Brain human monoclonal autoantibody from sydenham chorea targets dopaminergic neurons in transgenic mice and signals dopamine D2 receptor: implications in human disease.

This information is current as of March 4, 2015.

Brain Human Monoclonal Autoantibody from Sydenham Chorea Targets Dopaminergic Neurons in Transgenic Mice and Signals Dopamine D2 Receptor: Implications in Human Disease

J Immunol 2013; 191:5524-5541; Prepublished online 1 November 2013; doi: 10.4049/jimmunol.1102592 http://www.jimmunol.org/content/191/11/5524

Supplementary Material References Subscriptions Permissions Email Alerts

http://www.jimmunol.org/content/suppl/2013/11/01/jimmunol.110259 2.DC1.html This article cites 84 articles, 33 of which you can access for free at: http://www.jimmunol.org/content/191/11/5524.full#ref-list-1 Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscriptions Submit copyright permission requests at: http://www.aai.org/ji/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/cgi/alerts/etoc

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 9650 Rockville Pike, Bethesda, MD 20814-3994. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606.

Downloaded from http://www.jimmunol.org/ at Univ of New Hampshire on March 4, 2015

Carol J. Cox, Meenakshi Sharma, James F. Leckman, Jonathan Zuccolo, Amir Zuccolo, Abraham Kovoor, Susan E. Swedo and Madeleine W. Cunningham

The Journal of Immunology

Brain Human Monoclonal Autoantibody from Sydenham Chorea Targets Dopaminergic Neurons in Transgenic Mice and Signals Dopamine D2 Receptor: Implications in Human Disease Carol J. Cox,* Meenakshi Sharma,† James F. Leckman,‡,x,{ Jonathan Zuccolo,* Amir Zuccolo,* Abraham Kovoor,† Susan E. Swedo,x,‖ and Madeleine W. Cunningham*

S

ydenham chorea (SC) is well established as the major neurologic sequela of Streptococcus pyogenes–induced rheumatic fever (1) and is characterized by involuntary movements and neuropsychiatric disturbances, including obsessive-compulsive symptoms and hyperactivity (2). Although SC is associated with *Department of Microbiology and Immunology, University of Oklahoma Health Sciences Center, Biomedical Research Center, Oklahoma City, OK 73104; † Department of Biomedical and Pharmacological Sciences, College of Pharmacy, University of Rhode Island, Kingston, RI 02881; ‡Yale Child Study Center, Yale University School of Medicine, New Haven, CT 06519; xDepartment of Pediatrics, Yale University School of Medicine, New Haven, CT 06519; {Department of Psychiatry, Yale University School of Medicine, New Haven, CT 06519; and ‖Pediatrics and Developmental Neuroscience Branch, National Institute of Mental Health, Department of Health and Human Services, Bethesda, MD 20892 Received for publication September 9, 2011. Accepted for publication September 26, 2013. This work was supported by Grants HL35280 and HL56267 from the National Heart, Lung, and Blood Institute, a supplement from the National Institute of Mental Health, and a grant from the Oklahoma Center for Advancement of Science and Technology. M.W.C. is the recipient of a National Institutes of Health Merit Award. J.F.L. receives grant support from Grifols and the National Institutes of Mental Health Intramural program for a randomized clinical trial of i.v. Ig treatment for children with pediatric autoimmune neuropsychiatric disorder associated with streptococci being conducted at the National Institutes of Health Clinical Center under the leadership of S.E.S. Address correspondence and reprint requests to Dr. Madeleine W. Cunningham, Department of Microbiology and Immunology, University of Oklahoma Health Sciences Center, Biomedical Research Center, Room 217, 975 NE 10th Street, Oklahoma City, OK 73104. E-mail address: [email protected] The online version of this article contains supplemental material. Abbreviations used in this article: ADHD, attention deficit hyperactivity disorder; BBB, blood–brain barrier; CaM kinase II, calcium-calmodulin dependent protein kinase II; D1R, dopamine D1 receptor; D2R, dopamine D2 receptor; GlcNAc, Nacetyl-b-D-glucosamine; HC, H chain; LC, L chain; OCD, obsessive-compulsive disorder; PANDAS, pediatric autoimmune neuropsychiatric disorder associated with streptococci; SC, Sydenham chorea; Tg, transgenic; TH, tyrosine hydroxylase; TRITC, tetramethyl rhodamine isothiocyanate; TS, Tourette’s syndrome. www.jimmunol.org/cgi/doi/10.4049/jimmunol.1102592

