Bone morphogenetic protein-12 induces tenogenic differentiation of mesenchymal stem cells derived from equine amniotic fluid.

Original Paper Accepted after revision: December 27, 2013 Published online: March 21, 2014

Cells Tissues Organs 2013;198:377–389 DOI: 10.1159/000358231

Bone Morphogenetic Protein-12 Induces Tenogenic Differentiation of Mesenchymal Stem Cells Derived from Equine Amniotic Fluid Baldev R. Gulati a Rajesh Kumar a Niharika Mohanty b Pawan Kumar c Rajesh K. Somasundaram d Prem S. Yadav e a

National Research Centre on Equines, and Departments of b Veterinary Physiology and Biochemistry and Veterinary Anatomy, College of Veterinary Sciences, LLR University of Veterinary and Animal Sciences, d Equine Breeding Stud, and e Animal Physiology and Reproduction, Central Institute for Research on Buffaloes, Hisar, India c

Abstract Tendon injuries are common in race horses, and mesenchymal stem cells (MSCs) isolated from adult and foetal tissue have been used for tendon regeneration. In the present study, we evaluated equine amniotic fluid (AF) as a source of MSCs and standardised methodology and markers for their in vitro tenogenic differentiation. Plastic-adherent colonies were isolated from 12 of 20 AF samples by day 6 after seeding and 70–80% cell confluency was reached by day 17. These cells expressed mesenchymal surface markers [cluster of differentiation (CD)73, CD90 and CD105] by reverse transcription (RT)-polymerase chain reaction (PCR) and immunocytochemistry, but did not express haematopoietic markers (CD34, CD45 and CD14). In flow cytometry, the expression of CD29, CD44, CD73 and CD90 was observed in 68.83 ± 1.27, 93.66 ± 1.80, 96.96 ± 0.44 and 93.7 ± 1.89% of AF-MSCs, respectively. Osteogenic, chondrogenic and adipogenic differentiation of MSCs was confirmed by von Kossa and Alizarin red S, Alcian blue and oil red O staining, respectively. Upon supplementation of MSC growth media with 50 ng/ml bone

© 2014 S. Karger AG, Basel 1422–6405/14/1985–0377$39.50/0 E-Mail [email protected] www.karger.com/cto

morphogenetic protein (BMP)-12, AF-MSCs differentiated to tenocytes within 14 days. The differentiated cells were more slender, elongated and spindle shaped with thinner and longer cytoplasmic processes and showed expression of tenomodulin and decorin by RT-PCR and immunocytochemistry. In flow cytometry, 96.7 ± 1.90 and 80.9 ± 6.4% of differentiated cells expressed tenomodulin and decorin in comparison to 1.6 and 3.1% in undifferentiated control cells, Abbreviations used in this paper

AF AP BMP BSA CD cDNA dNTPs FBS FITC GAPDH GDF MSCs P PBS PCR PE RT

amniotic fluid alkaline phosphatase bone morphogenetic protein bovine serum albumin cluster of differentiation complementary DNA deoxynucleotide triphosphates foetal bovine serum fluorescein isothiocyanate glyceraldehyde 3-phosphate dehydrogenase growth and differentiation factor mesenchymal stem cells passage phosphate-buffered saline polymerase chain reaction phycoerythrin reverse transcription

Dr. Baldev R. Gulati National Research Centre on Equines Sirsa Road Hisar 125001, Haryana (India) E-Mail brgulati @ gmail.com

Downloaded by: University of Illinois at Chicago 128.248.155.225 - 5/7/2015 5:07:42 PM

Key Words Amniotic fluid · Bone morphogenetic protein-12 · Mesenchymal stem cells · Tenogenic differentiation · Equine

Introduction

Tendon injuries are common in equine athletes and are major reasons behind early retirement and euthanasia of race horses [Arnhold et al., 2007; van Schie et al., 2009]. Conventional treatments result in the formation of scar tissue or fibrous adhesions during healing, which may reduce the performance and increase the risk of re-injury [Dowling et al., 2000]. Mesenchymal stem cells (MSCs) have been alternatively proposed for a direct transplantation or after a previous in vitro differentiation into a tenogenic lineage for regeneration of injured tendons [Yin et al., 2010]. MSCs are fibroblast-like, highly proliferative, plastic-adherent cells with the ability to differentiate into several tissues, including bone [Holtorf et al., 2005], cartilage [Bernardo et al., 2007] and adipose tissue [LangeConsiglio et al., 2012]. Despite major progress in the knowledge on adult stem cells during recent years, a proper identification of MSC remains a challenge. In human medicine, the Mesenchymal and Tissue Stem Cell Committee of the International Society for Cellular Therapy recently proposed three criteria to define MSCs. Firstly, cells must be plastic adherent when maintained under standard culture conditions. Secondly, MSCs must express cluster of differentiation (CD)73, CD90 and CD105, and lack expression of CD34, CD45, CD14 or CD11b, CD79α or CD19 and MHC class II antigens. Thirdly, MSCs must be able to differentiate into osteoblasts, adipocytes and chondroblasts in vitro. MSCs isolated from adult sources have been successfully used for restoring structural and functional regeneration of injured tendons [Brehm et al., 2012]. However, isolation of MSCs from adult sources involves invasive procedures and gives very limited yield of MSCs. Therefore, various extra-embryonic sources are being exploited as alternate and safer sources of MSCs in equines, including umbilical cord matrix [Hoynowski et al., 2007; Lovati et al., 2011], umbilical cord blood [Koch et al., 2007; Reed and Johnson, 2008; Schuh et al., 2009], amnion [Lange-Consiglio et al., 2012], placenta [Carrade et al., 2011] and amniotic fluid [Park et al., 2011]. The amniotic fluid (AF)-derived MSCs (AF-MSCs) proliferate in vitro more rapidly than 378


