Biotechnol Lett (2014) 36:2193–2198 DOI 10.1007/s10529-014-1610-6
ORIGINAL RESEARCH PAPER
Biotechnological approach towards a highly efficient production of natural prostaglandins J. C. Guder • M. Buchhaupt • I. Huth • A. Hannappel • N. Ferreiro´s • G. Geisslinger J. Schrader
•
Received: 15 May 2014 / Accepted: 3 July 2014 / Published online: 22 July 2014 Ó Springer Science+Business Media Dordrecht 2014
Abstract Prostaglandins (PGs) act as potent local hormones in nearly all tissues of the human body and are used for various medical applications. Heterologous expression of PG endoperoxide H-synthase from the alga, Gracilaria vermiculophylla, into E. coli and the application of this strain in biotransformation experiments resulted in a highly efficient conversion of arachidonic acid (ARA) yielding up to 130 mg natural PGs l-1 in a laboratory scale approach. Detailed analyses of the products and production kinetics were performed, confirming a rapid conversion of ARA to PGs. Keywords Arachidonic acid Biotransformation E. coli Gracilaria vermiculophylla Prostaglandin Prostaglandin endoperoxide H-synthase Introduction Prostaglandins (PGs) comprise a group of lipid-derived local hormones that play major roles in modulation of J. C. Guder M. Buchhaupt I. Huth A. Hannappel J. Schrader (&) Biochemical Engineering, DECHEMA Research Institute, Theodor-Heuss-Allee 25, 60486 Frankfurt/Main, Germany e-mail: [email protected] N. Ferreiro´s G. Geisslinger Pharmazentrum Frankfurt/ZAFES, Institute of Clinical Pharmacology, Goethe-University, Frankfurt/Main, Germany
several physiological and pathophysiological processes in the cardiovascular, renal, respiratory, gastrointestinal and nervous system (Miller 2006). Due to their diverse functions, PGs are important active agents in several pharmaceuticals for a variety of therapeutic applications e.g. treatment of glaucoma (Hejkal and Camras 1999), or induction of labor (Summers 1997). Because of their medical applications, methods for PG production have been investigated in various ways. There are innovative strategies for chemical synthesis (Coulthard et al. 2012) but these methods suffer from e.g. yield limiting chromatographic purification steps. Different approaches for biotechnological production of PGs have been described, such as the use of the coral Plexaura homomalla (Bundy et al. 1972). Several microbial biosyntheses of PG analogs, biotransformations of chemically-synthesized precursors, or direct enzymatic production of PGs have been reviewed (Lamacˇka and Sˇajbidor 1997; Yilmaz 2001). All these methods exhibit several advantages compared to chemical synthesis such as the decrease of the need of strong oxidizers, the ability to work at lower temperatures and nonoccurrence of side products. Nevertheless, serious drawbacks have been described regarding the requirement of internal organs of animals as a source for enzymes or low stability of biocatalysts and products. To the present day, bioproduction of PGs is limited to academic research and has not been transferred into a commercial process. The most severe limitation for PG production is the absence of a viable source for the enzyme,
123
2194
prostaglandin endoperoxide H-synthase (PGHS), which catalyzes the cyclization reaction of arachidonic acid (ARA) to PGG2 and its reduction to PGH2. Due to the necessity of subcellular membrane organelles for post-translational glycosylation of animal PGHS, recombinant expression is limited to eukaryotic systems. Cloning and expression of a nonglycosylated form of PGHS of the red alga, Gracilaria vermiculophylla (gvPGHS), was published recently (Kanamoto et al. 2011; Takemura et al. 2013). These studies report the production of up to 3 mg PGF2a l-1 in 7 h using recombinant E. coli and 22 mg PGF2a per 500 g fresh weight liverworts, respectively. In our study we demonstrate a straight-forward method for biotechnological production of PGs in biotransformation experiments using gvPGHS expressed in E. coli. A highly efficient enzymatic conversion of ARA to PGH2 and subsequent chemical reduction using Sn(II)Cl yielded 130 mg PGs l-1 as confirmed by HPLC–ELSD and LC–ESI–MS/MS analysis. A product shift was observed over time resulting from the conversion of PGF2a to PGD2 and PGE2 in aqueous media.