streptococcal pharyngitis (3, 4), tics and obsessive-compulsive disorder (OCD) appear to be associated with streptococcal and other types of infections (5–9), as well as with autoantibodies against neuronal Ags (10–14). Movement, behavioral, and neuropsychiatric disorders affect millions of children worldwide. Studies suggesting that infection and autoantibodies might contribute to the pathogenesis of some groups of movement and behavioral disorders began with studies of SC and its relationship to streptococcal infection and autoantibodies against the brain in streptococcal-induced rheumatic fever (15–19). However, actualization of this hypothesis was not recognized until recently when it was discovered that SC was treatable by plasmaphoresis, which correlates with removal of autoantibodies against the brain (20, 21). Other childhood diseases, including some groups of OCD or tics, have also been related to streptococcal infections, with subsequent development of autoantibodies (10, 13, 20, 22–25). These disorders may be identified as pediatric autoimmune neuropsychiatric disorder associated with streptococci (PANDAS) (22) or pediatric acuteonset neuropsychiatric syndrome in the presence of other types of infections (23, 26). The basal ganglia has been implicated as a target of poststreptococcal immune responses (25, 27). Streptococcal-specific Abs in SC were shown to react with neurons in human basal ganglia, and neuronal-specific Ab titers were associated with both severity and duration of choreic episodes (15, 16). Husby et al. (16) found that chorea patient sera reacted strongly with cytoplasmic, but not nuclear, Ags in human caudate and subthalamic nuclei, as well as cerebral cortex neurons. The antibrain reactivity correlated with both severity and duration of choreic symptoms. Immunomodulatory therapies, such as plasma exchange, provide strong evi-


How autoantibodies target the brain and lead to disease in disorders such as Sydenham chorea (SC) is not known. SC is characterized by autoantibodies against the brain and is the main neurologic manifestation of streptococcal-induced rheumatic fever. Previously, our novel SC-derived mAb 24.3.1 was found to recognize streptococcal and brain Ags. To investigate in vivo targets of human mAb 24.3.1, VH/VL genes were expressed in B cells of transgenic (Tg) mice as functional chimeric human VH 24.3.1– mouse C-region IgG1a autoantibody. Chimeric human–mouse IgG1a autoantibody colocalized with tyrosine hydroxylase in the basal ganglia within dopaminergic neurons in vivo in VH 24.3.1 Tg mice. Both human mAb 24.3.1 and IgG1a in Tg sera were found to react with human dopamine D2 receptor (D2R). Reactivity of chorea-derived mAb 24.3.1 or SC IgG with D2R was confirmed by dose-dependent inhibitory signaling of D2R as a potential consequence of targeting dopaminergic neurons, reaction with surfaceexposed FLAG epitope-tagged D2R, and blocking of Ab reactivity by an extracellular D2R peptide. IgG from SC and a related subset of streptococcal-associated behavioral disorders called “pediatric autoimmune neuropsychiatric disorder associated with streptococci” (PANDAS) with small choreiform movements reacted in ELISA with D2R. Reaction with FLAG-tagged D2R distinguished SC from PANDAS, whereas sera from both SC and PANDAS induced inhibitory signaling of D2R on transfected cells comparably to dopamine. In this study, we define a mechanism by which the brain may be altered by Ab in movement and behavioral disorders. The Journal of Immunology, 2013, 191: 5524–5541.


