http://informahealthcare.com/iht ISSN: 0895-8378 (print), 1091-7691 (electronic) Inhal Toxicol, 2015; 27(5): 254–261 ! 2015 Informa Healthcare USA, Inc. DOI: 10.3109/08958378.2015.1037029
RESEARCH ARTICLE
Bone marrow-derived mesenchymal stem cells attenuate phosgene-induced acute lung injury in rats Junfeng Chen1,2*, Yiru Shao1,2*, Guoxiong Xu3, ChitChoon Lim1,2, Jun Li1,2, Daojian Xu1,2, and Jie Shen1,2 Center of Emergency & Intensive Care Unit, Jinshan Hospital, Fudan University, Shanghai, China, 2Medical Center of Chemical Injury, Jinshan Hospital, Fudan University, Shanghai, China, and 3Center Laboratory, Jinshan Hospital, Fudan University, Shanghai, China
Inhalation Toxicology Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
1
Abstract
Keywords
Accidental phosgene exposure could result in acute lung injury (ALI), effective therapy is needed for the patients with phosgene-induced ALI. As a type of cells with therapeutic potential, mesenchymal stem cells (MSCs) have been showed its efficacy in multiple diseases. Here, we assessed the therapeutic potential of MSCs in phosgene-induced ALI and explored the related mechanisms. After isolation and characterization of rat bone marrow MSCs (BMMSCs), we transplanted BMMSCs into the rats exposed to phosgene and observed significant improvement on the lung wet-to-dry ratio and partial oxygen pressure (PaO2) at 6, 24, 48 h after phosgene exposure. Histological analyses revealed reduced sign of pathological changes in the lungs. Reduced level of pro-inflammatory tumor necrosis factor a and increased level of antiinflammatory factor interleukin-10 were found in both bronchoalveolar lavage and plasma. Significant increased expression of epithelial cell marker AQP5 and SP-C was also found in the lung tissue. In conclusion, treatment with MSC markedly decreases the severity of phosgeneinduced ALI in rats, and these protection effects were closely related to the pulmonary air blood barrier repairment and inflammatory reaction regulation.
Acute lung injury, mesenchymal stem cells, phosgene, therapy
Introduction Phosgene is a highly reactive electrophilic gas which was once used in World War I as a chemical weapon. Currently, phosgene is an important industrial material and is widely used in the manufacturing of dyestuffs, acid chlorides, isocyanates, pharmaceuticals, polycarbonates, polyurethanes, carbamates and related pesticides (Borak & Diller, 2001). Accidental phosgene inhalation could result in acute lung injury (ALI) and even fatal acute respiratory distress syndrome in some condition (Pauluhn et al., 2007). Exploration of specific and effective therapy is necessary in the treatment of phosgene-induced lung injury. According to previous reports (Pauluhn et al., 2007), two pathological processes including primary lung injury and secondary lung injury were involved in the phosgene-induced lung injury. Of them, primary injury included direct injury on lung air–blood barrier, such as the injuries to lung epithelial cells, lung capillary endothelial cells and intercellular junction. Secondary injury included consequential inflammatory reactions after primary injury. Therefore, the exploration of
*These authors contributed equally to this work. Address for correspondence: Jie Shen, Center of Emergency & Intensive Care Unit, 1508 Longhang Road, Jinshan Hospital, Fudan University, Shanghai 201508, China. E-mail: [email protected]
History Received 20 January 2015 Revised 24 March 2015 Accepted 29 March 2015 Published online 13 May 2015
specific and effective therapy targeting these two processes is necessary in the treatment of phosgene-induced lung injury. Mesenchymal stem cells (MSCs) are a type of heterogeneous pluripotent progenitor cells derived from various adult tissues and organs including bone marrow, fat, umbilical cord (Djouad et al., 2003). MSCs also exhibit the ability of maintenance and regeneration of various types through differentiation to multiple lineages of mesenchymal tissues, including adipose tissue, bone, cartilage and muscle (Klopp et al., 2011). Furthermore, recent studies have also shown that newly injected MSCs usually redistribute to inflammatory tissues/organs (Kucerova et al., 2010; Liu et al., 2011; Roorda et al., 2009), and MSCs have shown their therapeutic effect in the endotoxin-induced lung injury (Gupta et al., 2007). In a bleomycin-induced lung injury model, Ortiz et al. showed that MSCs exerted their protection effect via homing to lung, adopting an epithelium-like phenotype and decreasing inflammation and collagen deposition in lung tissue (Ortiz et al., 2003, 2007). In a further study conducted by Hoffman et al. (2011), systemically administered MSCs could differentiate to pulmonary epithelial cells and endothelial cells in the setting of belomycin-induced lung injury. Taking together, differentiation to pulmonary epithelial cells and endothelial cells would facilitate the blood gas recovery and ultimately result in healing of the lung injury. Furthermore, MSCs could also decrease the systemic and local inflammatory reactions in endotoxin-induced lung
Inhalation Toxicology Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
DOI: 10.3109/08958378.2015.1037029
injury via immune response regulation. Several studies have shown that MSCs could decrease the plasma level of TNF-a and IL-1 through paracrine secretion of soluble TNF receptor and IL-1 receptor antagonist (Wang et al., 2013; Yagi et al., 2010). Moreover, blockage of NF-kB signaling was considered as a effective therapeutic choice in the setting of MSCs transplantation, and attenuation of granulocyte inflammatory reactions and pulmonary edema was attributed to the mechanisms (Aoki et al., 2011; Cheng et al., 2007). In addition, blockage of NF-kB signaling by MSCs transplantation could also lead to decrease pro-inflammatory cytokines (e.g. TNF-a and IL-6) and increase anti-inflammatory cytokines (e.g. IL-10) (Tian et al., 2013). Therefore, two main mechanisms were involved in the lung injury recovery effect exerted by MSCs: (1) Homing to the inflammatory site, differentiation to epithelial and endothelial cells and exerting repair effect to the air blood barrier; (2) Protection of the secondary lung injury through inflammation regulation. Currently, no report has focused on the role of MSCs in chemical related lung injury. If the above mechanisms were also accounted for the protection effect exerted by MSCs, the use of MSCs could be explored to chemical related lung injury and a more physiological therapeutic choice could be obtained. Therefore, MSCs may be used as a novel therapy choice in the treatment of lung injury. However, the role of MSCs in phosgene-induced ALI has not been evaluated yet. Here, we presented a study to verify the therapeutic role of MSCs in the treatment of phosgene-induced ALI. We found that bone marrow MSCs (BMMSCs) can alleviate the severity of the symptoms of ALI. We also determined that attenuated inflammatory reactions and the recovery of lung air blood barrier were attributed to the mechanisms.
