, 2009. 57. Long, J.L., Zuk, P., Berke, G.S., and Chhetri, D.K. Epithelial differentiation of adipose-derived stem cells for laryngeal tissue engineering. Laryngoscope 120, 125, 2010. 58. Le Visage, C., Dunham, B., Flint, P., and Leong, K. Coculture of mesenchymal stem cells and respiratory epithelial cells to engineer a human composite respiratory mucosa. Tissue Eng 10, 1426, 2004. 59. Huebsch, N., Arany, P.R., Mao, A.S., Shvartsman, D., Ali, O.A., Bencherif, S.A., Rivera-Feliciano, J., and Mooney, D.J. Harnessing traction-mediated manipulation of the cell/ matrix interface to control stem-cell fate. Nat Mater 9, 518, 2010. 60. Yamashita, J., Furman, B.R., Rawls, H.R., Wang, X., and Agrawal, C.M. The use of dynamic mechanical analysis to assess the viscoelastic properties of human cortical bone. J Biomed Mater Res 58, 47, 2001. 61. Rubin, C., Turner, A.S., Bain, S., Mallinckrodt, C., and McLeod, K. Anabolism. Low mechanical signals strengthen long bones. Nature 412, 603, 2001. 62. Rubin, C., Simon Turner, A., Muller, R., Mittra, E., McLeod, K., Lin, W., and Qin, X. Quantity and quality of trabecular bone in the femur are enhanced by a strongly anabolic, noninvasive mechanical intervention. J Bone Miner Res 17, 349, 2002. 63. Pitukcheewanont, P., and Safani, D. Extremely low-level, short-term mechanical stimulation increases cancellous and

BARTLETT ET AL.

64.

65.

66.

67. 68. 69.

70.

71.

72.

73.

74. 75.

76.

77.

78.

79.

cortical bone density and muscle mass of children with low bone density: pilot study. Endocrinologist 16, 128, 2006. Ward, K., Alsop, C., Caulton, J., Rubin, C., Adams, J., and Mughal, Z. Low magnitude mechanical loading is osteogenic in children with disabling conditions. J Bone Miner Res 19, 360, 2004. Verschueren, S.M.P., Roelants, M., Delecluse, C., Swinnen, S., Vanderschueren, D., and Boonen, S. Effect of 6-month whole body vibration training on hip density, muscle strength, and postural control in postmenopausal women: a randomized controlled pilot study. J Bone Miner Res 19, 352, 2004. Rubin, C., Recker, R., Cullen, D., Ryaby, J., McCabe, J., and McLeod, K. Prevention of postmenopausal bone loss by a low-magnitude, high-frequency mechanical stimuli: a clinical trial assessing compliance, efficacy, and safety. J Bone Miner Res 19, 343, 2004. Bonewald, L.F. The amazing osteocyte. J Bone Miner Res 26, 229, 2011. Han, Y., Cowin, S., Schaffler, M., and Weinbaum, S. Mechanotransduction and strain amplification in osteocyte cell processes. Proc Natl Acad Sci U S A 101, 16689, 2004. Lau, E., Al-Dujaili, S., Guenther, A., Liu, D., Wang, L., and You, L. Effect of low-magnitude, high-frequency vibration on osteocytes in the regulation of osteoclasts. Bone 46, 1508, 2010. Taylor, A.F., Saunders, M.M., Shingle, D.L., Cimbala, J.M., Zhou, Z., and Donahue, H.J. Mechanically stimulated osteocytes regulate osteoblastic activity via gap junctions. Am J Physiol Cell Physiol 292, C545, 2007. Winkler, D.G., Sutherland, M.K., Geoghegan, J.C., Yu, C., Hayes, T., Skonier, J.E., Shpektor, D., Jonas, M., Kovacevich, B.R., Staehling-Hampton, K., Appleby, M., Brunkow, M.E., and Latham, J.A. Osteocyte control of bone formation via sclerostin, a novel BMP antagonist. EMBO J 22, 6267, 2003. Lau, E., Lee, W.D., Li, J., Xiao, A., Davies, J.E., Wu, Q., Wang, L., and You, L. Effect of low-magnitude, highfrequency vibration on osteogenic differentiation of rat mesenchymal stromal cells. J Orthop Res 29, 1075, 2011. Luu, Y.K., Capilla, E., Rosen, C.J., Gilsanz, V., Pessin, J.E., Judex, S., and Rubin, C. Mechanical stimulation of mesenchymal stem cell proliferation and differentiation promotes osteogenesis while preventing dietary-induced obesity. J Bone Miner Res 24, 50, 2009. Thompson, W.R., Rubin, C., and Rubin, J. Mechanical regulation of signaling pathways in bone. Gene 503, 179, 2012. Srinivasan, S., Ausk, B.J., Poliachik, S.L., Warner, S.E., Richardson, T.S., and Gross, T.S. Rest-inserted loading rapidly amplifies the response of bone to small increases in strain and load cycles. J Appl Physiol 102, 1945, 2007. Robling, A.G., Hinant, F.M., Burr, D.B., and Turner, C.H. Improved bone structure and strength after long-term mechanical loading is greatest if loading is separated into short bouts. J Bone Miner Res 17, 1545, 2002. Sen, B., Xie, Z., Case, N., Styner, M., Rubin, C., and Rubin, J. Mechanical signal influence on mesenchymal stem cell fate is enhanced by incorporation of refractory periods into the loading regimen. J Biomech 44, 593, 2011. Titze, I., Hitchcock, R.W., Broadhead, K., Webb, K., Li, W., Gray, S.D., and Tresco, P.A. Design and validation of a bioreactor for engineering vocal fold tissues under combined tensile and vibrational stresses. J Biomech 37, 1521, 2004. Webb, K., Hitchcock, R.W., Smeal, R.M., Li, W., Gray, S.D., and Tresco, P.A. Cyclic strain increases fibroblast