Materials and methods Cloning of gvPGHS The gvPGHS gene sequence was codon-optimized for E. coli (GenBank accession number KJ415281). For cloning, the gene was amplified by PCR using oligonucleotides (TGCACATATGGTGTTTAACAA CTTTCGCAA and TGCACTCGAGTTACACCGGG TTATTTTTCG), followed by NdeI/XhoI digestion and ligation into the linearized pStaby expression vector (DELPHI genetics, Charleroi, BE). The expression vector was transformed into E. coli SE1 cells by electroporation according to manufacturer´s protocol. O2 consumption measurements during in vitro biotransformation Using a fiber-optic O2 monitor (Microx TX3, PreSens), cyclooxygenase activity was determined in microtiter plates by measuring the initial rate of O2 uptake. All experiments were carried out at 25 °C in 0.1 M Tris/HCl, pH 8.1, buffer in the presence of 100 lM ARA and 500 lM phenol as co-substrate.
123
Biotechnol Lett (2014) 36:2193–2198
Reaction buffer, substrate fatty acid and phenol were mixed by rapid stirring with a magnetic stir bar and the initial O2 level was determined. Cell free protein extract was added in defined amounts and the decrease in oxygen saturation was recorded until the end of the reaction. Treatment and product analytics of biotransformation samples Sample treatment comprised addition of 1 % (v/v) 1 M HCl, followed by SnCl2 addition to 50 mM and extraction twice with an equal volume of ethyl acetate. The ethyl acetate was evaporated under N2 and dried samples were stored at -80 °C until further processing. Sample analysis was performed using LC–ESI– MS/MS as described elsewhere (Linke et al. 2012). Quantification of PG and fatty acids was performed using an evaporative light scattering detector (ELSDLTII) coupled to an HPLC equipped with a RP column and precolumn [Phenomenex C5l Luna (100A) C18(2) 125 9 4 mm] using step-wise gradient elution of mobile phases A, water/acetate (99:1 v/v), and B, acetonitrile/acetate (99:1 v/v), and the following gradient elution: 0 min, 76 % A, 24 % B; 0.01–5.5 min, 48 % A, 52 % B; 5.5–8.5 min, 25 % A, 75 % B; 8.5–17 min, 22 % A, 78 % B; 17–18 min, 4 % A, 96 % B; 18–22.5 min, 4 % A, 96 % B; 22.5–23 min, 96 % A, 4 % B; 23–27 min, 76 % A, 24 % B; with a total flow rate of 1.5 ml min-1. Calibrations were carried out using authentic standards (Cayman Chemicals, Tallin, Estonia).
Results and discussion Expression of gvPGHS in E. coli We used an antibiotic-free expression system which offers the advantage to cultivate the production strain without expensive selection agents. To verify an efficient expression of gvPGHS, we analyzed specific enzyme activities in cell free protein extracts of pStaby-gvPGHS transformants of E. coli SE1 by following O2 incorporation into the substrate fatty acid catalyzed by cyclooxygenase activity. We calculated the specific enzyme activity to be 3.3 kU per mg total protein (one unit represents the consumption of
Biotechnol Lett (2014) 36:2193–2198
2195
1 lmol O2 min-1 mg-1 protein), compared to almost no measureable signal in the respective control (data not shown). Using the pStaby plasmid based stabilization system permits successful over-expression of recombinant gvPGHS in E. coli, hence generating an appropriate strain for efficient biotransformation of AA to PG. In vitro biotransformation PGHS catalyzes a two-step reaction starting with a cyclization of the linear fatty acid substrate and formation of a hydroperoxy-group, followed by a reduction of the hydroperoxide to form a hydroxylgroup at the respective position. The intermediate product of the first reaction is PGG2, the final reaction product is PGH2 (Simmons et al. 2004). Since gvPGHS-mediated PG formation has so far only been confirmed indirectly by reduction of the reaction products into the more stable PGs PGF2a, E2 and D2 using SnCl2 (Kanamoto et al. 2011; Varvas et al. 2013), we carried out in vitro biotransformations of ARA by gvPGHS in cell free protein extracts. As can be seen in Fig. 1, ARA was exclusively converted in the presence of gvPGHS, forming the expected products, PGG2 and PGH2, as confirmed by comparison with authentic standards (data not shown).