Materials and methods Ethical approval of the study protocol The study protocol was approved by the Institutional Animal Care and Use Committee of Jinshan Hospital, Fudan University and adheres to generally accepted international guidelines for animal experimentation. Animals Adult male Sprague–Dawley (SD) rats (weighing 180–220 g, 4–6 weeks old) were purchased from the Experimental Animal Center of the Second Military University, China, and were maintained in cages at temperature of 24–26 C under a 12 h light/dark cycle with free access to food and water. Isolation and characterization of rat bone marrow MSCs BMMSCs of male SD rats were isolated according to previous description (Kamiya et al., 2013). Gradient centrifugation (900 g, 30 min) was performed by Ficoll method to obtain the mononuclear cells. Then the cells were washed, counted and plated at a density of 2.0 105/cm2 into 75 cm2 tissue culture flasks (Corning, NY) in low-glucose Dulbecco modified Eagle medium (LG-DMEM; Invitrogen, CA) supplemented with 20% fetal bovine serum (FBS; Hyclone, UT). Medium
BMMSCs attenuate phosgene-induced ALI in rats
255
was changed at the 3rd day after initial seeding and was replaced every 3 days thereafter. When 80% confluent, the cells were split with a ratio of 1:4. A homogenous cell population was observed after 10 days of the culture. In the setting of BMMSCs transplantation, rat BMMSCs were infected with green fluorescence protein (GFP) expressing adenovirus. The adenovirus used here was purchased from Agilent Technologies and the infection was carried out according to the manufacturer’s instructions. MSCs were also tested for their ability to differentiate to adipocytes and osteoblasts. Adipocytic differentiation was induced by DMEM containing 10% FBS, 0.5 mM isobutylmethylxanthine, 5 mg/mL insulin, 1 mM dexamethasone and 60 mM indomethacin, whereas 1 mM b-glycerol phosphate, 0.1 mM dexamethasone and 50 mM ascorbate were used for osteoblastic differentiation. Oil red O and von Kossa dyes were used to identify adipocytes and osteoblasts, respectively. The identity of MSCs was also confirmed by immunophenotypic criteria based on the expression of CD29, CD44, CD 90 and the absence of hematopoietic (with anti-CD45, -CD34 antibodies) and major histocompatibility complex markers. Grouping and treatment Adult male rats were randomly divided into five groups as follows: Control group (normal air + PBS, K, n ¼ 8), phosgene group (phosgene, PH, n ¼ 8), phosgene control group (phosgene + PBS, PB, n ¼ 8), phosgene + MSCs group (phosgene + MSCs, PM, n ¼ 8) and air + MSCs (normal air + MSCs, KM, n ¼ 8). After grouping, these rats were exposed to either normal room air (control group) or a concentration of 8.33 mg/L phosgene (phosgene-exposed group) for 5 min and 1 106 GFP expressing BMMSCs were infused immediately through tail vein injection. The rats in these five groups were sacrificed at the time point of 6, 24 and 48 h post-exposure to evaluate the severity of the ALI. Bronchoalveolar lavage BAL was performed with the whole lung. Two milliliters aliquots of 37 C, sterile, pyrogen-free, 0.9% saline were flushed through the tracheotomy tube and this process was repeated for five times. The five fractions were recovered and pooled. The total number of cells was counted using a standard hemocytometer. The BAL fluid (BALF) was then centrifuged at600g for 5 min. The supernatant was collected and stored at 80 C. Protein quantification was determined by using BCA Protein Assay Kit (Pierce, Rockford, IL). Wet-to-dry lung weight ratio The wet-to-dry lung weight ratio (W:D ratio) was calculated by dividing the wet weight by the dry weight. Arterial blood gases measurement Arterial blood gases (arterial partial pressure of oxygen [PaO2]) were determined in blood samples collected with sterile vented plastic syringes (PICO 70, Radiometer, Copenhagen, Denmark) and measured at the times after phosgene exposure at 6, 24 and 48 h using an automatic AVLCompact3 device (Roche Diagnostic, Mannheim, Germany).
256
J. Chen et al.
Inhal Toxicol, 2015; 27(5): 254–261
Histology Lungs from the different treatment group were collected 6, 24, 48 h after phosgene-induced lung injury and fixed with 10% formalin. After fixation, the lungs were embedded in paraffin, cut into 5 mm section and stained with hematoxylin–eosin staining (H&E staining). In the setting of MSC engraftment evaluation, the lungs were embedded in OCT and frozen at 80 C before processing. After cutting into 5 mm section, the expression of GFP was observed under a fluorescence microscopy (Zeiss, Gottingen, Germany).
Inhalation Toxicology Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
Measurement of IL-10 and TNF-a The concentrations of interleukin 10 (IL-10) and Tumor necrosis factor-a (TNF-a) in BALF were quantified by enzyme-linked immunosorbent assay (ELISA), using standard commercially available ELISA kits (R&D Systems, Minneapolis, MN).
Real-time reverse transcription-polymerase chain reaction (RT-PCR) Lungs were retrieved from rats immediately after killing and rinsed extensively. Total cellular RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA). RT-PCR was carried out using a One Step SYBRÕ PrimeScriptÔ RT-PCR kit (Takara, Dalian, China) and an iQ5 Real-time PCR Detection system (Bio-Rad, Hercules, CA). Expression of the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene was assessed simultaneously in all samples as an internal control. Relative gene expression was determined by the 2DDCT method. Oligonucleotide primers specific for Aquaporin-5 (AQP5), surfactant protein (SP)-C and GAPDH are listed in Table 1. Statistical analysis All statistical analyses were performed using the SPSS13.0 software (SPSS Inc., Chicago, IL). The results were presented as means ± standard deviation (SD). One way ANOVA was used to examine the differences between groups. p50.05 was considered as statistically significance.
Table 1. Primer sequence of the genes.
Results Gene name
Forward primer (50 –30 )
Reverse primer (50 –30 )
AQP-5 SP-C GAPDH
gcgctcagcaacaacacaac gcccaccggattactcgac gacatgccgcctggagaaac
gtgtgaccgacaagccaatg tgactcatgtgaaggcccat agcccaggatgccctttagt
Rat BMMSCs isolation and characterization The morphology, differentiation abilities and the phenotype of the rat BMMSCs are shown in Figure 1. The cell showed
Figure 1. Isolation and characterization of rat bone marrow-derived mesenchymal stem cells (BMMSCs). (A) Primary culture cell morphology after seeding (100); (B) Primary culture cell morphology at 24 h after seeding (100); (C) Primary culture cell morphology on Day 10 after seeding (100); (D) Passage 3 cell morphology (100); (E) (100) and (F) (200). Alizarin red staining of osteo-induced BMMSCs; (G) (100) and (H) (200). Red oil O staining of adipo-induced BMMSCs; (I) Immune-phenotype of BMMSCs (negative on CD34, CD45 and positive on CD29, CD44, CD90).
Inhalation Toxicology Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
DOI: 10.3109/08958378.2015.1037029
BMMSCs attenuate phosgene-induced ALI in rats
257
Figure 2. Bone marrow derived-mesenchymal stem cells (BMMSCs) improve the lung wet-to-dry ratio and partial arterial oxygen pressure (PaO2) in phosgene-induced lung injury. (A) BMMSCs significantly decreased lung wet-to-dry ratio when compared with the phosgene-induced lung injury group at different time points (6, 24 and 48 h); (B) BMMSCs significantly increased PaO2 when compared with the phosgene-induced lung injury group at different time points (6, 24 and 48 h). *Represents p50.05 when compared with the phosgene + PBS group; yrepresents p50.05 when compared with the air + MSCs group.
typical fibroblast morphology and needed about 10 days to reach 80–90% confluence (Figure 1A–D). Alizarinread staining and red oil O staining confirmed the osteogenesis (Figure 1E–F) and adipogenesis (Figure 1G–H) of the cell. The phenotype of the cells was determined by flow cytometry analyses (Figure 1I). The cell was stained positive on CD29, CD 44, CD 90 and negative on CD34, CD 45. All the features of the BMSCs showed here were consistent with the previous publication. BMMSCs improved severity of lung injury Rats given BMMSCs showed a decreased trend of lung wet-to-dry ratio at 6 (5.06 ± 0.11 versus 6.02 ± 0.74), 24 (4.75 ± 0.06 versus 4.91 ± 0.10) and 48 h (4.70 ± 0.04 versus 4.68 ± 0.08) when compared with the phosgene group (Figure 2A). Moreover, an increased level of PaO2 was found in rats receiving BMMSCs at 6 (69.63 ± 2.62 versus 59.13 ± 3.72 mmHg), 24 (74.50 ± 1.85 versus 70.00 ± 1.77 mmHg) and 48 h (71.75 ± 2.12 versus 79.75 ± 2.12 mmHg) when compared with the phosgene group (Figure 2B). Histology At 6, 24 and 48 h, H&E staining of lung section from the BMMSCs-treated rats had significantly decreased injury, such as pulmonary edema, hemorrhage and leukocytes infiltration into alveoli compared with rats in the phosgene group (Figure 3). Moreover, engraftment was also assessed and BMMSC expressing GFP was observed scattered through the lungs of mice treated with the cells; however, only a small proportion of cells was engrafted into lung at 6, 24 and 48 h. Besides, no BMMSCs cluster was found in the lung parenchyma (Figure 4). The rats in the phosgene group and air control group showed no trace of GFP-stained cells.