comparable foetal and adult cells and have vast differentiation capacity [Mauro et al., 2010; Park et al., 2011]. MSCs are currently injected directly at the injury site [Smith et al., 2003; Godwin et al., 2012]. However it has been demonstrated recently that after transplantation, most of the MSCs migrate from the site of injury and might not differentiate into tenocytes in vivo [Stewart and Stewart 2011; Becerra et al., 2013]. Direct transplantation of MSCs after in vitro differentiation to tenocytes might result in better healing of the tendons. Some studies have demonstrated differentiation of MSCs into tenocyte-like cells in response to chemical factors, including bone morphogenetic proteins (BMPs), transforming growth factor-β and fibroblast growth factor [Hankemeier et al., 2005; Lorda-Diez et al., 2009]. BMP-12, the human homologue of mouse growth and differentiation factor (GDF)-7, has been shown to promote tendon differentiation and formation both in vivo [Lou et al., 2001] and in vitro [Wang et al., 2005b; Violini et al., 2009]. The study of tenogenic differentiation is hampered by the lack of definitive biomarkers for tenocytes. The extent of differentiation of tenocytes in vitro has been determined by examining the mRNA expression of specific markers, such as collagen type I [Kastelic et al., 1978], tenomodulin [Brandau et al., 2001; Shukunami et al., 2001] and decorin [Vogel and Trotter, 1987; Zhang et al., 2006]. In equines, gene expression of tenomodulin has been used to confirm tenogenic differentiation of bone marrow-derived MSCs [Violini et al., 2009]. The in vitro differentiation of AF-MSCs towards tenocytes has not been reported so far. Therefore, in the present study, we evaluated equine AF as a source of MSCs. The tenogenic differentiation potential of equine AF-MSCs was studied, and methodology and markers for the identification of differentiated tenocytes were refined. Materials and Methods Unless otherwise specified, all chemicals and cell culture media used for MSC isolation and culture were procured from Sigma (St. Louis, Mo., USA) and tissue culture flasks and dishes from Corning (Corning, N.Y., USA). AF Collection AF samples (about 60 ml) were aspirated directly from the amniotic sac protruding from the vulva before its spontaneous rupture during the full-term foaling using a sterile 18-gauge needle mounted on a 60-ml sterile syringe and collected in a 100-ml sterile container containing 1 ml each of EDTA and antibiotic antimycotic solution. Samples were collected in duplicate. They were stored and transported at 4 ° C and further processed individually for isolation of MSCs within 2–6 h.

Gulati /Kumar /Mohanty /Kumar / Somasundaram /Yadav


respectively. Our results suggest that AF is an easily accessible and effective source of MSCs. On BMP-12 supplementation, AF-MSCs can be differentiated to tenocytes, which could be exploited for regeneration of ruptured or damaged tendon in race horses. © 2014 S. Karger AG, Basel

Table 1. Oligonucleotide sequences used for RT-PCR analysis

Markers

Sequences (5′→3′)

Amplicon Annealing Accession size, bp temp., °C No.

GAPDH

F: CAAGGTCATCCATGACAACTTTG R: GTCCACCACCCTGTTGCTGTAG

496

58

NM_001163856.1

CD14

F: TTGATCTCAGCTGCAACAGG R: CAGAGGGTCGGTTGGTTAAGAC

303

56

NM_001081927.1

CD34

F: CACTAAACCCTCTACATCATTTTCTCCTA R: GGCAGATACCTTGAGTCAATTTCA

101

60

XM 001491596

CD45

F: TGATTCCCAGAAATGACCATGTA R: ACATTTTGGGCTTGTCCTGTAAC

101

60

AY114350.1

CD73

F: GGGATTGTTGGATACACTTCAAAAG R: GCTGCAACGCAGTGATTTCA

91

60

XM 001500115.2

CD90

F: TGCGAACTCCGCCTCTCT R: GCTTATGCCCTCGCACTTG

93

60

EU881920.1

CD105

F: AAGAGCTCATCTCGAGTCTG R: ATGCTCAGGGATCATTGGGG

338

56

XM_003364145.1

Decorin

F: CTTGCACAAGTTTCCTGGGC R: CGCTTTTCGCACTTTGGTGA

481

62

NM_001081925.1

363

58

NM_001081822.1

Tenomodulin F: ACATGGAAATTGATCCCGTG R: GTCTTGTAACTCTGAAACTGC

Isolation, Culture and Expansion of MSC Each sample was diluted 1:1 with Dulbecco’s phosphate-buffered saline (PBS) containing 100 IU/ml penicillin and 100 mg/ml streptomycin. The obtained solution was centrifuged for 20 min at 450 g. Supernatant was carefully removed and the pellet was resuspended in 5 ml of Dulbecco’s PBS. Cells were isolated by loading the sample on 5 ml of Histopaque solution in a 15-ml polypropylene tube and centrifugation at 450 g for 20 min at 25 ° C. The supernatant was discarded and interphase was collected, washed twice with Dulbecco’s PBS and centrifuged at 450 g for 10 min at 25 ° C. The cells were suspended in 1 ml of MSC growth medium containing low-glucose Dulbecco’s modified Eagle’s medium supplemented with 15% foetal bovine serum (FBS), minimal essential medium non-essential amino acid (1%), vitamin (1%), penicillin (100 IU/ml), streptomycin (0.1 mg/ml) and L-glutamine (2 mM). Live cells were counted by trypan blue dye (0.4%) exclusion using a haemocytometer, seeded at 105 cells/ml in 25-cm2 tissue culture flasks and incubated at 38.5 ° C in humidified atmosphere containing 5% CO2. Initially, the medium was replaced after 48 h and thereafter every 3rd day. Cell growth and morphology was observed under an inverted microscope (IX51; Olympus, Tokyo, Japan). The cells were detached at 80% confluency with 0.05% (w/v) trypsin, counted with a haemocytometer and re-seeded as ‘passage (P) 1’ at 105 cells/ml in 25-cm2 tissue culture flasks. Population doubling time was calculated by seeding cells (5 × 103 cells/cm2) in 25-cm2 tissue culture flasks and incubation till 80% confluency. The cells were trypsinised and the number of viable cells was counted and population doubling time (in h) was

calculated as per Iacono et al. [2012]. MSCs were seeded (300 cells/ cm2) in the growth medium in 60-mm tissue culture dishes and incubated for 5 days at 5% CO2 and 38.5 ° C. The cells were then fixed with methanol and colonies consisting of more than 16–20 cells were counted; data were reported as plating efficiency, which was calculated as number of colonies/number of seeded cells ×100.