Materials and Methods Human blood samples Blood samples from SC and PANDAS patients and healthy controls were obtained from the National Institute of Mental Health (S.E.S.), the Child Study Center, Yale University (J.F.L.), and the University of Oklahoma Health Sciences Center (M.W.C.). SC was diagnosed using Jones Criteria. PANDAS was diagnosed using the published National Institute of Mental Health criteria (22) and included patients displaying fine piano playing movements of the fingers and toes in addition to obsessive-compulsive symptoms (24). Attention deficit hyperactivity disorder (ADHD) was diagnosed on the basis of a structured psychiatric interview (KiddieSchedule for Affective Disorders and Schizophrenia or Diagnostic Interview for Children and Adolescents) and the Connors Parent and Teacher Rating Scales (34). Healthy controls had no evidence of neurologic or

behavioral abnormalities. All human subjects gave informed consent, and studies were approved by human subjects protection committees at the University of Oklahoma Health Sciences Center, Yale University, and the National Institute of Mental Health. Eight of ten SC, 27/27 PANDAS, 5/5 ADHD, and 18/19 control samples were presented in a different manner by Brimberg et al. (35), who did not include comparison with Tourette’s syndrome (TS)/OCD sera.

Construction of Tg vectors Rearranged Ig HC and LC V genes of human mAb 24.3.1 were cloned previously, and the VH and VL sequences are published (11). Tg constructs were designed to produce a chimeric Ab (human V-gene/mouse C-region Ab) when expressed in Tg mice. 24.3.1 HC Tg construct. A 2.8-kb BamHI-EcoRI fragment of plasmid pG11-LHCuM (provided by Dr. Brett Aplin, University of Melbourne, Melbourne, Victoria, Australia) was excised and religated. This contains Ig promoter, leader, and enhancer regions, as well as a unique SalI restriction site for cloning a V-gene insert (36). The mAb 24.3.1 rearranged VH gene, previously cloned into a PCR vector, was amplified using the following primers: 24HCTg59, 592CGCGTCGACTTGCTTTTCTGTTTCCAAGCAGGGGTCAATTCAGGTGCAGCTGGTG-39 and 24HCTg39, 592CGCGTCGACAGATCTAGCACACAGACCCTATTACTCACATACCTGCAGAGACAGTGAGGAGACGGTGAC-39. These primers contain consensus splice acceptor or donor sequences plus SalI restriction sites (bold type) for cloning. The 456-bp amplified PCR product was digested with SalI (Promega) and cloned into the corresponding SalI site in the modified Tg vector, creating a 3.2-kb plasmid. Verification of the presence of the 24.3.1 VH insert was done by diagnostic restriction enzyme digestion, as well as by sequencing of PCR amplification products. A mouse HC construct containing the IgG1 constant regions and membrane exons was kindly provided by Dr. Chris Goodnow (John Curtin School of Medical Research, The Australian National University, Canberra ACT, Australia). Experiments with this vector were described previously (37); parts of this vector are the same as pG11-LHCuM. A 9.5-kb region of the IgG1 plasmid, flanked by HindIII restriction sites, contains the Sg1 region, the constant and hinge exons, and the membrane exons. Primers were designed to amplify this region and the upstream regions, based on the published genomic sequence (GenBank). Three regions (including the cloned 24.3.1 VH gene site) were PCR amplified and tandemly ligated, as previously described (38), to create the 24HCTg Tg construct. 24.3.1 LC Tg construct. The LC Tg vector, pSV-LkCkΔJ4J5, generously provided by Dr. Brett Aplin (University of Melbourne, Melbourne, VIC, Australia), is an 11.4-kb plasmid containing a 6.4-kb region with the LC promoter and leader sequences, the SalI restriction site for cloning VL gene, and the mouse k C region. Amplification primers, TgLK-F5 (59CGGTCTGTGAAAAACCCCT-39) and TgLK-R4 (592TCCCCCTGAACCTGAAACATA-39), which spanned this region, were designed based on known plasmid and insert DNA sequences; this 6.5-kb fragment was amplified by PCR and subsequently cloned into the PCR cloning vector, pCR2.1 TOPO-TA (Invitrogen), creating the LKTA vector. Verification of the presence and orientation of insert was done by diagnostic restriction enzyme digestion, as well as by sequencing of PCR amplification products. The 24.3.1 VL gene was amplified using primers 24LCTg59 (59-CGCGTCGACTTGCTTTTCTGTTTCCAAGCAGGAGCCATCGGGGAAATTAGTGATGACG-39) and 24LC39 (592CGCGTCGACAGATCTAGCACACAGACCCTATTACTCACATACGTTTGATCTCCAGCTTGGTCCC-39), containing consensus splice acceptor or donor sequences and SalI restriction sites (bold type), which yield a 456-bp product. The VL gene amplification product was purified and digested with SalI (Promega). The digested DNA was then ligated into the corresponding SalI site of the LKTA vector, creating the 24LC-LKTA Tg vector. Correct orientation of the 24.3.1 LC V-gene insert was verified by DNA sequencing using primers flanking the insert, including TgLK-For24 (59-ATGGGCATCAAAATGGAGTCA-39) and 24LCRev1 (59-AGGCTGCTGATGGTGACAGT39). Expression of the chimeric human V-gene/mouse C-region Ab from the 24.3.1 transgenes was tested by transient transfection into mouse myeloma cells, as described below.