BMMSCs decreased levels of pro-inflammatory cytokines and increased anti-inflammatory cytokines phosgene injury The levels of TNF-a in the BAL were significantly lower in the BMMSCs-treated rats compared with the phosgene-treated control rats (Figure 5A) at 6 (76.63 ± 10.63 versus 100.54 ± 10.50 pg/mL), 24 (64.08 ± 11.02 versus 87.07 ± 11.24 pg/mL) and 48 h (51.46 ± 8.00 versus 70.90 ± 10.48 pg/mL), whereas TNF-a in the plasma were also significantly lower in the BMMSCs-treated rats compared with the phosgene-treated control rats at 6 (61.56 ± 10.61 versus 75.19 ± 11.67 pg/mL), 24 (46.44 ± 7.20 versus 61.82 ± 10.61 pg/mL) and 48 h (39.28 ± 8.20 versus 49.20 ± 6.86 pg/ mL) (Figure 5B). In addition, the anti-inflammatory cytokine IL-10 in BAL was significantly increased in the BMMSCs-treated rats compared with the phosgene-treated control rats (Figure 5C) at 6 (89.12 ± 7.33 versus 69.99 ± 7.80 pg/mL), 24 (72.16 ± 8.20 versus 63.65 ± 4.68 pg/mL) and 48 h (62.19 ± 7.82 versus 56.98 ± 6.78 pg/mL), whereas IL-10 in the plasma were also significantly higher in the BMMSCs-treated rats compared with the phosgene-treated control rats at 6 (64.60 ± 6.61 versus 54.85 ± 4.63 pg/mL), 24 (54.21 ± 5.98 versus 45.99 ± 3.88 pg/mL) and 48 h (49.17 ± 2.66 versus 42.56 ± 6.17 pg/mL) (Figure 5D).
BMMSCs increased the expression of epithelial cell marker AQP5 and SP-C mRNA We also examined the gene expression of the epithelial cell surface marker AQP5 and SP-C mRNA. The expression of the epithelial cell surface marker AQP5 and SP-C mRNA was significantly increased in the BMMSCs-treated rats compared with the phosgene-treated control rats at 6, 24 and 48 h (Figure 6).
258
J. Chen et al.
Inhal Toxicol, 2015; 27(5): 254–261
Inhalation Toxicology Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
Figure 3. Bone marrow-derived mesenchymal stem cells (BMMSCs) improve the severity of phosgene-induced lung injury. H&E staining of lung sections demonstrated attenuated lung injury in the BMMSCs-treated group versus phosgene group at different time points (6, 24 and 48 h) (100).
Discussion Recently, MSCs have been shown to exert beneficial effect in ALI through homing to the lung injury site and ameliorate lung injury in situ (Gupta et al., 2007; Rojas et al., 2005). Mechanisms for this protection not only included tissue repair, such as engraftment and differentiation of MSCs into specific lung cell types, but also included immunomodulation, the latter being associated with regulation levels of proor anti-inflammatory cytokines and formation of the microenviroment for tissue repair (Gupta et al., 2007;
Mei et al., 2007; Rojas et al., 2005; Xu et al., 2007). Previously, we have shown that Ulinastatin reduces pathogenesis of phosgene-induced ALI in rats via decreasing the infiltration of blood cells and reducing pro-inflammatory cytokines (Shen et al., 2014). Moreover, we also showed that adenovirus-delivered angiopoietin-1 attenuates inflammatory responses in phosgene-induced ALI through suppression of NF-kB and p38 MAPK signaling (He et al., 2014). However, optimal therapy is still urgent for the treatment of phosgeneinduced lung injury.
DOI: 10.3109/08958378.2015.1037029
BMMSCs attenuate phosgene-induced ALI in rats
259
Inhalation Toxicology Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
Figure 4. Engraftment of the adenovirus green fluorescent protein (GFP) transduced bone marrow-derived mesenchymal stem cells (BMMSCs) in the lung.
Figure 5. Decreased level of the pro-inflammatory cytokine tumor necrosis factor (TNF)-a and increased level of interleukin-10 (IL-10) were found in rats receiving bone marrow derived mesenchymal stem cells (BMMSCs). #Represents p50.05 when compared with the air control group; *represents p50.05 when compared with the phosgene + PBS group; yrepresents p50.05 when compared with the air + MSCs group.
260
J. Chen et al.
Inhal Toxicol, 2015; 27(5): 254–261
Inhalation Toxicology Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
Figure 6. Real-time reverse polymerase chain reaction showed the expression of the epithelial cell marker SP-C and AQP5. #Represents p50.05 when compared with the air + MSCs group (KM); *represents p50.05 when compared with the phosgene group (PH); ***represents p50.01 when compared with the phosgene group. PM represents the phosgene + MSC group.
Recent studies have shown that MSCs could improve the injury, despite the level of MSC engraftment of 55% at 48 h after injury (Gupta et al., 2007). In the present study, the low level of engraftment seen is consistent with prior studies. We found that intravenous administration of MSCs can ameliorated the severity of lung injury according to the lung wet-to-dry ratio, PaO2 and histopathological analysis. Decreased level of pro-inflammatory factor TNF-a, increased level of anti-inflammatory IL-10, restoration of the epithelial cells were involved in the mechanisms. To the best of our knowledge, this is the first report about the therapeutic evaluation of MSCs in phosgene-induced ALI. Previous in vivo studies have shown that phosgene exposure could result in pathophysiological changes in the lung especially in the bronchoalveolar region (Duniho et al., 2002). The severity of the lung injury was characterized by pulmonary edema, hemorrhage and leukocytes infiltration into alveoli (Lucas et al., 2009; Xu et al., 2011). Here we employed the lung wet-to-dry ratio, PaO2 and histological section to reflect these pathological changes. At 6, 24 and 48 h of post-exposure, we observed significantly increased level of lung wet-to-dry ratio, decreased level of PaO2 and pathological changes (pulmonary edema, hemorrhage and leukocytes infiltration into alveoli),which demonstrated the acute damage in the lung after exposure to phosgene. In the rats receiving MSCs, we found a less severe degree of lung injury proved by decreased level of lung wet-to-dry ratio, increased level of PaO2. Decreased level of lung injury on pulmonary edema, hemorrhage and leukocytes infiltration into alveoli was also observed on the histological sections. According to the recent literatures reporting the immunomodulatory properties of MSCs (Aggarwal & Pittenger, 2005; Corcione et al., 2006; Glennie et al., 2005; Krampera et al., 2006), we hypothesized that down-regulation of the proinflammatory response to phosgene could be mediated by the treatment of MSCs. Analysis of the BAL and plasma sample from the BMMSCs-treated and phosgene control rats demonstrated that reduced level of TNF-a was found in the BMMSCs-treated rats. Moreover, MSCs were also reported to exert immunomodulatory properties through up regulation of the anti-inflammatory cytokines. We also assessed the level of IL-10 in the setting of BMMSCs treatment. The analyses of the BAL and plasma sample revealed that BMMSCs
treatment could significantly increase the level of IL-10, which was consistent with the reports demonstrating that MSCs increase production of IL10 through the interaction with antigen presenting cells (Beyth et al., 2005). Furthermore, this results may suggest an important mechanism through which MSC exert their beneficial effect because the protective role of IL-10 in lung inflammation has been well-described (Shanley et al., 2000; Spight et al., 2005). In our phosgene-induced lung injury model, significant increased level of PaO2 was found when compared with the air control group, which indicated that destruction of the lung blood–gas barrier. As an important component of lung blood– gas barrier, pulmonary epithelium plays a critical role in the sodium and chloride transportation and the pathological changes on pulmonary epithelium could result in pulmonary edema (Matthay et al., 2005). AQP5, a major water channel in lung epithelial cells, plays an important role in maintaining water homeostasis in the lungs. Dyregulation of AQP5 can lead to increased plasma membrane water permeability in lung epithelial (Ohinata et al., 2005). We here also assessed the expression of AQP5 in lung tissues and our results showed that increased level of AQP5 was found after the BMMSCs treatment. In addition, previous studies have shown that pulmonary SP-C, an innate immune molecule and presented in alveolar type II cells, could modify lipopolysaccharide (LPS)-induced cell responses (Glasser et al., 2013). We here also examined the expression of SP-C and increased expression of SP-C could be detected in the BMMSCs-treated rats. These findings might compare the similarity between phosgene- and endotoxin-induced lung injury in the further studies. In conclusion, our studies demonstrated for the first time about the therapeutic role exerted by MSCs in phosgeneinduced ALI. The regulation of the pro-inflammatory and anti-inflammatory cytokine level was accounted for the mechanisms. Furthermore, the expression of pulmonary epithelial function related genes AQP5 and SP-C was also involved in the treatment process by MSCs.