BMP-12 Induces Tenogenic Differentiation in Equine AF-MSC


Alkaline Phosphatase Staining To characterise the undifferentiated state of AF-derived cells, we analysed the level of alkaline phosphatase (AP) expression. Cells at P1, P5 and P10 were subjected to AP staining using an AP staining kit (Sigma) by staining with naphthol and fast blue B alkaline solution followed by counter-staining with neutral red. Adult equine ear pinna fibroblast cells were taken as negative control. Reverse Transcription-Polymerase Chain Reaction Expression of specific MSC (CD73, CD90 and CD105) and haematopoietic/leucocytic (CD14, CD34 and CD45) marker genes was investigated by reverse transcription (RT)-polymerase chain reaction (PCR) analysis on undifferentiated AF-MSCs. Total RNA was isolated using the RNeasy kit (Qiagen, Milan, Italy) as per manufacturer’s protocol. RNA concentration and purity were measured using a spectrophotometer (BioPhotometer plus; Eppendorf AG, Hamburg, Germany). First-strand complementary DNA (cDNA) was synthesised by using the RevertAid first-strand cDNA synthesis kit (Fermentas, Hanover, Md., USA) in a total of 20 μl of reaction volume, using 1 μg RNA, 10 mM deoxynucleotide triphosphates (dNTPs), 0.5 μg oligo(dT) primers, 20 units of Ri-

379


boLock RNAase inhibitor and 200 units of Moloney murine leukemia virus reverse transcriptase H. PCR amplification of firststrand cDNA was carried out using primers specific for each gene (table 1) separately in 25 μl of reaction volume with reaction mixture consisting of 1× PCR buffer, 50 μM dNTP, 10 pM each of genespecific forward and reverse primers, 1.5 mM MgCl2, 0.05 units/μl Taq DNA polymerase and 3 μl of cDNA with a thermal profile consisting of initial denaturation at 95 ° C for 3 min followed by 35 cycles of PCR with denaturation at 94 ° C for 20 s, annealing at a temperature specific for each individual gene (table 1) for 30 s, extension at 72 ° C for 30 s and final extension at 72 ° C for 10 min. The reference gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was included as an endogenous control to evaluate the quality of cDNA. Non-template control was run with every PCR amplification program to check contamination or PCR carryover. PCR products were run in 2% agarose gel containing ethidium bromide (0.5 μg/ml) along with a DNA ladder to determine their molecular sizes and visualised on a G:Box gel documentation system (Syngene; Cambridge, UK).

Trilineage Differentiation Trilineage differentiation was performed in triplicate on 3 independent MSC samples at P3 essentially according to Iacono et al. [2012]. The cells cultured in MSC growth medium containing 2% FBS for 21 days served as undifferentiated control. After osteogenic differentiation, the cells were stained with von Kossa stain on day 21. For chondrogenic differentiation, the cells were stained with 1% Alcian blue (in 3% acetic acid, pH 2.5) on day 21. For adipogenic differentiation, the cells were stained with oil red O (0.5% in isopropanol) followed by counter-staining with Harris’ haematoxylin for 1 min. Immunocytochemistry Murine monoclonal antibodies against CD90, CD73, CD45 and CD34 were procured from BD Biosciences (Gurgaon, India) and used as per manufacturer’s instruction. Undifferentiated AFMSCs used for immunocytochemistry were seeded (5,000 cells/ cm2) in 4-well glass chamber slides (SPL Biosciences, Pocheon-si, Korea) and incubated at 38.5 ° C in a humidified atmosphere containing 5% CO2. After overnight incubation, cells were briefly rinsed with buffer (PBS with 0.2% bovine serum albumin; BSA) followed by fixation with 4% paraformaldehyde for 20 min. Cell permeabilisation was done with 0.1% Triton X-100 in PBS for 10 min followed by blocking in blocking buffer (3% FBS in PBS) for 30 min. Cells were washed thrice and incubated with 1:50 dilution of each murine monoclonal antibody separately in triplicate for 1 h at 37 ° C in a moist chamber. After three washings, cells were incubated with anti-mouse fluorescein isothiocyanate (FITC)conjugated IgG/IgM (BD Biosciences) at 1:100 dilutions in blocking buffer for 1 h at 37 ° C in dark. Cells were washed thrice and visualised under a fluorescence microscope (1X51, Olympus) using a suitable filter. Fibroblast cells derived from adult horse ear pinna (maintained in our laboratory) were used as a negative control and processed in a similar manner.

Tenogenic Differentiation At P3 and P5, AF-MSCs were plated at a density of 6 × 104 cells/ 2 cm for overnight attachment in tissue culture flasks in MSC growth medium. To induce tenogenic differentiation, cells were cultured in MSC growth medium supplemented with different concentrations of BMP-12 (10, 30 and 50 ng/ml) and incubated for different time periods (7, 14, 21 and 28 days), with media change on every alternate day. The cells were stained with haematoxylin and eosin for morphology study. The expression of tenomodulin and decorin was confirmed by gene expression, immunocytochemistry and flow cytometry. Undifferentiated MSCs served as a negative control. For gene expression, RNA was isolated and processed for RT-PCR with tenomodulin- and decorinspecific primers (table 1) using conditions described in the previous section. For immunocytochemistry and flow cytometry, polyclonal antibodies against peptides of human tenomodulin (N-14) and decorin (N-15) in goat (Santa Cruz Biotechnology, Heidelberg, Germany) were used as primary antibody and FITC-conjugated donkey anti-goat IgG (Santa Cruz Biotechnology) as secondary antibody, following the protocol described in the previous section. Statistical Analysis All statistical analyses were performed using SPSS 17.0 software. Each experiment was performed on 3 independent samples and results represent the mean of these 3 experiments. Data obtained were analysed through one-way ANOVA using Duncan’s multiple range test at 0.05% level of significance.

Results

Flow Cytometry Test cell populations were analyzed for a total of 6 cell surface markers (CD29, CD44, CD73, CD90, CD34 and CD45) in flow cytometry. All the experiments were performed on 3 samples for each marker. MSCs were trypsinised at P4 and re-suspended in

380


AF Collection and Isolation of MSCs AF was recovered from 20 Thoroughbred mares during full-term foaling. No complications for both mares and foals were encountered upon AF sampling at foaling. The sample storage and transport temperature was 4 ° C. Samples were processed within 2–6 h (mean 3.0 h). No sample had signs of coagulation. On average 2.9 × 106 cells could be isolated from the initial sample volume of 60 ml of AF. The cells were seeded at a density of 1 × 105 cells/25-cm2 culture flasks for the isolation of MSCs. Adherent colonies growing in a



culture medium at 106 cells/ml. Harvested cells were pelleted and fixed with 4% paraformaldehyde at 4 ° C followed by washing with washing buffer (0.2% BSA in PBS containing 0.01% sodium azide). Cells in duplicate tubes were incubated with 1:50 dilution of mouse anti-human CD29-FITC, CD44-FITC, CD73-FITC, CD90-phycoerythrin (PE), CD45-FITC and CD34-PE monoclonal antibodies (eBiosciences, San Diego, Calif., USA) for 45 min in the dark at room temperature. Cells were washed thrice with washing buffer and re-suspended in washing buffer. Flow cytometry was performed using FACSCalibur (BD Biosciences, San Diego, Calif., USA) and the data were analyzed with FACSDiva software (BD Biosciences).