Fig. 1 Biotransformation of arachidonic acid using cell free protein extracts. Batch cultivation was carried out in a total volume of 500 ml LB medium; protein expression and in vitro biotransformation were carried out as described in ‘‘Materials and methods’’ section. For biotransformation, 1 mg cell free protein extract of cells expressing gvPGHS or a respective control were incubated with 100 lM arachidonic acid (AA) and 500 lM phenol. gvPGHS-mediated conversion of AA to PGs was monitored following O2 consumption. When gvPGHS became inactive, O2 consumption stopped and samples were treated as described in ‘‘Materials and methods’’ section. For HPLC–ELSD analysis, samples were resuspended in 100 ll ethyl acetate and 5 ll were injected for analysis. Chromatograms represent one single result, representative for three independent experiments for each E. coli strain
Whole-cell biotransformation of arachidonic acid to prostaglandins Whole-cell biocatalysts offer several advantages, such as the elimination of the need for protein isolation or purification, enzyme stability, facile cofactor regeneration, as well as the ability to catalyze more sophisticated chemical transformations requiring multiple enzymes or pathways. On the other hand, bioprocesses are limited by the barrier function of cellular walls and membranes (Chen 2007). Based on earlier experiences in biotransformation of fatty acid substrates using E. coli, we carried out a 30 min incubation of the cells in the presence of Triton X100 prior to substrate addition (Kaehne et al. 2011), expecting an enhanced substrate delivery towards the enzyme by partial permeabilization of gvPGHS expressing E. coli cells, as well as improved substrate solubility through micellarisation. As can be seen in Fig. 2, there was a rapid and efficient conversion of ARA within the initial 10 min
Fig. 2 Whole-cell biotransformation of arachidonic acid using E. coli expressing gvPGHS. Batch cultivation was carried out in 2 l LB medium. For protein expression the cells were grown at 37 °C in LB medium to an OD600 of 0.6–0.7. After chilling to 16 °C, protein expression was induced by adding 0.1 mM IPTG. The cultures were incubated for 16 h at 16 °C. After harvesting, the cells were centrifuged (8,0009g, 4 °C, 15 min), washed with buffer (0.1 M Tris/HCl, pH 7.5) and re-centrifuged again. For biotransformation, cells were resuspended in 0.1 M Tris/HCl, pH 7.5, buffer at 20 g cell wet weight l-1 and transferred to baffled shake-flasks. Prior to substrate addition, 1 % Triton X100 (v/v) was added and the cells were incubated for 30 min at 25 °C with constant shaking. Following the addition of 600 lM arachidonic acid in ethanol, samples were taken periodically. Samples were treated as described in ‘‘Materials and methods’’ section. For HPLC–ELSD analysis samples were resuspended in 250 ll ethyl acetate and 10 ll were injected for analysis. Circles represent the concentration of substrate fatty acid, squares represent total prostaglandin content (PGF2a ? PGD2 ? PGE2) (mean ± SE, n = 2)
123
2196
Fig. 3 HPLC–ELSD and LC–ESI–MS/MS analysis of products formed in whole-cell biotransformation. a Bars represent concentrations of different prostaglandins formed in the biotransformation. Identification and quantification in HPLC– ELSD analysis were carried out using authentic standards. Dried samples were resuspended in ethyl acetate and 10 ll were injected for analysis. White bars represent PGF2a, dark grey bars represent PGD2, and light grey bars represent PGE2
123
Biotechnol Lett (2014) 36:2193–2198
(mean ± SE, n = 2). b LC–ESI–MS/MS based validation of natural prostaglandins formed in biotransformation experiment. Dried samples were resuspended in acetonitrile/water/formic acid (20:80:0.0025, by volume pH 4.0) and 45 ll were injected for analysis. Left-hand side chromatograms represent biotransformation samples; right-hand side chromatograms represent deuterated standards
Biotechnol Lett (2014) 36:2193–2198
of the biotransformation and an increasing amount of total PGs generated up to 20 min. Thereafter product concentration declined constantly over time, most probably due to instability of PGs in aqueous media. The fast conversion of substrate into PGs could therefore be highly beneficial with respect to recovery of the products. The maximum concentration of PGs generated de novo from ARA after 20 min was calculated to be 127.8 mg l-1. PGs formed by gvPGHS were chemically reduced using SnCl2. According to Hamberg et al. (1974), SnCl2 reduction culminates in formation of primarily PGF2a from PGG2 and PGH2. Figure 3a shows PGF2a to be the primary product within the first 10 min of the biotransformation, thereafter PGF2a content decreases. An increasing amount of PGD2, and especially PGE2, is most probably based on a known conversion of PGH2 to a mixture of PGE2 and PGD2 in acid-buffered media as shown by Andersen and Hartzell (1984) through high-field 1H-NMR studies. Both PGs are not further reduced by SnCl2 during sample treatment. Detailed analyses of the biotransformation samples using LC–ESI–MS/MS analysis, proved that products formed through gvPGHS catalysis and Sn(II)Cl treatment are indeed natural PGs of the two series (Fig. 3b). To enhance the efficiency of PG bioproduction, further efforts should be made to optimize the biotransformation conditions in order to prevent a decomposition of PGH2 into PGE2 or PGD2 in cases of PGF2a being the primary target product. Alternatively, co-expression of a selective PGH2 reducing PGE- or F-synthase would enable the synthesis of a single product in respective experiments.