Generation of Tg mice Purified 24.3.1 HC and LC Tg constructs (13.8-kb and 6.4-kb BamHI DNA fragments) were used for pronuclear microinjection into C57BL/6 mouse embryos at Xenogen Biosciences/Caliper Life Sciences (Cranbury, NJ). Genomic DNA used to create the HC Tg vector was derived from a BALB/C mouse (IgG1a allotype); having the transgenes in C57BL/6 mice (IgG1b allotype) allows for detection of the HC transgene by ELISA and FACS, and most importantly, in vivo in the brain. The 24.3.1 chimeric transgenes


dence that SC is caused by a pathogenic Ab response (20). Other groups of neuropsychiatric and movement disorders, including PANDAS, may also be associated with an autoantibody response against the brain (13, 28) and abnormal brain magnetic resonance imaging (29). Improvement was also seen in these cases after plasmaphoresis (21, 30). The hypothesis that SC and its pathogenesis may develop as a result of signaling autoantibodies directed against neuronal cells in the brain was delineated by studies using SC-derived human mAbs. SC mAb cross-reactivity was first associated with the group A streptococcal carbohydrate epitope N-acetyl-b2D-glucosamine (GlcNAc) and neuronal surface Ag lysoganglioside GM1 and a helical intracellular brain protein tubulin (10, 11). The cross-reactivity between GlcNAc and a helical peptide structures has been studied extensively (31–33). Chorea-derived human anti-streptococcal mAb 24.3.1 also induced increased calcium-calmodulin dependent protein kinase II (CaM kinase II) activity in a human neuronal cell line (10), and intrathecal passive transfer of mAb 24.3.1 induced elevated tyrosine hydroxylase (TH) in rat brains (12). mAb 24.3.1 exhibited stronger avidity for neuronal Ags, which may explain its ability to signal neuronal cells, but the extracellular targets responsible for the signaling were not defined. SC mAb specificities were similar to the neuronal-specific IgG in sera or cerebrospinal fluid from active chorea (10). Ab-mediated cell signaling leading to excess dopamine release was suggested to be involved in the immunopathogenesis of SC, as well as other CNS disorders, but the functional in vivo targets explaining mechanisms in disease were not identified. To gain further insight into in vivo functional Ab targets that may be involved in the mechanisms of SC and related CNS disorders, we created transgenic (Tg) mice expressing chorea-derived human mAb 24.3.1 H chain (HC) and L chain (LC) V-region (VH and VL) genes as part of a chimeric (human V-gene/mouse C-region) IgG1a Ab. Mice Tg for mAb 24.3.1 V genes were validated by characteristic cross-reactive anti-neuronal Ab specificities in serum and of mAbs produced from lymphocytes of Tg mice. Chimeric 24.3.1 Tg Ab penetrated the brain and dopaminergic neurons in the basal ganglia of Tg mice, most likely in the substantia nigra or ventral tegmental area. However, not all neurons targeted were dopaminergic, and a significant portion of them were located in the cortex. Furthermore, human mAb 24.3.1 was similar to sera from SC and other movement and neuropsychiatric disorders, which had elevated IgG to human dopamine D2 receptor (D2R). SC-derived mAb 24.3.1 and SC IgG reacted with FLAG-tagged D2R, whereas PANDAS IgG did not. However, human chorea mAb 24.3.1, sera from the human SC mAb B cell donor, and PANDAS sera all induced inhibitory signaling of D2R, which may be the consequence of Ab targeting of dopaminergic neurons. Our novel findings suggest that signaling autoantibodies may play a role in chorea and other movement and behavioral disorders.