Declaration of interest This work was funded by National Natural Science Foundation of China (81471850), National Natural Science
BMMSCs attenuate phosgene-induced ALI in rats
DOI: 10.3109/08958378.2015.1037029
Foundation of China (81101412), and Science and Technology Commission of Shanghai Municipality (11JC1401900).
Inhalation Toxicology Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
References Aggarwal S, Pittenger MF. (2005). Human mesenchymal stem cells modulate allogeneic immune cell responses. Blood 105:1815–22. Aoki T, Nishimura M, Matsuoka T, et al. (2011). PGE(2)-EP(2) signalling in endothelium is activated by haemodynamic stress and induces cerebral aneurysm through an amplifying loop via NFkappaB. Br J Pharmacol 163:1237–49. Beyth S, Borovsky Z, Mevorach D, et al. (2005). Human mesenchymal stem cells alter antigen-presenting cell maturation and induce T-cell unresponsiveness. Blood 105:2214–19. Borak J, Diller WF. (2001). Phosgene exposure: mechanisms of injury and treatment strategies. J Occup Environ Med 43:110–19. Cheng DS, Han W, Chen SM, et al. (2007). Airway epithelium controls lung inflammation and injury through the NF-kappa B pathway. J Immunol 178:6504–13. Corcione A, Benvenuto F, Ferretti E, et al. (2006). Human mesenchymal stem cells modulate B-cell functions. Blood 107:367–72. Djouad F, Plence P, Bony C, et al. (2003). Immunosuppressive effect of mesenchymal stem cells favors tumor growth in allogeneic animals. Blood 102:3837–44. Duniho SM, Martin J, Forster JS, et al. (2002). Acute changes in lung histopathology and bronchoalveolar lavage parameters in mice exposed to the choking agent gas phosgene. Toxicol Pathol 30: 339–49. Glasser SW, Maxfield MD, Ruetschilling TL, et al. (2013). Persistence of LPS-induced lung inflammation in surfactant protein-C-deficient mice. Am J Respir Cell Mol Biol 49:845–54. Glennie S, Soeiro I, Dyson PJ, et al. (2005). Bone marrow mesenchymal stem cells induce division arrest anergy of activated T cells. Blood 105:2821–7. Gupta N, Su X, Popov B, et al. (2007). Intrapulmonary delivery of bone marrow-derived mesenchymal stem cells improves survival and attenuates endotoxin-induced acute lung injury in mice. J Immunol 179:1855–63. He DK, Shao YR, Zhang L, et al. (2014). Adenovirus-delivered angiopoietin-1 suppresses NF-kappaB and p38 MAPK and attenuates inflammatory responses in phosgene-induced acute lung injury. Inhal Toxicol 26:185–92. Hoffman AM, Paxson JA, Mazan MR, et al. (2011). Lung-derived mesenchymal stromal cell post-transplantation survival, persistence, paracrine expression, and repair of elastase-injured lung. Stem Cells Dev 20:1779–92. Kamiya N, Ueda M, Igarashi H, et al. (2013). In vivo monitoring of arterially transplanted bone marrow mononuclear cells in a rat transient focal brain ischemia model using magnetic resonance imaging. Neurol Res 35:573–9. Klopp AH, Gupta A, Spaeth E, et al. (2011). Concise review: dissecting a discrepancy in the literature: do mesenchymal stem cells support or suppress tumor growth? Stem Cells 29:11–19. Krampera M, Pasini A, Pizzolo G, et al. (2006). Regenerative and immunomodulatory potential of mesenchymal stem cells. Curr Opin Pharmacol 6:435–41. Kucerova L, Matuskova M, Hlubinova K, et al. (2010). Tumor cell behaviour modulation by mesenchymal stromal cells. Mol Cancer 9:129.
261
Liu S, Ginestier C, Ou SJ, et al. (2011). Breast cancer stem cells are regulated by mesenchymal stem cells through cytokine networks. Cancer Res 71:614–24. Lucas R, Verin AD, Black SM, Catravas JD. (2009). Regulators of endothelial and epithelial barrier integrity and function in acute lung injury. Biochem Pharmacol 77:1763–72. Matthay MA, Robriquet L, Fang X. (2005). Alveolar epithelium: role in lung fluid balance and acute lung injury. Proc Am Thorac Soc 2: 206–13. Mei SH, McCarter SD, Deng Y, et al. (2007). Prevention of LPS-induced acute lung injury in mice by mesenchymal stem cells overexpressing angiopoietin 1. PLoS Med 4:e269. Ohinata A, Nagai K, Nomura J, et al. (2005). Lipopolysaccharide changes the subcellular distribution of aquaporin 5 and increases plasma membrane water permeability in mouse lung epithelial cells. Biochem Biophys Res Commun 326:521–6. Ortiz LA, Dutreil M, Fattman C, et al. (2007). Interleukin 1 receptor antagonist mediates the antiinflammatory and antifibrotic effect of mesenchymal stem cells during lung injury. Proc Natl Acad Sci USA 104:11002–7. Ortiz LA, Gambelli F, McBride C, et al. (2003). Mesenchymal stem cell engraftment in lung is enhanced in response to bleomycin exposure and ameliorates its fibrotic effects. Proc Natl Acad Sci USA 100: 8407–11. Pauluhn J, Carson A, Costa DL, et al. (2007). Workshop summary: phosgene-induced pulmonary toxicity revisited: appraisal of early and late markers of pulmonary injury from animal models with emphasis on human significance. Inhal Toxicol 19:789–810. Rojas M, Xu J, Woods CR, et al. (2005). Bone marrow-derived mesenchymal stem cells in repair of the injured lung. Am J Respir Cell Mol Biol 33:145–52. Roorda BD, ter Elst A, Kamps WA, de Bont ES. (2009). Bone marrowderived cells and tumor growth: contribution of bone marrow-derived cells to tumor micro-environments with special focus on mesenchymal stem cells. Crit Rev Oncol Hematol 69:187–98. Shanley TP, Vasi N, Denenberg A. (2000). Regulation of chemokine expression by IL-10 in lung inflammation. Cytokine 12: 1054–64. Shen J, Gan Z, Zhao J, et al. (2014). Ulinastatin reduces pathogenesis of phosgene-induced acute lung injury in rats. Toxicol Ind Health 30: 785–93. Spight D, Zhao B, Haas M, et al. (2005). Immunoregulatory effects of regulated, lung-targeted expression of IL-10 in vivo. Am J Physiol Lung Cell Mol Physiol 288:L251–65. Tian Z, Li Y, Ji P, et al. (2013). Mesenchymal stem cells protects hyperoxia-induced lung injury in newborn rats via inhibiting receptor for advanced glycation end-products/nuclear factor kappaB signaling. Exp Biol Med (Maywood) 238:242–7. Wang YY, Li XZ, Wang LB. (2013). Therapeutic implications of mesenchymal stem cells in acute lung injury/acute respiratory distress syndrome. Stem Cell Res Ther 4:45. Xu J, Woods CR, Mora AL, et al. (2007). Prevention of endotoxininduced systemic response by bone marrow-derived mesenchymal stem cells in mice. Am J Physiol Lung Cell Mol Physiol 293: L131–41. Xu YN, Zhang Z, Ma P, Zhang SH. (2011). Adenovirus-delivered angiopoietin 1 accelerates the resolution of inflammation of acute endotoxic lung injury in mice. Anesth Analg 112:1403–10. Yagi H, Soto-Gutierrez A, Navarro-Alvarez N, et al. (2010). Reactive bone marrow stromal cells attenuate systemic inflammation via sTNFR1. Mol Ther 18:1857–64.