Conclusions and outlook The successful application of gvPGHS in a biotechnological approach allows the rapid conversion of ARA at high rates and produces PGs in significant concentrations. Up to now 130 mg total PGs per liter could be obtained within 20 min in an as yet nonoptimized process. As to our knowledge the production costs for chemically-synthesized PGs exceed. 200 US$ g-1, the biotechnological synthesis concept appears economically viable. As the system is simple, demanding a single, recombinant gene expression in E. coli, it should be easily scalable to industrial size.
2197
Detailed product analysis confirmed the production of natural PGs. Although in medical application the bulk of pharmaceuticals contains a wide spectrum of modified PG derivatives and natural PGs are only occasionally used as in case of Dinoprostone (PGE2,) for the induction of labor (Keirse 2006), biotechnologically-produced PGs would––for the first time—open access to the synthesis of desired derivatives (Bezuglov and Serkov 2012). Acknowledgments This project has been funded by the German Federal Ministry of Economics and Technology (BMWi) via the German Federation of Industrial Research Associations ‘‘Otto von Guericke’’ e.V. (AiF) (project number 16899 N) and via Deutsche Forschungsgemeinschaft SFB 1039/Z1.
References Andersen NH, Hartzell CJ (1984) High-field 1H NMR studies of prostaglandin H2 and its decomposition pathways. Biochem Biophys Res Commun 120:512–519 Bezuglov VV, Serkov IV (2012) Selective protection of hydroxyls in natural type E and F prostaglandins. Chem Nat Compd 48:291–296 Bundy GL, Schneider WP, Lincoln FH, Pike JE (1972) The synthesis of prostaglandins E 2 and F 2a from (15R)- and (15S)-PGA 2. J Am Chem Soc 94:2123–2124 Chen RR (2007) Permeability issues in whole-cell bioprocesses and cellular membrane engineering. Appl Microbiol Biotechnol 74:730–738 Coulthard G, Erb W, Aggarwal VK (2012) Stereocontrolled organocatalytic synthesis of prostaglandin PGF2alpha in seven steps. Nature 489:278–281 Hamberg M, Svensson J, Wakabayashi T, Samuelsson B (1974) Isolation and structure of two prostaglandin endoperoxides that cause platelet aggregation. Proc Nat Acad Sci USA 71:345–349 Hejkal TW, Camras CB (1999) Prostaglandin analogs in the treatment of glaucoma. Semin Ophthalmol 14:114–123 Kaehne F, Buchhaupt M, Schrader J (2011) A recombinant alpha-dioxygenase from rice to produce fatty aldehydes using E. coli. Appl Microbiol Biotechnol 90:989–995 Kanamoto H, Takemura M, Ohyama K (2011) Identification of a cyclooxygenase gene from the red alga Gracilaria vermiculophylla and bioconversion of arachidonic acid to PGF(2alpha) in engineered Escherichia coli. Appl Microbiol Biotechnol 91:1121–1129 Keirse MJ (2006) Natural prostaglandins for induction of labor and preinduction cervical ripening. Clin Obstet Gynecol 49:609–626 Lamacˇka M, Sˇajbidor J (1997) Biotechnological production of prostaglandins. Appl Microbiol Biotechnol 47:199–206 Linke B et al (2012) Analysis of sphingolipid and prostaglandin synthesis during zymosan-induced inflammation. Prostaglandins Other Lipid Mediat 99:15–23
123
2198 Miller SB (2006) Prostaglandins in health and disease: an overview. Semin Arthritis Rheum 36:37–49 Simmons DL, Botting RM, Hla T (2004) Cyclooxygenase isozymes: the biology of prostaglandin synthesis and inhibition. Pharmacol Rev 56:387–437 Summers L (1997) Methods of cervical ripening and labor induction. J Nurse Midwifery 42:71–85 Takemura M, Kanamoto H, Nagaya S, Ohyama K (2013) Bioproduction of prostaglandins in a transgenic liverwort,
123
Biotechnol Lett (2014) 36:2193–2198 Marchantia polymorpha. Transgenic Res doi:10.1007/ s11248-013-9699-2 Varvas K, Kasvandik S, Hansen K, Ja¨rving I, Morell I, Samel N (2013) Structural and catalytic insights into the algal prostaglandin H synthase reveal atypical features of the first non-animal cyclooxygenase. Biochim Biophys Acta 1831:863–871 Yilmaz E (2001) Biotechnological production of prostaglandin. Biotechnol Adv 19:387–397
ORIGINAL RESEARCH PAPER