a

b

Fig. 1. Morphology of equine AF-derived cells. a Primary colony exhibiting a plastic-adherent fibroblastic morphology. b Monolayer of rapidly expanding adherent spindle-shaped fibroblastoid cells at P2.

a

b

c

Fig. 2. AP staining of equine AF-MSCs. a Heterogenous population of both AP-positive (blue) and -negative (red) cells at P1. b Most of the cells are AP positive (stained blue) at P5. c Equine fibroblast cells served as negative

monolayer were observed in 12 of 20 AF samples, giving an isolation rate of 60%. Contamination was observed in the remaining 5 samples and plastic-adherent colonies could not be isolated from 3 samples. The spindle-shaped colonies were observed as early as 6 days after seeding (range 6–11 days) and 70–80% cell confluency was reached by day 17 after seeding. Starting from P1, the AFMSCs formed a morphologically homogeneous population of fibroblast-like cells (fig. 1). These cells were able to proliferate till P36, after which the cells exhibited growth arrest. Before growth arrest, MSCs demonstrated morphological abnormalities, including size enlargement and irregular shape with decreased proliferation rate, increased passage time and finally stopped dividing. During P0–P8, AF cells had an average cell doubling time of 43.33 ± 0.91 h and plating efficiency of 2.29 ± 0.14%.

MSC Characterisation The AF-MSCs were positive for AP at different passages. However, some of the cells in early passage (at P1) did not show AP staining (appeared red) but subsequently (at P5 and P10), all cells were positive for AP (appeared blue; fig. 2). RT-PCR analysis of AF-MSCs at P3 showed the expression of mesenchymal markers (viz CD73, CD90 and CD105) but did not express haematopoietic and leucocytic markers (viz CD14, CD34 and CD45; fig. 3). Peripheral blood mononuclear cells included as control expressed haematopoietic markers. Immunocytochemical analysis results indicated that AF-MSCs (P2–P5) expressed CD73 and CD90 (MSC markers) but did not express CD34 and CD45 (fig. 4). Fibroblast cells derived from adult horse ear pinna did not express CD73 and CD90.



381


control and stained red.

Fig. 3. Gene expression analysis of cell sur-

1

2

3

4

5

6

7

8

9

10

bp

face markers in equine AF-MSCs. The products from RT-PCR analysis of genes for CD34 (lane 1); CD45 (lane 2); CD14 (lane 3); GAPDH (lane 6: 496 bp); CD90 (lane 7: 93 bp); CD73 (lane 8: 91 bp), and CD105 (lane 9: 338 bp). Lane 4 = RT control; lane 5 = 50-bp ladder; lane 10 = 100-bp ladder. AF-MSC RNA showed the expression of mesenchymal markers CD90, CD73 and CD105 (lanes 7–9) but did not express haematopoietic/leucocytic markers CD34, CD45 and CD14 (lanes 1–3).

3,000 1,500 1,000 500 400 300 200 100

a

b Fig. 4. Expression analysis of cell surface markers in equine AF-MSCs by immunostaining. The cells were stained with antibodies directed against CD73 (a) and CD90 (b; left panel). Right panels show the phase-contrast view of the same cells, respectively.

382


0.44% cells showed positive reaction with another clone of CD73 (AD2). AF-MSCs were negative for CD45 (94.8 ± 2.40%) and CD34 (97.25 ± 1.55%) by flow cytometry (fig. 5).



Flow cytometry of AF-derived horse MSCs with crossreactive antibodies showed expression of CD29, CD44 and CD90 in 68.83 ± 1.27, 93.66 ± 1.80 and 93.7 ± 1.89% cells, respectively. Although these cells did not show reactivity with clone 5F/B9 of CD73 (6.6 ± 3.8%), 96.96 ±

NRCE April 18, 2013-tube_002 60.4%

36.4%

10 4 103 102

Q1

0.3% 103 10 4 CD29 FITC-A

105

103 102

10 4 103 102

c

Q2

Q1 0.8% Q3 102

0.6% 10 4

CD73 FITC-A

1.1% Q3

1.8% Q4

102

105

103 10 4 CD44 FITC-A

105

105

d

1.3%

0.1%

10 4 103 102

Q4 103

Q2

NRCE April 18, 2013-tube_014 94.9%

CD34 PE-A

CD90 PE-A

105

88.4%

Q1

b

NRCE May 10, 2013-tube_002 3.7%

8.7%

10 4

Q4

102

a

Q2

2.8% Q3

105

CD90 PE-A

CD90 PE-A

105

NRCE April 18, 2013-tube_003

Q1

Q2

98.6% Q3

Q4 102

103

10 4 CD45 FITC-A

105

Fig. 5. Flow-cytometric analysis of equine AF-MSCs for expression of surface markers. Plots showing expression of CD29 and CD90 (a); CD44 and CD90 (b), CD73 and CD90 (c), and CD34 and CD45 (d). NRCE = National

Research Centre on Equines.

Tenogenic Differentiation Cultures of AF-MSCs did not show any change in the morphology of cells on supplementation of 10–30 ng/ml of BMP-12 to the growth medium till day 28. However, culture of AF-MSCs in growth medium supplemented with 50 ng/ml of BMP-12 induced tenocytic differentiaBMP-12 Induces Tenogenic Differentiation in Equine AF-MSC

tion by day 14, as exhibited by morphological changes. The BMP-12-treated cells appeared more slender, elongated and spindle shaped with thinner and longer cytoplasmic processes compared to control untreated cells (fig. 7). The AF-MSCs cultured in growth medium supplemented with BMP-12 expressed the tenomodulin and decorin genes by RT-PCR. Tenomodulin and decorin gene expression was noted in BMP-12-treated cells but not in untreated control cells (fig. 8). Immunocytochemical analysis indicated that BMP12-treated cells showed fluorescence on staining with tenomodulin and decorin antibodies, while untreated cells were negative (fig. 9). Further, flow-cytometric data showed that tenomodulin and decorin expression was observed in 96.7 ± 1.90 and 80.9 ± 6.4% cells on BMP-12 treatment in comparison to 1.6 and 3.1%, respectively, in untreated control cells (fig. 10).