Supplementary material available online Supplementary Figure S1
RESEARCH ARTICLE
Bone marrow-derived mesenchymal stem cells attenuate phosgene-induced acute lung injury in rats Junfeng Chen1,2*, Yiru Shao1,2*, Guoxiong Xu3, ChitChoon Lim1,2, Jun Li1,2, Daojian Xu1,2, and Jie Shen1,2 Center of Emergency & Intensive Care Unit, Jinshan Hospital, Fudan University, Shanghai, China, 2Medical Center of Chemical Injury, Jinshan Hospital, Fudan University, Shanghai, China, and 3Center Laboratory, Jinshan Hospital, Fudan University, Shanghai, China
Inhalation Toxicology Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
1
Abstract
Keywords
Accidental phosgene exposure could result in acute lung injury (ALI), effective therapy is needed for the patients with phosgene-induced ALI. As a type of cells with therapeutic potential, mesenchymal stem cells (MSCs) have been showed its efficacy in multiple diseases. Here, we assessed the therapeutic potential of MSCs in phosgene-induced ALI and explored the related mechanisms. After isolation and characterization of rat bone marrow MSCs (BMMSCs), we transplanted BMMSCs into the rats exposed to phosgene and observed significant improvement on the lung wet-to-dry ratio and partial oxygen pressure (PaO2) at 6, 24, 48 h after phosgene exposure. Histological analyses revealed reduced sign of pathological changes in the lungs. Reduced level of pro-inflammatory tumor necrosis factor a and increased level of antiinflammatory factor interleukin-10 were found in both bronchoalveolar lavage and plasma. Significant increased expression of epithelial cell marker AQP5 and SP-C was also found in the lung tissue. In conclusion, treatment with MSC markedly decreases the severity of phosgeneinduced ALI in rats, and these protection effects were closely related to the pulmonary air blood barrier repairment and inflammatory reaction regulation.
Acute lung injury, mesenchymal stem cells, phosgene, therapy
Introduction Phosgene is a highly reactive electrophilic gas which was once used in World War I as a chemical weapon. Currently, phosgene is an important industrial material and is widely used in the manufacturing of dyestuffs, acid chlorides, isocyanates, pharmaceuticals, polycarbonates, polyurethanes, carbamates and related pesticides (Borak & Diller, 2001). Accidental phosgene inhalation could result in acute lung injury (ALI) and even fatal acute respiratory distress syndrome in some condition (Pauluhn et al., 2007). Exploration of specific and effective therapy is necessary in the treatment of phosgene-induced lung injury. According to previous reports (Pauluhn et al., 2007), two pathological processes including primary lung injury and secondary lung injury were involved in the phosgene-induced lung injury. Of them, primary injury included direct injury on lung air–blood barrier, such as the injuries to lung epithelial cells, lung capillary endothelial cells and intercellular junction. Secondary injury included consequential inflammatory reactions after primary injury. Therefore, the exploration of
*These authors contributed equally to this work. Address for correspondence: Jie Shen, Center of Emergency & Intensive Care Unit, 1508 Longhang Road, Jinshan Hospital, Fudan University, Shanghai 201508, China. E-mail: [email protected]
History Received 20 January 2015 Revised 24 March 2015 Accepted 29 March 2015 Published online 13 May 2015
specific and effective therapy targeting these two processes is necessary in the treatment of phosgene-induced lung injury. Mesenchymal stem cells (MSCs) are a type of heterogeneous pluripotent progenitor cells derived from various adult tissues and organs including bone marrow, fat, umbilical cord (Djouad et al., 2003). MSCs also exhibit the ability of maintenance and regeneration of various types through differentiation to multiple lineages of mesenchymal tissues, including adipose tissue, bone, cartilage and muscle (Klopp et al., 2011). Furthermore, recent studies have also shown that newly injected MSCs usually redistribute to inflammatory tissues/organs (Kucerova et al., 2010; Liu et al., 2011; Roorda et al., 2009), and MSCs have shown their therapeutic effect in the endotoxin-induced lung injury (Gupta et al., 2007). In a bleomycin-induced lung injury model, Ortiz et al. showed that MSCs exerted their protection effect via homing to lung, adopting an epithelium-like phenotype and decreasing inflammation and collagen deposition in lung tissue (Ortiz et al., 2003, 2007). In a further study conducted by Hoffman et al. (2011), systemically administered MSCs could differentiate to pulmonary epithelial cells and endothelial cells in the setting of belomycin-induced lung injury. Taking together, differentiation to pulmonary epithelial cells and endothelial cells would facilitate the blood gas recovery and ultimately result in healing of the lung injury. Furthermore, MSCs could also decrease the systemic and local inflammatory reactions in endotoxin-induced lung
Inhalation Toxicology Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
DOI: 10.3109/08958378.2015.1037029
injury via immune response regulation. Several studies have shown that MSCs could decrease the plasma level of TNF-a and IL-1 through paracrine secretion of soluble TNF receptor and IL-1 receptor antagonist (Wang et al., 2013; Yagi et al., 2010). Moreover, blockage of NF-kB signaling was considered as a effective therapeutic choice in the setting of MSCs transplantation, and attenuation of granulocyte inflammatory reactions and pulmonary edema was attributed to the mechanisms (Aoki et al., 2011; Cheng et al., 2007). In addition, blockage of NF-kB signaling by MSCs transplantation could also lead to decrease pro-inflammatory cytokines (e.g. TNF-a and IL-6) and increase anti-inflammatory cytokines (e.g. IL-10) (Tian et al., 2013). Therefore, two main mechanisms were involved in the lung injury recovery effect exerted by MSCs: (1) Homing to the inflammatory site, differentiation to epithelial and endothelial cells and exerting repair effect to the air blood barrier; (2) Protection of the secondary lung injury through inflammation regulation. Currently, no report has focused on the role of MSCs in chemical related lung injury. If the above mechanisms were also accounted for the protection effect exerted by MSCs, the use of MSCs could be explored to chemical related lung injury and a more physiological therapeutic choice could be obtained. Therefore, MSCs may be used as a novel therapy choice in the treatment of lung injury. However, the role of MSCs in phosgene-induced ALI has not been evaluated yet. Here, we presented a study to verify the therapeutic role of MSCs in the treatment of phosgene-induced ALI. We found that bone marrow MSCs (BMMSCs) can alleviate the severity of the symptoms of ALI. We also determined that attenuated inflammatory reactions and the recovery of lung air blood barrier were attributed to the mechanisms.