5525

5526

BRAIN AUTOANTIBODY TARGETS DOPAMINERGIC NEURONS

were coinjected, and litters consisting of a total of 65 mice were born. Screening for incorporation of transgene(s) was done by tail DNA PCR using mAb 24.3.1 V-gene–specific primers. Nine founder mice were generated that were either HC (VH) only or double-integration positive Tg (VH+VL). Southern hybridization was performed to confirm correct orientation of the transgene(s) in the genome and to determine copy number. Sequencing of PCR products confirmed that the inserted VH and VL genes in founder animals were correct and unmutated. Sera from founders were collected and screened by ELISA to verify expression of the chimeric IgG1a Ab. Founders were maintained at Xenogen and backcrossed to C57BL/6 mice. Tg mice were shipped to the University of Oklahoma Health Sciences Center for experimental studies and housed at the University of Oklahoma Health Sciences Center Animal Facility. Negative littermates or C57BL/6 wild-type mice (Taconic) were used as experimental controls. All experiments on animals were performed in accordance with relevant institutional (National Institutes of Health and University of Oklahoma Health Sciences Center) guidelines and regulations as set by the University of Oklahoma Health Sciences Center Institutional Animal Care and Use Committee.

DNA isolation and purification

PCR PCR amplification of DNA was performed using 0.1–1 ng plasmid template DNA or 50–400 ng genomic template DNA and 0.5 mM 59 and 39 oligonucleotide primers, using Platinum Taq PCR Supermix, High Fidelity (Invitrogen). Amplification was performed using a Gene-Amp PCR System 2700 (Applied Biosystems). Cycling parameters were dependent on the primers and template being used, but followed this general profile: 94˚C for 1 min, followed by 30–45 cycles of 94˚C for 15–30 s, 50–65˚C for 15–30 s, 72˚C for 1 min/kb, and then 10 min at 72˚C. PCR amplification products were separated by electrophoresis on 1% (w/v) Tris HCl–borate– EDTA ethidium bromide–containing agarose gels and visualized under UV light, as per standard molecular biological procedures.

DNA cloning Molecular weight markers, restriction endonucleases, and DNA-modifying enzymes (Promega, Invitrogen, New England BioLabs) were used according to the manufacturers’ instructions. Insert DNA and/or plasmids for cloning were digested with appropriate restriction enzymes and size separated by agarose gel electrophoresis. Digested DNA samples were separated on 0.8–1.25% modified TAE (40 mM Tris-acetate, 0.1 mM Na2 EDTA [pH 8]) agarose gels, and DNA bands were excised and purified using the Montage DNA Gel Extraction kit (Millipore) or the QIAquick Gel Extraction Kit (QIAGEN). DNA samples were concentrated using Microcon YM-50 centrifugal filter units (Millipore) if necessary. PCR amplification products (for cloning or direct sequencing) were purified by the above-mentioned gel-extraction methods or by Montage PCR filter units (Millipore). Small DNA products (,1 kb), which were cloned into the pCR2.1-TOPO TA vector (Invitrogen), were transformed into One Shot TOP10 Chemically Competent Escherichia coli cells (Invitrogen), following the provided protocols. Inserts cloned into Tg or other vectors were ligated using T4 DNA ligase (Invitrogen), following the recommended insert/vector DNA ratios. Larger DNA inserts and DNA fragments cloned into large Tg vector constructs with a propensity for recombination were transformed into One Shot OmniMax 2 T1 Phage–resistant cells (Invitrogen) or SURE cells (Stratagene), following the suppliers’ protocols. Growth and propagation of transformed cells and selection of positive transformants were performed following standard molecular biological protocols.