383


In vitro Multilineage Differentiation On osteogenic differentiation, AF-MSCs were detected positive by von Kossa staining after 21 days of osteogenic induction, whereas the control cells were negative for the staining (fig. 6). Similarly, on chondrogenic differentiation, AF-MSCs showed marked deposition of glycosaminoglycans in the matrix by day 21, as seen by Alcian blue staining (fig. 6). The induction of adipogenic differentiation resulted in the development of positive staining with oil red O, whereas cells maintained in regular control medium were negative (fig. 6).

Differentiation induced AF-MSCs

Undifferentiated control AF-MSCs

a

b

c

384




Fig. 6. Cytochemical staining of differentiated and control undifferentiated equine AF-MSCs at P3. a Von Kossa staining after osteogenic differentiation showing matrix mineralisation with phosphate and calcium. b Alcian blue staining after chondrogenic differentiation showing marked deposition of glycosaminoglycans in the matrix. c Oil red O stain after induction of adipogenic differentiation showing cytoplasmic neutral triglyceride droplets.

a

b

Fig. 7. Morphology of equine AF-MSCs after tenogenic differentiation (HE). AF-MSCs after 14 days of culture in the presence of BMP-12 show elongated cells with longer cytoplasmic processes (a) in comparison to control cells cultured in the absence of BMP-12 (b).

Horse MSCs have been isolated from a variety of tissues, such as bone marrow, fat and peripheral blood, but the low cell number and invasive technique [Pittenger et al., 1999; Koerner et al., 2006; Martinello et al., 2010] associated with these sources necessitated search for alternative sources of MSCs for cellular therapy. In the present study, we isolated MSCs from equine AF and investigated their tenogenic potential in vitro. MSCs could be isolated from 12 of 20 AF samples, resulting in an isolation success rate of 60%, which was comparable to an earlier report [Iacono et al., 2012]. AF-MSCs were able to proliferate till P36 (data not shown); thereafter, the cells exhibited growth arrest. Culture of horse AF-MSCs has been reported for a maximum of 15 passages [Iacono et al., 2012]. In the present study, AF-MSCs till P8 showed a mean doubling time of 43.33 ± 0.91 h in comparison to 55.2 ± 1.0 h reported previously [Iacono et al., 2012]. Some cells at P1 did not show AP staining. It might be due to the fact that during initial cultures, there is a heterogeneous population of cells in AF and in subsequent passages, nonproliferative cells are eliminated and MSCs form a uniform monolayer and thus show uniform AP expression [Arnhold et al., 2011; Corradetti et al., 2013]. Equine AF-MSC expressed MSC-related cell surface markers CD73, CD90 and CD105 by RT-PCR. Our results were in accordance with earlier reports in equine adipose tissue-, bone marrow- and peripheral blood-derived MSCs [Braun et al., 2010; Ranera et al., 2011]. AFMSCs did not express CD14, CD34 and CD45 in the presBMP-12 Induces Tenogenic Differentiation in Equine AF-MSC

1

2

3

4

5

6

7

bp

500 400 300 250 200 150 100 50

Fig. 8. Gene expression analysis of AF-MSCs after tenogenic dif-

ferentiation. The products from RT-PCR analysis of genes for GAPDH in undifferentiated cells (lane 1) and differentiated cells (lane 3); tenomodulin in undifferentiated cells (lane 2) and differentiated cells (lane 4: 363 bp), and decorin in differentiated cells (lane 6: 481 bp). Lanes 5, 7 = 50-bp ladder.

ent study, although CD34 expression by equine MSCs has been reported previously [Ranera et al., 2011; LangeConsiglio et al., 2012]. The expression of CD73 and CD90 proteins on AF-MSCs was further confirmed by immunocytochemistry. In our study, AF-MSCs expressed CD29 in 68.83 ± 1.27% of the cells by flow cytometry, which was significantly lower than the reported >90% positivity in equine Cells Tissues Organs 2013;198:377–389 DOI: 10.1159/000358231

385


Discussion

Differentiated AF-MSCs

Undifferentiated control AF-MSCs

a

b

MSCs derived from adipose tissue [Ranera et al., 2011], bone marrow [Radcliffe et al., 2010; Ranera et al., 2011], umbilical cord blood [De Schauwer et al., 2012] and peripheral blood MSCs [Spaas et al., 2013]. However, Mambelli et al. [2009] reported that MSCs derived from equine adipose tissue did not react with CD29. The expression levels of CD44 and CD90 in the present study were comparable with earlier reports [Ranera et al., 2011; Iacono et al., 2012; Spaas et al., 2013]. In this study, 96.96 ± 0.44% of AF-MSCs expressed CD73 in one of two clones tested. The negative results for CD73 expression in flow cytometry in previous reports might be due to the lack of crossreactivity of the antibody clones used for immunophenotyping of equine MSCs [Ibrahim et al., 2007]. This is supported by our observation that on using two different clones of CD73 (clone 5F/B9 and AD2; BD Biosciences), the former did not react with AF-MSCs cells. Only lim386


ited cross-reactivity of monoclonal antibodies between species has been demonstrated in an earlier study [Ibrahim et al., 2007], in which only 14 of 379 monoclonal antibodies against human CD molecules showed cross-reactivity with equine leukocytes. Different techniques such as gene transfection [Wang et al., 2005a], gene transduction [Murray et al., 2010] and application of tensile strain, GDFs and oxygen tension [Raabe et al., 2013] have been attempted for the induction of tenogenic differentiation in MCSs. We evaluated the effect of exogenous supplementation of BMP12 on tenogenic differentiation of equine AF-MSCs and observed that equine AF-MSCs could be differentiated into tenocytes by day 14 following supplementation of BMP-12 (50 ng/ml) to the growth medium, similar to observations by Violini et al. [2009] for equine bone marrow, while 10 ng/ml BMP-12 supplementation inGulati /Kumar /Mohanty /Kumar / Somasundaram /Yadav


Fig. 9. Immunostaining of differentiated (left panel) and control undifferentiated (right panel) equine AF-MSCs after tenogenic differentiation. The cells were stained with antibodies directed against tenomodulin (a) and decorin (b) and visualised under a fluorescence microscope.