Materials and methods Ethical approval of the study protocol The study protocol was approved by the Institutional Animal Care and Use Committee of Jinshan Hospital, Fudan University and adheres to generally accepted international guidelines for animal experimentation. Animals Adult male Sprague–Dawley (SD) rats (weighing 180–220 g, 4–6 weeks old) were purchased from the Experimental Animal Center of the Second Military University, China, and were maintained in cages at temperature of 24–26 C under a 12 h light/dark cycle with free access to food and water. Isolation and characterization of rat bone marrow MSCs BMMSCs of male SD rats were isolated according to previous description (Kamiya et al., 2013). Gradient centrifugation (900 g, 30 min) was performed by Ficoll method to obtain the mononuclear cells. Then the cells were washed, counted and plated at a density of 2.0 105/cm2 into 75 cm2 tissue culture flasks (Corning, NY) in low-glucose Dulbecco modified Eagle medium (LG-DMEM; Invitrogen, CA) supplemented with 20% fetal bovine serum (FBS; Hyclone, UT). Medium
BMMSCs attenuate phosgene-induced ALI in rats
255
was changed at the 3rd day after initial seeding and was replaced every 3 days thereafter. When 80% confluent, the cells were split with a ratio of 1:4. A homogenous cell population was observed after 10 days of the culture. In the setting of BMMSCs transplantation, rat BMMSCs were infected with green fluorescence protein (GFP) expressing adenovirus. The adenovirus used here was purchased from Agilent Technologies and the infection was carried out according to the manufacturer’s instructions. MSCs were also tested for their ability to differentiate to adipocytes and osteoblasts. Adipocytic differentiation was induced by DMEM containing 10% FBS, 0.5 mM isobutylmethylxanthine, 5 mg/mL insulin, 1 mM dexamethasone and 60 mM indomethacin, whereas 1 mM b-glycerol phosphate, 0.1 mM dexamethasone and 50 mM ascorbate were used for osteoblastic differentiation. Oil red O and von Kossa dyes were used to identify adipocytes and osteoblasts, respectively. The identity of MSCs was also confirmed by immunophenotypic criteria based on the expression of CD29, CD44, CD 90 and the absence of hematopoietic (with anti-CD45, -CD34 antibodies) and major histocompatibility complex markers. Grouping and treatment Adult male rats were randomly divided into five groups as follows: Control group (normal air + PBS, K, n ¼ 8), phosgene group (phosgene, PH, n ¼ 8), phosgene control group (phosgene + PBS, PB, n ¼ 8), phosgene + MSCs group (phosgene + MSCs, PM, n ¼ 8) and air + MSCs (normal air + MSCs, KM, n ¼ 8). After grouping, these rats were exposed to either normal room air (control group) or a concentration of 8.33 mg/L phosgene (phosgene-exposed group) for 5 min and 1 106 GFP expressing BMMSCs were infused immediately through tail vein injection. The rats in these five groups were sacrificed at the time point of 6, 24 and 48 h post-exposure to evaluate the severity of the ALI. Bronchoalveolar lavage BAL was performed with the whole lung. Two milliliters aliquots of 37 C, sterile, pyrogen-free, 0.9% saline were flushed through the tracheotomy tube and this process was repeated for five times. The five fractions were recovered and pooled. The total number of cells was counted using a standard hemocytometer. The BAL fluid (BALF) was then centrifuged at600g for 5 min. The supernatant was collected and stored at 80 C. Protein quantification was determined by using BCA Protein Assay Kit (Pierce, Rockford, IL). Wet-to-dry lung weight ratio The wet-to-dry lung weight ratio (W:D ratio) was calculated by dividing the wet weight by the dry weight. Arterial blood gases measurement Arterial blood gases (arterial partial pressure of oxygen [PaO2]) were determined in blood samples collected with sterile vented plastic syringes (PICO 70, Radiometer, Copenhagen, Denmark) and measured at the times after phosgene exposure at 6, 24 and 48 h using an automatic AVLCompact3 device (Roche Diagnostic, Mannheim, Germany).
256
J. Chen et al.
Inhal Toxicol, 2015; 27(5): 254–261
Histology Lungs from the different treatment group were collected 6, 24, 48 h after phosgene-induced lung injury and fixed with 10% formalin. After fixation, the lungs were embedded in paraffin, cut into 5 mm section and stained with hematoxylin–eosin staining (H&E staining). In the setting of MSC engraftment evaluation, the lungs were embedded in OCT and frozen at 80 C before processing. After cutting into 5 mm section, the expression of GFP was observed under a fluorescence microscopy (Zeiss, Gottingen, Germany).
Inhalation Toxicology Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
Measurement of IL-10 and TNF-a The concentrations of interleukin 10 (IL-10) and Tumor necrosis factor-a (TNF-a) in BALF were quantified by enzyme-linked immunosorbent assay (ELISA), using standard commercially available ELISA kits (R&D Systems, Minneapolis, MN).
Real-time reverse transcription-polymerase chain reaction (RT-PCR) Lungs were retrieved from rats immediately after killing and rinsed extensively. Total cellular RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA). RT-PCR was carried out using a One Step SYBRÕ PrimeScriptÔ RT-PCR kit (Takara, Dalian, China) and an iQ5 Real-time PCR Detection system (Bio-Rad, Hercules, CA). Expression of the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene was assessed simultaneously in all samples as an internal control. Relative gene expression was determined by the 2DDCT method. Oligonucleotide primers specific for Aquaporin-5 (AQP5), surfactant protein (SP)-C and GAPDH are listed in Table 1. Statistical analysis All statistical analyses were performed using the SPSS13.0 software (SPSS Inc., Chicago, IL). The results were presented as means ± standard deviation (SD). One way ANOVA was used to examine the differences between groups. p50.05 was considered as statistically significance.
Table 1. Primer sequence of the genes.
Results Gene name
Forward primer (50 –30 )
Reverse primer (50 –30 )
AQP-5 SP-C GAPDH
gcgctcagcaacaacacaac gcccaccggattactcgac gacatgccgcctggagaaac
gtgtgaccgacaagccaatg tgactcatgtgaaggcccat agcccaggatgccctttagt
Rat BMMSCs isolation and characterization The morphology, differentiation abilities and the phenotype of the rat BMMSCs are shown in Figure 1. The cell showed
Figure 1. Isolation and characterization of rat bone marrow-derived mesenchymal stem cells (BMMSCs). (A) Primary culture cell morphology after seeding (100); (B) Primary culture cell morphology at 24 h after seeding (100); (C) Primary culture cell morphology on Day 10 after seeding (100); (D) Passage 3 cell morphology (100); (E) (100) and (F) (200). Alizarin red staining of osteo-induced BMMSCs; (G) (100) and (H) (200). Red oil O staining of adipo-induced BMMSCs; (I) Immune-phenotype of BMMSCs (negative on CD34, CD45 and positive on CD29, CD44, CD90).
Inhalation Toxicology Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
DOI: 10.3109/08958378.2015.1037029
BMMSCs attenuate phosgene-induced ALI in rats
257
Figure 2. Bone marrow derived-mesenchymal stem cells (BMMSCs) improve the lung wet-to-dry ratio and partial arterial oxygen pressure (PaO2) in phosgene-induced lung injury. (A) BMMSCs significantly decreased lung wet-to-dry ratio when compared with the phosgene-induced lung injury group at different time points (6, 24 and 48 h); (B) BMMSCs significantly increased PaO2 when compared with the phosgene-induced lung injury group at different time points (6, 24 and 48 h). *Represents p50.05 when compared with the phosgene + PBS group; yrepresents p50.05 when compared with the air + MSCs group.
typical fibroblast morphology and needed about 10 days to reach 80–90% confluence (Figure 1A–D). Alizarinread staining and red oil O staining confirmed the osteogenesis (Figure 1E–F) and adipogenesis (Figure 1G–H) of the cell. The phenotype of the cells was determined by flow cytometry analyses (Figure 1I). The cell was stained positive on CD29, CD 44, CD 90 and negative on CD34, CD 45. All the features of the BMSCs showed here were consistent with the previous publication. BMMSCs improved severity of lung injury Rats given BMMSCs showed a decreased trend of lung wet-to-dry ratio at 6 (5.06 ± 0.11 versus 6.02 ± 0.74), 24 (4.75 ± 0.06 versus 4.91 ± 0.10) and 48 h (4.70 ± 0.04 versus 4.68 ± 0.08) when compared with the phosgene group (Figure 2A). Moreover, an increased level of PaO2 was found in rats receiving BMMSCs at 6 (69.63 ± 2.62 versus 59.13 ± 3.72 mmHg), 24 (74.50 ± 1.85 versus 70.00 ± 1.77 mmHg) and 48 h (71.75 ± 2.12 versus 79.75 ± 2.12 mmHg) when compared with the phosgene group (Figure 2B). Histology At 6, 24 and 48 h, H&E staining of lung section from the BMMSCs-treated rats had significantly decreased injury, such as pulmonary edema, hemorrhage and leukocytes infiltration into alveoli compared with rats in the phosgene group (Figure 3). Moreover, engraftment was also assessed and BMMSC expressing GFP was observed scattered through the lungs of mice treated with the cells; however, only a small proportion of cells was engrafted into lung at 6, 24 and 48 h. Besides, no BMMSCs cluster was found in the lung parenchyma (Figure 4). The rats in the phosgene group and air control group showed no trace of GFP-stained cells.