Biotechnological approach towards a highly efficient production of natural prostaglandins J. C. Guder • M. Buchhaupt • I. Huth • A. Hannappel • N. Ferreiro´s • G. Geisslinger J. Schrader
•
Received: 15 May 2014 / Accepted: 3 July 2014 / Published online: 22 July 2014 Ó Springer Science+Business Media Dordrecht 2014
Abstract Prostaglandins (PGs) act as potent local hormones in nearly all tissues of the human body and are used for various medical applications. Heterologous expression of PG endoperoxide H-synthase from the alga, Gracilaria vermiculophylla, into E. coli and the application of this strain in biotransformation experiments resulted in a highly efficient conversion of arachidonic acid (ARA) yielding up to 130 mg natural PGs l-1 in a laboratory scale approach. Detailed analyses of the products and production kinetics were performed, confirming a rapid conversion of ARA to PGs. Keywords Arachidonic acid Biotransformation E. coli Gracilaria vermiculophylla Prostaglandin Prostaglandin endoperoxide H-synthase Introduction Prostaglandins (PGs) comprise a group of lipid-derived local hormones that play major roles in modulation of J. C. Guder M. Buchhaupt I. Huth A. Hannappel J. Schrader (&) Biochemical Engineering, DECHEMA Research Institute, Theodor-Heuss-Allee 25, 60486 Frankfurt/Main, Germany e-mail: [email protected] N. Ferreiro´s G. Geisslinger Pharmazentrum Frankfurt/ZAFES, Institute of Clinical Pharmacology, Goethe-University, Frankfurt/Main, Germany
several physiological and pathophysiological processes in the cardiovascular, renal, respiratory, gastrointestinal and nervous system (Miller 2006). Due to their diverse functions, PGs are important active agents in several pharmaceuticals for a variety of therapeutic applications e.g. treatment of glaucoma (Hejkal and Camras 1999), or induction of labor (Summers 1997). Because of their medical applications, methods for PG production have been investigated in various ways. There are innovative strategies for chemical synthesis (Coulthard et al. 2012) but these methods suffer from e.g. yield limiting chromatographic purification steps. Different approaches for biotechnological production of PGs have been described, such as the use of the coral Plexaura homomalla (Bundy et al. 1972). Several microbial biosyntheses of PG analogs, biotransformations of chemically-synthesized precursors, or direct enzymatic production of PGs have been reviewed (Lamacˇka and Sˇajbidor 1997; Yilmaz 2001). All these methods exhibit several advantages compared to chemical synthesis such as the decrease of the need of strong oxidizers, the ability to work at lower temperatures and nonoccurrence of side products. Nevertheless, serious drawbacks have been described regarding the requirement of internal organs of animals as a source for enzymes or low stability of biocatalysts and products. To the present day, bioproduction of PGs is limited to academic research and has not been transferred into a commercial process. The most severe limitation for PG production is the absence of a viable source for the enzyme,
123
2194
prostaglandin endoperoxide H-synthase (PGHS), which catalyzes the cyclization reaction of arachidonic acid (ARA) to PGG2 and its reduction to PGH2. Due to the necessity of subcellular membrane organelles for post-translational glycosylation of animal PGHS, recombinant expression is limited to eukaryotic systems. Cloning and expression of a nonglycosylated form of PGHS of the red alga, Gracilaria vermiculophylla (gvPGHS), was published recently (Kanamoto et al. 2011; Takemura et al. 2013). These studies report the production of up to 3 mg PGF2a l-1 in 7 h using recombinant E. coli and 22 mg PGF2a per 500 g fresh weight liverworts, respectively. In our study we demonstrate a straight-forward method for biotechnological production of PGs in biotransformation experiments using gvPGHS expressed in E. coli. A highly efficient enzymatic conversion of ARA to PGH2 and subsequent chemical reduction using Sn(II)Cl yielded 130 mg PGs l-1 as confirmed by HPLC–ELSD and LC–ESI–MS/MS analysis. A product shift was observed over time resulting from the conversion of PGF2a to PGD2 and PGE2 in aqueous media.