Undifferentiated AF-MSCs NRCE April 18, 2013-tube_023

90 80 70 60 50 40 30 20 10 0

95.9%

P2

100

P2

50 0 102

a

3.9%

150

Count

Count

Differentiated AF-MSCs NRCE April 18, 2013-tube_022

103 10 4 Tenomodulin FITC-A

105

102

NRCE April 18, 2013-tube_021

100

60 50

P2

40

Count

Count

0.6%

125

70

30 20

75

P2

50 25

10 0

b

105

NRCE April 18, 2013-tube_019 60.1%

80

103 10 4 Tenomodulin FITC-A

0 102

103 10 4 Decorin FITC-A

105

102

103 10 4 Decorin FITC-A

105

duced tenogenic differentiation in rat MSCs [Lee et al., 2011]. Currently, techniques and markers for the identification of tenocytes are not well defined. We utilised a combination of morphologic traits, and phenotypic and gene expression techniques to assess tenogenic differentiation. The BMP-12-treated MSCs expressed two tendon-related markers (tenomodulin and decorin) by immunocytochemistry, flow cytometry and RT-PCR. The expression of tenomodulin and decorin was observed in 96.7 ± 1.90 and 80.9 ± 6.4% of differentiated cells by flow cytometry, respectively. This is the first report describing flow-cytometric analysis of tenomodulin and decorin expression by equine AF-MSC after tenogenic differentiation. The transmembrane protein tenomodulin is expressed by mature tenocytes and has been implicated in regulating their proliferation and matrix organisation [Docheva et al., 2005]. Decorin is a small cellular or peri-cellular matrix proteoglycan,

which regulates the assembly of collagen fibrils and acquisition of biomechanical properties during tendon development [Zhang et al., 2006]. Consequently, the expression of tenomodulin and decorin in this study is consistent with progressive differentiation of these cells along a tenocytic pathway. In summary, our results suggest that AF is an accessible and effective source of MSCs. These cells hold the promise of value for regenerative veterinary medicine as well as for laboratory in vitro study, because they maintain their in vitro differentiation potential. Further, our study has confirmed at cellular and molecular level through gene expression, immunocytochemistry and flow cytometry that AF-MSCs possess the capability of differentiating into tenocytes. These data will be the basis of future efforts to standardise the isolation, expansion and transplantation of equine undifferentiated and differentiated stem cells in clinical practice.



387


Fig. 10. Flow-cytometric analysis of equine AF-MSCs after tenogenic differentiation. The differentiated cells (left panel) were stained with antibodies to tenomodulin (a) and decorin (b) in comparison to undifferentiated cells (right panel). NRCE = National Research Centre on Equines.

Acknowledgements

Disclosure Statement

The authors wish to thank the Remount Veterinary Services and Equine Breeding Stud, Hisar, India, for providing access for sampling. We thank the National Research Centre on Equines, Hisar, for infrastructure support. Financial support from the Department of Biotechnology, Government of India (grant No. BT/ PR4229/MED/31/149/2012), is duly acknowledged. The assistance in flow cytometry by the BD-FACS Academy, New Delhi, India, is duly acknowledged.

The authors declare that they have no competing interests.

References

388

Corradetti, B., A. Meucci, D. Bizzaro, F. Cremonesi, C.A. Lange (2013) Mesenchymal stem cells from amnion and amniotic fluid in the bovine. Reproduction 145: 391–400. De Schauwer C., S. Piepers, G.R. Van de Walle, K. Demeyere, M.K. Hoogewijs, J.L. Govaere, K. Braeckmans, A. Van Soom, E. Meyer (2012) In search for cross-reactivity to immunophenotype equine mesenchymal stromal cells by multicolor flow cytometry. Cytometry A 81: 312–323. Docheva, D., E.B. Hunziker, R. Fassler, O. Brandau (2005) Tenomodulin is necessary for tenocyte proliferation and tendon maturation. Mol Cell Biol 25: 699–705. Dowling, B.A., A.J. Dart, D.R. Hodgson, R.K. Smith (2000) Superficial digital flexor tendonitis in the horse. Equine Vet J 32: 369–378. Godwin, E.E., N.J. Young, J. Dudhia, I.C. Beamish, R.K. Smith (2012) Implantation of bone marrow-derived mesenchymal stem cells demonstrates improved outcome in horses with overstrain injury of the superficial digital flexor tendon. Equine Vet J 44: 25–32. Hankemeier, S., M. Keus, J. Zeichen, M. Jagodzinski, T. Barkhausen, U. Bosch, C. Krettek, M. van Griensven (2005) Modulation of proliferation and differentiation of human bone marrow stromal cells by fibroblast growth factor 2: potential implications for tissue engineering of tendons and ligaments. Tissue Eng 11: 41–49. Holtorf, H.L., T.L. Sheffield, C.G. Ambrose, J.A. Jansen, A.G. Mikos (2005) Flow perfusion culture of marrow stromal cells seeded on porous biphasic calcium phosphate ceramics. Ann Biomed Eng 33: 1238–1248. Hoynowski, S.M., M.M. Fry, B.M. Gardner, M.T. Leming, J.R. Tucker, L. Black, T. Sand, K.E. Mitchell (2007) Characterization and differentiation of equine umbilical cord-derived matrix cells. Biochem Biophys Res Commun 362: 347–353. Iacono, E., L. Brunori, A. Pirrone, P.P. Pagliaro, F. Ricci, P.L. Tazzari, B. Merlo (2012) Isolation, characterization and differentiation of mesenchymal stem cells from amniotic fluid, umbilical cord blood and Wharton’s jelly in the horse. Reproduction 143: 455–468.