BMMSCs decreased levels of pro-inflammatory cytokines and increased anti-inflammatory cytokines phosgene injury The levels of TNF-a in the BAL were significantly lower in the BMMSCs-treated rats compared with the phosgene-treated control rats (Figure 5A) at 6 (76.63 ± 10.63 versus 100.54 ± 10.50 pg/mL), 24 (64.08 ± 11.02 versus 87.07 ± 11.24 pg/mL) and 48 h (51.46 ± 8.00 versus 70.90 ± 10.48 pg/mL), whereas TNF-a in the plasma were also significantly lower in the BMMSCs-treated rats compared with the phosgene-treated control rats at 6 (61.56 ± 10.61 versus 75.19 ± 11.67 pg/mL), 24 (46.44 ± 7.20 versus 61.82 ± 10.61 pg/mL) and 48 h (39.28 ± 8.20 versus 49.20 ± 6.86 pg/ mL) (Figure 5B). In addition, the anti-inflammatory cytokine IL-10 in BAL was significantly increased in the BMMSCs-treated rats compared with the phosgene-treated control rats (Figure 5C) at 6 (89.12 ± 7.33 versus 69.99 ± 7.80 pg/mL), 24 (72.16 ± 8.20 versus 63.65 ± 4.68 pg/mL) and 48 h (62.19 ± 7.82 versus 56.98 ± 6.78 pg/mL), whereas IL-10 in the plasma were also significantly higher in the BMMSCs-treated rats compared with the phosgene-treated control rats at 6 (64.60 ± 6.61 versus 54.85 ± 4.63 pg/mL), 24 (54.21 ± 5.98 versus 45.99 ± 3.88 pg/mL) and 48 h (49.17 ± 2.66 versus 42.56 ± 6.17 pg/mL) (Figure 5D).
BMMSCs increased the expression of epithelial cell marker AQP5 and SP-C mRNA We also examined the gene expression of the epithelial cell surface marker AQP5 and SP-C mRNA. The expression of the epithelial cell surface marker AQP5 and SP-C mRNA was significantly increased in the BMMSCs-treated rats compared with the phosgene-treated control rats at 6, 24 and 48 h (Figure 6).
258
J. Chen et al.
Inhal Toxicol, 2015; 27(5): 254–261
Inhalation Toxicology Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
Figure 3. Bone marrow-derived mesenchymal stem cells (BMMSCs) improve the severity of phosgene-induced lung injury. H&E staining of lung sections demonstrated attenuated lung injury in the BMMSCs-treated group versus phosgene group at different time points (6, 24 and 48 h) (100).
Discussion Recently, MSCs have been shown to exert beneficial effect in ALI through homing to the lung injury site and ameliorate lung injury in situ (Gupta et al., 2007; Rojas et al., 2005). Mechanisms for this protection not only included tissue repair, such as engraftment and differentiation of MSCs into specific lung cell types, but also included immunomodulation, the latter being associated with regulation levels of proor anti-inflammatory cytokines and formation of the microenviroment for tissue repair (Gupta et al., 2007;
Mei et al., 2007; Rojas et al., 2005; Xu et al., 2007). Previously, we have shown that Ulinastatin reduces pathogenesis of phosgene-induced ALI in rats via decreasing the infiltration of blood cells and reducing pro-inflammatory cytokines (Shen et al., 2014). Moreover, we also showed that adenovirus-delivered angiopoietin-1 attenuates inflammatory responses in phosgene-induced ALI through suppression of NF-kB and p38 MAPK signaling (He et al., 2014). However, optimal therapy is still urgent for the treatment of phosgeneinduced lung injury.
DOI: 10.3109/08958378.2015.1037029
BMMSCs attenuate phosgene-induced ALI in rats
259
Inhalation Toxicology Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
Figure 4. Engraftment of the adenovirus green fluorescent protein (GFP) transduced bone marrow-derived mesenchymal stem cells (BMMSCs) in the lung.
Figure 5. Decreased level of the pro-inflammatory cytokine tumor necrosis factor (TNF)-a and increased level of interleukin-10 (IL-10) were found in rats receiving bone marrow derived mesenchymal stem cells (BMMSCs). #Represents p50.05 when compared with the air control group; *represents p50.05 when compared with the phosgene + PBS group; yrepresents p50.05 when compared with the air + MSCs group.
260
J. Chen et al.
Inhal Toxicol, 2015; 27(5): 254–261
Inhalation Toxicology Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
Figure 6. Real-time reverse polymerase chain reaction showed the expression of the epithelial cell marker SP-C and AQP5. #Represents p50.05 when compared with the air + MSCs group (KM); *represents p50.05 when compared with the phosgene group (PH); ***represents p50.01 when compared with the phosgene group. PM represents the phosgene + MSC group.
Recent studies have shown that MSCs could improve the injury, despite the level of MSC engraftment of 55% at 48 h after injury (Gupta et al., 2007). In the present study, the low level of engraftment seen is consistent with prior studies. We found that intravenous administration of MSCs can ameliorated the severity of lung injury according to the lung wet-to-dry ratio, PaO2 and histopathological analysis. Decreased level of pro-inflammatory factor TNF-a, increased level of anti-inflammatory IL-10, restoration of the epithelial cells were involved in the mechanisms. To the best of our knowledge, this is the first report about the therapeutic evaluation of MSCs in phosgene-induced ALI. Previous in vivo studies have shown that phosgene exposure could result in pathophysiological changes in the lung especially in the bronchoalveolar region (Duniho et al., 2002). The severity of the lung injury was characterized by pulmonary edema, hemorrhage and leukocytes infiltration into alveoli (Lucas et al., 2009; Xu et al., 2011). Here we employed the lung wet-to-dry ratio, PaO2 and histological section to reflect these pathological changes. At 6, 24 and 48 h of post-exposure, we observed significantly increased level of lung wet-to-dry ratio, decreased level of PaO2 and pathological changes (pulmonary edema, hemorrhage and leukocytes infiltration into alveoli),which demonstrated the acute damage in the lung after exposure to phosgene. In the rats receiving MSCs, we found a less severe degree of lung injury proved by decreased level of lung wet-to-dry ratio, increased level of PaO2. Decreased level of lung injury on pulmonary edema, hemorrhage and leukocytes infiltration into alveoli was also observed on the histological sections. According to the recent literatures reporting the immunomodulatory properties of MSCs (Aggarwal & Pittenger, 2005; Corcione et al., 2006; Glennie et al., 2005; Krampera et al., 2006), we hypothesized that down-regulation of the proinflammatory response to phosgene could be mediated by the treatment of MSCs. Analysis of the BAL and plasma sample from the BMMSCs-treated and phosgene control rats demonstrated that reduced level of TNF-a was found in the BMMSCs-treated rats. Moreover, MSCs were also reported to exert immunomodulatory properties through up regulation of the anti-inflammatory cytokines. We also assessed the level of IL-10 in the setting of BMMSCs treatment. The analyses of the BAL and plasma sample revealed that BMMSCs
treatment could significantly increase the level of IL-10, which was consistent with the reports demonstrating that MSCs increase production of IL10 through the interaction with antigen presenting cells (Beyth et al., 2005). Furthermore, this results may suggest an important mechanism through which MSC exert their beneficial effect because the protective role of IL-10 in lung inflammation has been well-described (Shanley et al., 2000; Spight et al., 2005). In our phosgene-induced lung injury model, significant increased level of PaO2 was found when compared with the air control group, which indicated that destruction of the lung blood–gas barrier. As an important component of lung blood– gas barrier, pulmonary epithelium plays a critical role in the sodium and chloride transportation and the pathological changes on pulmonary epithelium could result in pulmonary edema (Matthay et al., 2005). AQP5, a major water channel in lung epithelial cells, plays an important role in maintaining water homeostasis in the lungs. Dyregulation of AQP5 can lead to increased plasma membrane water permeability in lung epithelial (Ohinata et al., 2005). We here also assessed the expression of AQP5 in lung tissues and our results showed that increased level of AQP5 was found after the BMMSCs treatment. In addition, previous studies have shown that pulmonary SP-C, an innate immune molecule and presented in alveolar type II cells, could modify lipopolysaccharide (LPS)-induced cell responses (Glasser et al., 2013). We here also examined the expression of SP-C and increased expression of SP-C could be detected in the BMMSCs-treated rats. These findings might compare the similarity between phosgene- and endotoxin-induced lung injury in the further studies. In conclusion, our studies demonstrated for the first time about the therapeutic role exerted by MSCs in phosgeneinduced ALI. The regulation of the pro-inflammatory and anti-inflammatory cytokine level was accounted for the mechanisms. Furthermore, the expression of pulmonary epithelial function related genes AQP5 and SP-C was also involved in the treatment process by MSCs.