Oligonucleotide primers Primers were designed according to known sequence, using the Primer 3 (v.0.4.0) primer design program (SourceForge) and were synthesized by

DNA sequencing Sequencing was performed by the University of Oklahoma Health Sciences Center Laboratory for Genomics and Bioinformatics. Nucleotide alignments were performed using the basic local alignment search tool analysis program (National Center for Biotechnology Information), IMGT/V-QUEST (International Immunogenetics Information System), and WUR MUSCLE multiple alignment analysis program (http://www.bioinformatics.nl/tools/ muscle.html).

Transient transfections Sp2/0 mouse myeloma cells were maintained in culture in IMDM (Life Technologies) containing 10 IU/ml penicillin/streptomycin (Life Technologies), 10 mg/ml gentamicin (Sigma), and 10% (v/v) heat-inactivated FCS (Hyclone). Cells were fed 18 h prior to transfection. A total of 10–15 mg each DNA species to be transfected and 1.5 mg the plasmid were linearized separately by restriction enzyme digestion and purified using Amicon Micropure-EZ centrifugal filter devices (Millipore). Electroporation was performed using parameters previously published for Sp2/0 cells (39). Each linearized DNA sample was added to 1.6 3 107 Sp2/0 cells, and samples were incubated on ice for 10 min. The cells were then electroporated at 960 mF, 2 kV/cm using Gene Pulser Xcell (Bio-Rad). After an additional 10-min incubation on ice, each set of cells was transferred to a plastic media dish containing 3 ml prewarmed IMDM with 20% FCS. Cells were cultured at 37˚C overnight, after which the supernatant was collected for ELISA, and transfectants were collected and stored in TRI Reagent (Molecular Research Center) at 280˚C for subsequent RNA extraction and RT-PCR.

Southern hybridization Southern blotting was performed to determine orientation and copy number of transgenes. Purified genomic DNA from Tg mice and control C57BL/6 wild-type mice was provided by Xenogen. Hybridization was done using Stratagene’s Illuminator Chemiluminescent Detection System, following the Southern blot procedure described in the accompanying manual. Probes were purified PCR products of the variable regions from the 24.3.1 HC or LC (24HCTg59–39 and 24LCTg59–39).

RNA isolation and RT-PCR Total RNA was isolated from whole spleen or tissue culture cell lines using TRI Reagent (Molecular Research Center, Cincinnati, OH) following the protocol provided. Contaminating DNA was removed by treatment with DNase I (1 U/mg RNA) (Invitrogen), per the manufacturer’s protocol. RTPCR was performed using the Superscript III One-step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen), using either genespecific primers or Ig-Primer Sets (human or mouse) from Novagen. Reactions were performed on a Gene-Amp PCR System 2700 (Applied Biosystems) using the following cycling profile: 45˚C for 30 min (firststrand cDNA synthesis reaction), denaturation at 94˚C for 2 min, followed by 50 cycles of 94˚C for 15 s, 50˚C for 30 s, 68˚C for 1 min, and a 5-min extension at 68˚C. Results of amplification were assessed by visualizing an aliquot of the RT-PCR products (10 ml each) on an ethidium bromide– stained 1% Tris HCl–borate–EDTA agarose gel. The remainder of the amplification products were purified by column filtration or gel extraction, as described above. Purified RT-PCR products were either cloned into plasmid vectors or submitted for sequencing.