Ibrahim, S., K. Saunders, J.H. Kydd, D.P. Lunn, F. Steinbach (2007) Screening of anti-human leukocyte monoclonal antibodies for reactivity with equine leukocytes. Vet Immunol Immunopathol 119: 63–80. Kastelic, J., A. Galeski, E. Baer (1978) The multicomposite structure of tendon. Connect Tissue Res 6: 11–23. Koch, T.G., T. Heerkens, P.D. Thomsen, D.H. Betts (2007) Isolation of mesenchymal stem cells from equine umbilical cord blood. BMC Biotechnol 7: 26. Koerner, J., D. Nesic, J.D. Romero, W. Brehm, P. Mainil-Varlet, S.P. Grogan (2006) Equine peripheral blood-derived progenitors in comparison to bone marrow-derived mesenchymal stem cells. Stem Cells 24: 1613–1619. Lange-Consiglio, A., B. Corradetti, D. Bizzaro, M. Magatti, L. Ressel, S. Tassan, O. Parolini, F. Cremonesi (2012) Characterization and potential applications of progenitor-like cells isolated from horse amniotic membrane. J Tissue Eng Regen Med 6: 622–635. Lee, J.Y., Z. Zhou, P.J. Taub, M. Ramcharan, Y. Li, T. Akinbiyi, E.R. Maharam, D.J. Leong, D.M. Laudier, T. Ruike, P.J. Torina, M. Zaidi, R.J. Majeska, M.B. Schaffler, E.L. Flatow, H.B. Sun (2011) BMP-12 treatment of adult mesenchymal stem cells in vitro augments tendon-like tissue formation and defect repair in vivo. PLoS One 6: e17531. Lorda-Diez, C.I., J.A. Montero, C. Martinez-Cue, J.A. Garcia-Porrero, J.M. Hurle (2009) Transforming growth factors beta coordinate cartilage and tendon differentiation in the developing limb mesenchyme. J Biol Chem 284: 29988–29996. Lou, J., Y. Tu, M. Burns, M.J. Silva, P. Manske (2001) BMP-12 gene transfer augmentation of lacerated tendon repair. J Orthop Res 19: 1199–1202. Lovati, A.B., B. Corradetti, C.A. Lange, C. Recordati, E. Bonacina, D. Bizzaro, F. Cremonesi (2011) Comparison of equine bone marrow-, umbilical cord matrix and amniotic fluid-derived progenitor cells. Vet Res Commun 35: 103–121.



Arnhold, S., S. Gluer, K. Hartmann, O. Raabe, K. Addicks, S. Wenisch, M. Hoopmann (2011) Amniotic-fluid stem cells: growth dynamics and differentiation potential after a CD-117based selection procedure. Stem Cells Int 2011: 715341. Arnhold, S.J., I. Goletz, H. Klein, G. Stumpf, L.A. Beluche, C. Rohde, K. Addicks, L.F. Litzke (2007) Isolation and characterization of bone marrow-derived equine mesenchymal stem cells. Am J Vet Res 68: 1095–1105. Becerra, P., M.A. Valdes Vazquez, J. Dudhia, A.R. Fiske-Jackson, F. Neves, N.G. Hartman, R.K. Smith (2013) Distribution of injected technetium(99m)-labeled mesenchymal stem cells in horses with naturally occurring tendinopathy. J Orthop Res 31: 1096–1102. Bernardo, M.E., J.A. Emons, M. Karperien, A.J. Nauta, R. Willemze, H. Roelofs, S. Romeo, A. Marchini, G.A. Rappold, S. Vukicevic, F. Locatelli, W.E. Fibbe (2007) Human mesenchymal stem cells derived from bone marrow display a better chondrogenic differentiation compared with other sources. Connect Tissue Res 48: 132–140. Brandau, O., A. Meindl, R. Fassler, A. Aszodi (2001) A novel gene, tendin, is strongly expressed in tendons and ligaments and shows high homology with chondromodulin-I. Dev Dyn 221: 72–80. Braun, J., A. Hack, M. Weis-Klemm, S. Conrad, S. Treml, K. Kohler, U. Walliser, T. Skutella, W.K. Aicher (2010) Evaluation of the osteogenic and chondrogenic differentiation capacities of equine adipose tissue-derived mesenchymal stem cells. Am J Vet Res 71: 1228– 1236. Brehm, W., J. Burk, U. Delling, C. Gittel, I. Ribitsch (2012) Stem cell-based tissue engineering in veterinary orthopaedics. Cell Tissue Res 347: 677–688. Carrade, D.D., S.D. Owens, L.D. Galuppo, M.A. Vidal, G.L. Ferraro, F. Librach, S. Buerchler, M.S. Friedman, N.J. Walker, D.L. Borjesson (2011) Clinicopathologic findings following intra-articular injection of autologous and allogeneic placentally derived equine mesenchymal stem cells in horses. Cytotherapy 13: 419–430.


Radcliffe, C.H., M.J. Flaminio, L.A. Fortier (2010) Temporal analysis of equine bone marrow aspirate during establishment of putative mesenchymal progenitor cell populations. Stem Cells Dev 19: 269–282. Ranera, B., J. Lyahyai, A. Romero, F.J. Vazquez, A.R. Remacha, M.L. Bernal, P. Zaragoza, C. Rodellar, I. Martin-Burriel (2011) Immunophenotype and gene expression profiles of cell surface markers of mesenchymal stem cells derived from equine bone marrow and adipose tissue. Vet Immunol Immunopathol 144: 147–154. Reed, S.A., S.E. Johnson (2008) Equine umbilical cord blood contains a population of stem cells that express Oct4 and differentiate into mesodermal and endodermal cell types. J Cell Physiol 215: 329–336. Schuh, E.M., M.S. Friedman, D.D. Carrade, J. Li, D. Heeke, S.M. Oyserman, L.D. Galuppo, D.J. Lara, N.J. Walker, G.L. Ferraro, S.D. Owens, D.L. Borjesson (2009) Identification of variables that optimize isolation and culture of multipotent mesenchymal stem cells from equine umbilical-cord blood. Am J Vet Res 70: 1526–1535. Shukunami, C., Y. Oshima, Y. Hiraki (2001) Molecular cloning of tenomodulin, a novel chondromodulin-I related gene. Biochem Biophys Res Commun 280: 1323–1327. Smith, R.K., M. Korda, G.W. Blunn, A.E. Goodship (2003) Isolation and implantation of autologous equine mesenchymal stem cells from bone marrow into the superficial digital flexor tendon as a potential novel treatment. Equine Vet J 35: 99–102. Spaas, J.H., C. De Schauer, P. Cornillie, E. Meyer, A. Van Soom, G.R. Van de Walle (2013) Culture and characterisation of equine peripheral blood mesenchymal stromal cells. Vet J 195: 107–113.