Materials and methods Cloning of gvPGHS The gvPGHS gene sequence was codon-optimized for E. coli (GenBank accession number KJ415281). For cloning, the gene was amplified by PCR using oligonucleotides (TGCACATATGGTGTTTAACAA CTTTCGCAA and TGCACTCGAGTTACACCGGG TTATTTTTCG), followed by NdeI/XhoI digestion and ligation into the linearized pStaby expression vector (DELPHI genetics, Charleroi, BE). The expression vector was transformed into E. coli SE1 cells by electroporation according to manufacturer´s protocol. O2 consumption measurements during in vitro biotransformation Using a fiber-optic O2 monitor (Microx TX3, PreSens), cyclooxygenase activity was determined in microtiter plates by measuring the initial rate of O2 uptake. All experiments were carried out at 25 °C in 0.1 M Tris/HCl, pH 8.1, buffer in the presence of 100 lM ARA and 500 lM phenol as co-substrate.
123
Biotechnol Lett (2014) 36:2193–2198
Reaction buffer, substrate fatty acid and phenol were mixed by rapid stirring with a magnetic stir bar and the initial O2 level was determined. Cell free protein extract was added in defined amounts and the decrease in oxygen saturation was recorded until the end of the reaction. Treatment and product analytics of biotransformation samples Sample treatment comprised addition of 1 % (v/v) 1 M HCl, followed by SnCl2 addition to 50 mM and extraction twice with an equal volume of ethyl acetate. The ethyl acetate was evaporated under N2 and dried samples were stored at -80 °C until further processing. Sample analysis was performed using LC–ESI– MS/MS as described elsewhere (Linke et al. 2012). Quantification of PG and fatty acids was performed using an evaporative light scattering detector (ELSDLTII) coupled to an HPLC equipped with a RP column and precolumn [Phenomenex C5l Luna (100A) C18(2) 125 9 4 mm] using step-wise gradient elution of mobile phases A, water/acetate (99:1 v/v), and B, acetonitrile/acetate (99:1 v/v), and the following gradient elution: 0 min, 76 % A, 24 % B; 0.01–5.5 min, 48 % A, 52 % B; 5.5–8.5 min, 25 % A, 75 % B; 8.5–17 min, 22 % A, 78 % B; 17–18 min, 4 % A, 96 % B; 18–22.5 min, 4 % A, 96 % B; 22.5–23 min, 96 % A, 4 % B; 23–27 min, 76 % A, 24 % B; with a total flow rate of 1.5 ml min-1. Calibrations were carried out using authentic standards (Cayman Chemicals, Tallin, Estonia).
Results and discussion Expression of gvPGHS in E. coli We used an antibiotic-free expression system which offers the advantage to cultivate the production strain without expensive selection agents. To verify an efficient expression of gvPGHS, we analyzed specific enzyme activities in cell free protein extracts of pStaby-gvPGHS transformants of E. coli SE1 by following O2 incorporation into the substrate fatty acid catalyzed by cyclooxygenase activity. We calculated the specific enzyme activity to be 3.3 kU per mg total protein (one unit represents the consumption of
Biotechnol Lett (2014) 36:2193–2198
2195
1 lmol O2 min-1 mg-1 protein), compared to almost no measureable signal in the respective control (data not shown). Using the pStaby plasmid based stabilization system permits successful over-expression of recombinant gvPGHS in E. coli, hence generating an appropriate strain for efficient biotransformation of AA to PG. In vitro biotransformation PGHS catalyzes a two-step reaction starting with a cyclization of the linear fatty acid substrate and formation of a hydroperoxy-group, followed by a reduction of the hydroperoxide to form a hydroxylgroup at the respective position. The intermediate product of the first reaction is PGG2, the final reaction product is PGH2 (Simmons et al. 2004). Since gvPGHS-mediated PG formation has so far only been confirmed indirectly by reduction of the reaction products into the more stable PGs PGF2a, E2 and D2 using SnCl2 (Kanamoto et al. 2011; Varvas et al. 2013), we carried out in vitro biotransformations of ARA by gvPGHS in cell free protein extracts. As can be seen in Fig. 1, ARA was exclusively converted in the presence of gvPGHS, forming the expected products, PGG2 and PGH2, as confirmed by comparison with authentic standards (data not shown).