Treatments to open blood–brain barrier To open the blood–brain barrier (BBB) and stimulate Tg B cells, Tg and non-Tg littermates were immunized with streptococcal cell wall and LPS, following the method of Kowal et al. (40). Serum was collected before and after immunization and analyzed by capture ELISA using anti-mouse IgG1a. Animals were sacrificed at the end of the experiments, brains were collected and placed in formalin for histopathological analysis and immunohistochemical staining, and serum was collected for ELISA. Spleens were collected from Tg mice and used for RNA extraction/RT-PCR, FACS analysis, and hybridoma production. Peripheral lymph nodes and bone marrow were harvested for FACS analysis.

ELISAs Ninety-six–well polyvinyl, Immunolon-4 microtiter plates (Dynatech Laboratories) were coated with 10 mg/ml Ag overnight at 4˚C. Plates were reacted with sera or hybridoma supernatant overnight at 4˚C. Ab binding


Small-scale plasmid DNA isolation was performed using a Wizard Plus Minipreps DNA Purification system (Promega). Endofree Plasmid Maxi kit (QIAGEN) and PureYield Plasmid Midiprep and Maxiprep Systems (Promega) were used for medium- and large-scale plasmid DNA preparation for cloning, cell transfections, and transgenesis microinjection. Genomic DNA from mouse tail tissue samples was purified using the EasyDNA isolation kit (Invitrogen). All kits were used following the manufacturers’ instructions. DNA constructs used for microinjection were further purified by dialysis against TE buffer (10 mM Tris, 0.25 mM EDTA [pH 7.5]) using Millipore V-series mixed cellulose ester microdialysis membranes (0.025 mm) following the transgene preparation protocol supplied by Xenogen. Concentration and purity of DNA samples were determined by spectrophotometric analysis at 260/280 nm using a Synergy HT Multidetection microplate reader (Bio-Tek) with KC4 software.

Invitrogen. Commercial universal forward and reverse primers for M13 (Promega) were also used.


Competitive-inhibition ELISA with D2R peptide Competitive-inhibition ELISA was performed in duplicate, as previously described (32, 44). Concentration of mAbs was 100 ng/ml. Peptide inhibitors were prepared as 1-mg/ml solutions in PBS (pH 7.2) and serially diluted from 500 to 1 mg/ml. The diluted inhibitors were mixed with an equal volume of each mAb and incubated at 37˚C for 1 h, followed by an overnight incubation at 4˚C. The mAb-inhibitor mixture was added to 96well microtiter plates coated with human dopamine receptor D2L (PerkinElmer) at 10 mg/ml in bicarbonate buffer. Samples were allowed to incubate overnight at 4˚C. Ab binding was detected using alkaline phosphatase–conjugated anti-human IgM (Sigma). The remainder of the assay was performed as described above. Maximal (100%) reactivity was determined by mAb–PBS incubation without inhibitors. Mouse monoclonal anti-human D2R Ab clone 1B11 was purchased from Sigma and was detected using alkaline phosphatase–conjugated goat anti-mouse IgG (Fab specific; Sigma). Mouse mAb 1B11 was produced after immunization of mice with human D2R residues 1–110.

Human D2R peptide sequences D2R peptides were synthesized by ImmunoKontact (AMS Biotechnology, Lake Forest, CA) and purified by HPLC. The sequences and designations are as follows: DRD2 E1.1, MDPLNLSWYDDDLERQNWSR and DRD2 E1.2, SRPFNGSDGKADRPHYNYYA. Control peptide was a previously described human cardiac myosin peptide: FTRLKEALEKSEARRKELEERMVSL (45, 46).