Stewart, M.C., A.A. Stewart (2011) Mesenchymal stem cells: characteristics, sources, and mechanisms of action. Vet Clin North Am Equine Pract 27: 243–261. van Schie, H.T., E.M. Bakker, W. Cherdchutham, A.M. Jonker, C.H. van de Lest, P.R. van Weeren (2009) Monitoring of the repair process of surgically created lesions in equine superficial digital flexor tendons by use of computerized ultrasonography. Am J Vet Res 70: 37–48. Violini, S., P. Ramelli, L.F. Pisani, C. Gorni, P. Mariani (2009) Horse bone marrow mesenchymal stem cells express embryo stem cell markers and show the ability for tenogenic differentiation by in vitro exposure to BMP12. BMC Cell Biol 10: 29. Vogel, K.G., J.A. Trotter (1987) The effect of proteoglycans on the morphology of collagen fibrils formed in vitro. Coll Relat Res 7: 105– 114. Wang, Q.W., Z.L. Chen, Y.J. Piao (2005a) Mesenchymal stem cells differentiate into tenocytes by bone morphogenetic protein (BMP) 12 gene transfer. J Biosci Bioeng 100: 418–422. Wang, X.T., P.Y. Liu, K.Q. Xin, J.B. Tang (2005b) Tendon healing in vitro: bFGF gene transfer to tenocytes by adeno-associated viral vectors promotes expression of collagen genes. J Hand Surg Am 30: 1255–1261. Yin, Z., X. Chen, J.L. Chen, H.W. Ouyang (2010) Stem cells for tendon tissue engineering and regeneration. Expert Opin Biol Ther 10: 689– 700. Zhang, G., Y. Ezura, I. Chervoneva, P.S. Robinson, D.P. Beason, E.T. Carine, L.J. Soslowsky, R.V. Iozzo, D.E. Birk (2006) Decorin regulates assembly of collagen fibrils and acquisition of biomechanical properties during tendon development. J Cell Biochem 98: 1436– 1449.


389


Mambelli, L.I., E.J. Santos, P.J. Frazao, M.B. Chaparro, A. Kerkis, A.L. Zoppa, I. Kerkis (2009) Characterization of equine adipose tissue-derived progenitor cells before and after cryopreservation. Tissue Eng Part C Methods 15: 87–94. Martinello, T., I. Bronzini, L. Maccatrozzo, I. Iacopetti, M. Sampaolesi, F. Mascarello, M. Patruno (2010) Cryopreservation does not affect the stem characteristics of multipotent cells isolated from equine peripheral blood. Tissue Eng Part C Methods 16: 771–781. Mauro, A., M. Turriani, A. Ioannoni, V. Russo, A. Martelli, O. Di Giacinto, D. Nardinocchi, P. Berardinelli (2010) Isolation, characterization, and in vitro differentiation of ovine amniotic stem cells. Vet Res Commun 34(suppl 1): S25–S28. Murray, S.J., K.S. Santangelo, A.L. Bertone (2010) Evaluation of early cellular influences of bone morphogenetic proteins 12 and 2 on equine superficial digital flexor tenocytes and bone marrow-derived mesenchymal stem cells in vitro. Am J Vet Res 71: 103–114. Park, S.B., M.S. Seo, J.G. Kang, J.S. Chae, K.S. Kang (2011) Isolation and characterization of equine amniotic fluid-derived multipotent stem cells. Cytotherapy 13: 341–349. Pittenger, M.F., A.M. Mackay, S.C. Beck, R.K. Jaiswal, R. Douglas, J.D. Mosca, M.A. Moorman, D.W. Simonetti, S. Craig, D.R. Marshak (1999) Multilineage potential of adult human mesenchymal stem cells. Science 284: 143– 147. Raabe, O., K. Shell, D. Fietz, C. Freitag, A. Ohrndorf, H.J. Christ, S. Wenisch, S. Arnhold (2013) Tenogenic differentiation of equine adipose-tissue-derived stem cells under the influence of tensile strain, growth differentiation factors and various oxygen tensions. Cell Tissue Res 352: 509–521.

Bone morphogenetic protein 7 induces cementogenic differentiation of human periodontal ligament-derived mesenchymal stem cells.

Multipotency of equine mesenchymal stem cells derived from synovial fluid.

Amniotic fluid-derived mesenchymal stem cells: characteristics and therapeutic applications.

Calcitonin-induced effects on amniotic fluid-derived mesenchymal stem cells.

Bone morphogenetic protein 9 (BMP9) induces effective bone formation from reversibly immortalized multipotent adipose-derived (iMAD) mesenchymal stem cells.

Immunophenotypic characterization and tenogenic differentiation of mesenchymal stromal cells isolated from equine umbilical cord blood.

Cyclic Tensile Strain Induces Tenogenic Differentiation of Tendon-Derived Stem Cells in Bioreactor Culture.

GATA2 regulates differentiation of bone marrow-derived mesenchymal stem cells.

Differentiation of human amniotic fluid-derived mesenchymal stem cells into type II alveolar epithelial cells in vitro.

The potential of mesenchymal stem cells derived from amniotic membrane and amniotic fluid for neuronal regenerative therapy.

Enhanced differentiation of human amniotic fluid-derived stem cells into insulin-producing cells in vitro.

Three-dimensional culture and transforming growth factor beta3 synergistically promote tenogenic differentiation of equine embryo-derived stem cells.

Multilineage potential research of bovine amniotic fluid mesenchymal stem cells.

Osteogenic differentiation of amniotic fluid mesenchymal stromal cells and their bone regeneration potential.

Effects of naringin on the proliferation and osteogenic differentiation of human amniotic fluid-derived stem cells.

Interaction between neural stem cells and bone marrow derived-mesenchymal stem cells during differentiation.

Hepatogenic and neurogenic differentiation of bone marrow mesenchymal stem cells from abattoir-derived bovine fetuses.

Adenovirus-mediated bone morphogenetic protein-2 promotes osteogenic differentiation in human mesenchymal stem cells in vitro.

A cocktail method for promoting cardiomyocyte differentiation from bone marrow-derived mesenchymal stem cells.

Co-culture of human adipose-derived stem cells with tenocytes increases proliferation and induces differentiation into a tenogenic lineage.

Transcription factor Mohawk controls tenogenic differentiation of bone marrow mesenchymal stem cells in vitro and in vivo.

Inner ear stem cells derived feeder layer promote directional differentiation of amniotic fluid stem cells into functional neurons.

Equine adipose-derived mesenchymal stem cells: phenotype and growth characteristics, gene expression profile and differentiation potentials.

Surface glycan pattern of canine, equine, and ovine bone marrow-derived mesenchymal stem cells.