Fig. 1 Biotransformation of arachidonic acid using cell free protein extracts. Batch cultivation was carried out in a total volume of 500 ml LB medium; protein expression and in vitro biotransformation were carried out as described in ‘‘Materials and methods’’ section. For biotransformation, 1 mg cell free protein extract of cells expressing gvPGHS or a respective control were incubated with 100 lM arachidonic acid (AA) and 500 lM phenol. gvPGHS-mediated conversion of AA to PGs was monitored following O2 consumption. When gvPGHS became inactive, O2 consumption stopped and samples were treated as described in ‘‘Materials and methods’’ section. For HPLC–ELSD analysis, samples were resuspended in 100 ll ethyl acetate and 5 ll were injected for analysis. Chromatograms represent one single result, representative for three independent experiments for each E. coli strain
Whole-cell biotransformation of arachidonic acid to prostaglandins Whole-cell biocatalysts offer several advantages, such as the elimination of the need for protein isolation or purification, enzyme stability, facile cofactor regeneration, as well as the ability to catalyze more sophisticated chemical transformations requiring multiple enzymes or pathways. On the other hand, bioprocesses are limited by the barrier function of cellular walls and membranes (Chen 2007). Based on earlier experiences in biotransformation of fatty acid substrates using E. coli, we carried out a 30 min incubation of the cells in the presence of Triton X100 prior to substrate addition (Kaehne et al. 2011), expecting an enhanced substrate delivery towards the enzyme by partial permeabilization of gvPGHS expressing E. coli cells, as well as improved substrate solubility through micellarisation. As can be seen in Fig. 2, there was a rapid and efficient conversion of ARA within the initial 10 min
Fig. 2 Whole-cell biotransformation of arachidonic acid using E. coli expressing gvPGHS. Batch cultivation was carried out in 2 l LB medium. For protein expression the cells were grown at 37 °C in LB medium to an OD600 of 0.6–0.7. After chilling to 16 °C, protein expression was induced by adding 0.1 mM IPTG. The cultures were incubated for 16 h at 16 °C. After harvesting, the cells were centrifuged (8,0009g, 4 °C, 15 min), washed with buffer (0.1 M Tris/HCl, pH 7.5) and re-centrifuged again. For biotransformation, cells were resuspended in 0.1 M Tris/HCl, pH 7.5, buffer at 20 g cell wet weight l-1 and transferred to baffled shake-flasks. Prior to substrate addition, 1 % Triton X100 (v/v) was added and the cells were incubated for 30 min at 25 °C with constant shaking. Following the addition of 600 lM arachidonic acid in ethanol, samples were taken periodically. Samples were treated as described in ‘‘Materials and methods’’ section. For HPLC–ELSD analysis samples were resuspended in 250 ll ethyl acetate and 10 ll were injected for analysis. Circles represent the concentration of substrate fatty acid, squares represent total prostaglandin content (PGF2a ? PGD2 ? PGE2) (mean ± SE, n = 2)
123
2196
Fig. 3 HPLC–ELSD and LC–ESI–MS/MS analysis of products formed in whole-cell biotransformation. a Bars represent concentrations of different prostaglandins formed in the biotransformation. Identification and quantification in HPLC– ELSD analysis were carried out using authentic standards. Dried samples were resuspended in ethyl acetate and 10 ll were injected for analysis. White bars represent PGF2a, dark grey bars represent PGD2, and light grey bars represent PGE2
123
Biotechnol Lett (2014) 36:2193–2198
(mean ± SE, n = 2). b LC–ESI–MS/MS based validation of natural prostaglandins formed in biotransformation experiment. Dried samples were resuspended in acetonitrile/water/formic acid (20:80:0.0025, by volume pH 4.0) and 45 ll were injected for analysis. Left-hand side chromatograms represent biotransformation samples; right-hand side chromatograms represent deuterated standards
Biotechnol Lett (2014) 36:2193–2198
of the biotransformation and an increasing amount of total PGs generated up to 20 min. Thereafter product concentration declined constantly over time, most probably due to instability of PGs in aqueous media. The fast conversion of substrate into PGs could therefore be highly beneficial with respect to recovery of the products. The maximum concentration of PGs generated de novo from ARA after 20 min was calculated to be 127.8 mg l-1. PGs formed by gvPGHS were chemically reduced using SnCl2. According to Hamberg et al. (1974), SnCl2 reduction culminates in formation of primarily PGF2a from PGG2 and PGH2. Figure 3a shows PGF2a to be the primary product within the first 10 min of the biotransformation, thereafter PGF2a content decreases. An increasing amount of PGD2, and especially PGE2, is most probably based on a known conversion of PGH2 to a mixture of PGE2 and PGD2 in acid-buffered media as shown by Andersen and Hartzell (1984) through high-field 1H-NMR studies. Both PGs are not further reduced by SnCl2 during sample treatment. Detailed analyses of the biotransformation samples using LC–ESI–MS/MS analysis, proved that products formed through gvPGHS catalysis and Sn(II)Cl treatment are indeed natural PGs of the two series (Fig. 3b). To enhance the efficiency of PG bioproduction, further efforts should be made to optimize the biotransformation conditions in order to prevent a decomposition of PGH2 into PGE2 or PGD2 in cases of PGF2a being the primary target product. Alternatively, co-expression of a selective PGH2 reducing PGE- or F-synthase would enable the synthesis of a single product in respective experiments.