Declaration of interest This work was funded by National Natural Science Foundation of China (81471850), National Natural Science
BMMSCs attenuate phosgene-induced ALI in rats
DOI: 10.3109/08958378.2015.1037029
Foundation of China (81101412), and Science and Technology Commission of Shanghai Municipality (11JC1401900).
Inhalation Toxicology Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
References Aggarwal S, Pittenger MF. (2005). Human mesenchymal stem cells modulate allogeneic immune cell responses. Blood 105:1815–22. Aoki T, Nishimura M, Matsuoka T, et al. (2011). PGE(2)-EP(2) signalling in endothelium is activated by haemodynamic stress and induces cerebral aneurysm through an amplifying loop via NFkappaB. Br J Pharmacol 163:1237–49. Beyth S, Borovsky Z, Mevorach D, et al. (2005). Human mesenchymal stem cells alter antigen-presenting cell maturation and induce T-cell unresponsiveness. Blood 105:2214–19. Borak J, Diller WF. (2001). Phosgene exposure: mechanisms of injury and treatment strategies. J Occup Environ Med 43:110–19. Cheng DS, Han W, Chen SM, et al. (2007). Airway epithelium controls lung inflammation and injury through the NF-kappa B pathway. J Immunol 178:6504–13. Corcione A, Benvenuto F, Ferretti E, et al. (2006). Human mesenchymal stem cells modulate B-cell functions. Blood 107:367–72. Djouad F, Plence P, Bony C, et al. (2003). Immunosuppressive effect of mesenchymal stem cells favors tumor growth in allogeneic animals. Blood 102:3837–44. Duniho SM, Martin J, Forster JS, et al. (2002). Acute changes in lung histopathology and bronchoalveolar lavage parameters in mice exposed to the choking agent gas phosgene. Toxicol Pathol 30: 339–49. Glasser SW, Maxfield MD, Ruetschilling TL, et al. (2013). Persistence of LPS-induced lung inflammation in surfactant protein-C-deficient mice. Am J Respir Cell Mol Biol 49:845–54. Glennie S, Soeiro I, Dyson PJ, et al. (2005). Bone marrow mesenchymal stem cells induce division arrest anergy of activated T cells. Blood 105:2821–7. Gupta N, Su X, Popov B, et al. (2007). Intrapulmonary delivery of bone marrow-derived mesenchymal stem cells improves survival and attenuates endotoxin-induced acute lung injury in mice. J Immunol 179:1855–63. He DK, Shao YR, Zhang L, et al. (2014). Adenovirus-delivered angiopoietin-1 suppresses NF-kappaB and p38 MAPK and attenuates inflammatory responses in phosgene-induced acute lung injury. Inhal Toxicol 26:185–92. Hoffman AM, Paxson JA, Mazan MR, et al. (2011). Lung-derived mesenchymal stromal cell post-transplantation survival, persistence, paracrine expression, and repair of elastase-injured lung. Stem Cells Dev 20:1779–92. Kamiya N, Ueda M, Igarashi H, et al. (2013). In vivo monitoring of arterially transplanted bone marrow mononuclear cells in a rat transient focal brain ischemia model using magnetic resonance imaging. Neurol Res 35:573–9. Klopp AH, Gupta A, Spaeth E, et al. (2011). Concise review: dissecting a discrepancy in the literature: do mesenchymal stem cells support or suppress tumor growth? Stem Cells 29:11–19. Krampera M, Pasini A, Pizzolo G, et al. (2006). Regenerative and immunomodulatory potential of mesenchymal stem cells. Curr Opin Pharmacol 6:435–41. Kucerova L, Matuskova M, Hlubinova K, et al. (2010). Tumor cell behaviour modulation by mesenchymal stromal cells. Mol Cancer 9:129.
261
Liu S, Ginestier C, Ou SJ, et al. (2011). Breast cancer stem cells are regulated by mesenchymal stem cells through cytokine networks. Cancer Res 71:614–24. Lucas R, Verin AD, Black SM, Catravas JD. (2009). Regulators of endothelial and epithelial barrier integrity and function in acute lung injury. Biochem Pharmacol 77:1763–72. Matthay MA, Robriquet L, Fang X. (2005). Alveolar epithelium: role in lung fluid balance and acute lung injury. Proc Am Thorac Soc 2: 206–13. Mei SH, McCarter SD, Deng Y, et al. (2007). Prevention of LPS-induced acute lung injury in mice by mesenchymal stem cells overexpressing angiopoietin 1. PLoS Med 4:e269. Ohinata A, Nagai K, Nomura J, et al. (2005). Lipopolysaccharide changes the subcellular distribution of aquaporin 5 and increases plasma membrane water permeability in mouse lung epithelial cells. Biochem Biophys Res Commun 326:521–6. Ortiz LA, Dutreil M, Fattman C, et al. (2007). Interleukin 1 receptor antagonist mediates the antiinflammatory and antifibrotic effect of mesenchymal stem cells during lung injury. Proc Natl Acad Sci USA 104:11002–7. Ortiz LA, Gambelli F, McBride C, et al. (2003). Mesenchymal stem cell engraftment in lung is enhanced in response to bleomycin exposure and ameliorates its fibrotic effects. Proc Natl Acad Sci USA 100: 8407–11. Pauluhn J, Carson A, Costa DL, et al. (2007). Workshop summary: phosgene-induced pulmonary toxicity revisited: appraisal of early and late markers of pulmonary injury from animal models with emphasis on human significance. Inhal Toxicol 19:789–810. Rojas M, Xu J, Woods CR, et al. (2005). Bone marrow-derived mesenchymal stem cells in repair of the injured lung. Am J Respir Cell Mol Biol 33:145–52. Roorda BD, ter Elst A, Kamps WA, de Bont ES. (2009). Bone marrowderived cells and tumor growth: contribution of bone marrow-derived cells to tumor micro-environments with special focus on mesenchymal stem cells. Crit Rev Oncol Hematol 69:187–98. Shanley TP, Vasi N, Denenberg A. (2000). Regulation of chemokine expression by IL-10 in lung inflammation. Cytokine 12: 1054–64. Shen J, Gan Z, Zhao J, et al. (2014). Ulinastatin reduces pathogenesis of phosgene-induced acute lung injury in rats. Toxicol Ind Health 30: 785–93. Spight D, Zhao B, Haas M, et al. (2005). Immunoregulatory effects of regulated, lung-targeted expression of IL-10 in vivo. Am J Physiol Lung Cell Mol Physiol 288:L251–65. Tian Z, Li Y, Ji P, et al. (2013). Mesenchymal stem cells protects hyperoxia-induced lung injury in newborn rats via inhibiting receptor for advanced glycation end-products/nuclear factor kappaB signaling. Exp Biol Med (Maywood) 238:242–7. Wang YY, Li XZ, Wang LB. (2013). Therapeutic implications of mesenchymal stem cells in acute lung injury/acute respiratory distress syndrome. Stem Cell Res Ther 4:45. Xu J, Woods CR, Mora AL, et al. (2007). Prevention of endotoxininduced systemic response by bone marrow-derived mesenchymal stem cells in mice. Am J Physiol Lung Cell Mol Physiol 293: L131–41. Xu YN, Zhang Z, Ma P, Zhang SH. (2011). Adenovirus-delivered angiopoietin 1 accelerates the resolution of inflammation of acute endotoxic lung injury in mice. Anesth Analg 112:1403–10. Yagi H, Soto-Gutierrez A, Navarro-Alvarez N, et al. (2010). Reactive bone marrow stromal cells attenuate systemic inflammation via sTNFR1. Mol Ther 18:1857–64.
Supplementary material available online Supplementary Figure S1