VOCAL FOLD BIOREACTOR THERAPEUTICS

80. 81.

82. 83.

84.

proliferation, matrix accumulation, and elastic modulus of fibroblast-seeded polyurethane constructs. J Biomech 39, 1136, 2006. Gaston, J., Rios, B.Q., Bartlett, R., Berchtold, C., and Thibeault, S. The response of vocal fold fibroblasts and mesenchymal stromal cells to vibration. PLoS One 7, e30965, 2012. Tong, Z., and Jia, X. Vocal fold-mimetic environment for fibroblastic differentiation of mesenchymal stem cell. Bioengineering Conference (NEBEC), 2012 38th Annual Northeast, 410, 2012. Chen, X., and Thibeault, S. Characteristics of age-related changes in cultured human vocal fold fibroblasts. Laryngoscope 118, 1700, 2008. Crisostomo, P.R., Markel, T.A., Wang, M., Lahm, T., Lillemoe, K.D., and Meldrum, D.R. In the adult mesenchymal stem cell population, source gender is a biologically relevant aspect of protective power. Surgery 142, 215, 2007. Mendes, S.C., Tibbe, J.M., Veenhof, M., Bakker, K., Both, S., Platenburg, P.P., Oner, F.C., de Bruijn, J.D., and van Blitterswijk, C.A. Bone tissue-engineered implants using human bone marrow stromal cells: effect of culture conditions and donor age. Tissue Eng 8, 911, 2002.

2447

85. Wagner, W., Bork, S., Horn, P., Krunic, D., Walenda, T., Diehlmann, A., Benes, V., Blake, J., Huber, F.-X., Eckstein, V., Boukamp, P., and Ho, A.D. Aging and replicative senescence have related effects on human stem and progenitor cells. PLoS One 4, e5846, 2009. 86. Brunner, D., Frank, J., Appl, H., Scho¨ffl, H., Pfaller, W., and Gstraunthaler, G. Serum-free cell culture: the serum-free media interactive online database. ALTEX 27, 53, 2010.

Address correspondence to: Susan L. Thibeault, PhD Department of Surgery University of Wisconsin Madison 5107 Wisconsin Institute Medical Research 1111 Highland Avenue Madison, WI 53705 E-mail: [email protected] Received: April 7, 2015 Accepted: June 25, 2015 Online Publication Date: July 22, 2015