Conclusions and outlook The successful application of gvPGHS in a biotechnological approach allows the rapid conversion of ARA at high rates and produces PGs in significant concentrations. Up to now 130 mg total PGs per liter could be obtained within 20 min in an as yet nonoptimized process. As to our knowledge the production costs for chemically-synthesized PGs exceed. 200 US$ g-1, the biotechnological synthesis concept appears economically viable. As the system is simple, demanding a single, recombinant gene expression in E. coli, it should be easily scalable to industrial size.
2197
Detailed product analysis confirmed the production of natural PGs. Although in medical application the bulk of pharmaceuticals contains a wide spectrum of modified PG derivatives and natural PGs are only occasionally used as in case of Dinoprostone (PGE2,) for the induction of labor (Keirse 2006), biotechnologically-produced PGs would––for the first time—open access to the synthesis of desired derivatives (Bezuglov and Serkov 2012). Acknowledgments This project has been funded by the German Federal Ministry of Economics and Technology (BMWi) via the German Federation of Industrial Research Associations ‘‘Otto von Guericke’’ e.V. (AiF) (project number 16899 N) and via Deutsche Forschungsgemeinschaft SFB 1039/Z1.
References Andersen NH, Hartzell CJ (1984) High-field 1H NMR studies of prostaglandin H2 and its decomposition pathways. Biochem Biophys Res Commun 120:512–519 Bezuglov VV, Serkov IV (2012) Selective protection of hydroxyls in natural type E and F prostaglandins. Chem Nat Compd 48:291–296 Bundy GL, Schneider WP, Lincoln FH, Pike JE (1972) The synthesis of prostaglandins E 2 and F 2a from (15R)- and (15S)-PGA 2. J Am Chem Soc 94:2123–2124 Chen RR (2007) Permeability issues in whole-cell bioprocesses and cellular membrane engineering. Appl Microbiol Biotechnol 74:730–738 Coulthard G, Erb W, Aggarwal VK (2012) Stereocontrolled organocatalytic synthesis of prostaglandin PGF2alpha in seven steps. Nature 489:278–281 Hamberg M, Svensson J, Wakabayashi T, Samuelsson B (1974) Isolation and structure of two prostaglandin endoperoxides that cause platelet aggregation. Proc Nat Acad Sci USA 71:345–349 Hejkal TW, Camras CB (1999) Prostaglandin analogs in the treatment of glaucoma. Semin Ophthalmol 14:114–123 Kaehne F, Buchhaupt M, Schrader J (2011) A recombinant alpha-dioxygenase from rice to produce fatty aldehydes using E. coli. Appl Microbiol Biotechnol 90:989–995 Kanamoto H, Takemura M, Ohyama K (2011) Identification of a cyclooxygenase gene from the red alga Gracilaria vermiculophylla and bioconversion of arachidonic acid to PGF(2alpha) in engineered Escherichia coli. Appl Microbiol Biotechnol 91:1121–1129 Keirse MJ (2006) Natural prostaglandins for induction of labor and preinduction cervical ripening. Clin Obstet Gynecol 49:609–626 Lamacˇka M, Sˇajbidor J (1997) Biotechnological production of prostaglandins. Appl Microbiol Biotechnol 47:199–206 Linke B et al (2012) Analysis of sphingolipid and prostaglandin synthesis during zymosan-induced inflammation. Prostaglandins Other Lipid Mediat 99:15–23
123
2198 Miller SB (2006) Prostaglandins in health and disease: an overview. Semin Arthritis Rheum 36:37–49 Simmons DL, Botting RM, Hla T (2004) Cyclooxygenase isozymes: the biology of prostaglandin synthesis and inhibition. Pharmacol Rev 56:387–437 Summers L (1997) Methods of cervical ripening and labor induction. J Nurse Midwifery 42:71–85 Takemura M, Kanamoto H, Nagaya S, Ohyama K (2013) Bioproduction of prostaglandins in a transgenic liverwort,
123
Biotechnol Lett (2014) 36:2193–2198 Marchantia polymorpha. Transgenic Res doi:10.1007/ s11248-013-9699-2 Varvas K, Kasvandik S, Hansen K, Ja¨rving I, Morell I, Samel N (2013) Structural and catalytic insights into the algal prostaglandin H synthase reveal atypical features of the first non-animal cyclooxygenase. Biochim Biophys Acta 1831:863–871 Yilmaz E (2001) Biotechnological production of prostaglandin. Biotechnol Adv 19:387–397