Flow cytometry Lymphocytes from spleen, bone marrow, and lymph nodes were fluorescently labeled and analyzed by FACS. Spleens, lymph nodes, and bone marrow from Tg mice and non-Tg littermates were harvested, and singlecell suspensions were prepared. Spleens were pushed through autoclaved screens to homogenize tissue. Isolation of spleen cells and cells from peripheral lymph nodes was performed using Histopaque-1083 Hybri-Max (Sigma). Bone marrow was isolated from mouse femurs as follows: heads of femurs were cut off and discarded, and bones were placed in 0.6-ml centrifuge tubes, each with a hole in the end made by an 18-gauge needle. Each tube was placed in a 1.5-ml centrifuge tube and pulse centrifuged for 30 s. RBCs in the collected bone marrow were removed by treatment with the Mouse Erythrocyte Lysing Kit (R&D Systems), following the manufacturer’s protocol. Cells from spleen, bone marrow, and lymph nodes were resuspended at 1.0 3 106 cells/ml in 500 ml FBS stain buffer (Pharmingen) and incubated for 30 min with the appropriate biotinylated or directly fluorescein-labeled Ab for FACS analysis. Cells were washed

with FBS stain buffer after incubations; sequential incubations were performed for cell samples that were stained with more than one fluorochrome. All incubations were conducted on ice in the dark. Wash steps were carried out by adding 1 ml FBS stain buffer to each tube, followed by centrifugation at 1000 rpm for 5 min at 4˚C in a Beckman Coulter Allegra 25R centrifuge. Cells were labeled with Abs coupled to biotin (anti-mouse IgG1a, anti-mouse IgG1b) or one of the following fluorochromes: PerCPCy5.5 (anti-mouse B220), R-PE (anti-mouse CD23), or allophycocyanin (anti-mouse CD21). Biotin-conjugated Abs were also incubated with streptavidin-FITC. All labeled Abs were purchased from Pharmingen. Isotype-control Abs (Biotin Mouse IgG2a k, Biotin Mouse IgM k, PerCPCy5.5 Rat IgG2a k, PE-Rat IgG2a k, allophycocyanin Rat IgG2b k) were used at the same concentrations as the Abs of interest. After labeling, cells were resuspended in 500 ml 13 fixative containing 1.4% formaldehyde (R&D Systems). Labeled cells were stored in the dark at 4˚C overnight and then analyzed on a FACSCalibur automated four-color benchtop flow cytometer (BD Biosciences) at the University of Oklahoma Health Sciences Center Flow and Image Cytometry Laboratory. Dead and irrelevant cell populations were excluded by setting gates on the basis of forward and side scatter profiles. Stained cells were analyzed initially to estimate the percentage of cells expressing B220, a marker present on cells committed to the B lineage. B cell subpopulations were identified by anti–B220PerCP-Cy5.5 in combination with fluorescently labeled Abs against the other cell surface markers, anti-CD23 and anti-CD21, to characterize the cells with regard to maturation level and location (i.e., marginal zone or follicular). Computer analysis was done using Summit v 4.3 software (Dako Colorado).

Immunohistochemistry Colocalization studies were performed using paraffin-embedded Tg mouse brain tissue sections. Brain sections were tested to determine whether Tg Ab IgG1a expressed in vivo by B cells deposited in the brains of Tg mice. Formalin-fixed mouse brains were cut, mounted on slides, and stained following previously described protocols (11, 44). Briefly, tissue was fixed overnight in 10% buffered formalin, sectioned (5-mM thick), and mounted onto Microprobe probe-On Plus slides. Mounted tissue was baked for 60 min and deparaffinized, followed by rehydration using graded ethanol. Heat-mediated Ag retrieval was performed using a rice cooker and sodium citrate buffer (10 mM sodium citrate, 0.05% Tween 20 [pH 6]). Slides were heated for 20 min and allowed to cool to room temperature. Slides were then washed twice in PBS (pH 7.4) and blocked with a protein blocker for 15 min at room temperature, followed by two additional washes in PBS. Colocalization by double immunostaining used Abs conjugated to FITC and tetramethyl rhodamine isothiocyanate (TRITC). For localization of chimeric IgG1a Ab, biotin-conjugated mouse anti-mouse IgG1a was used (5 mg/ml; BD Pharmingen) in combination with FITC-conjugated streptavidin (1:20; Invitrogen). For immunostaining of dopaminergic neurons, rabbit polyclonal Ab to TH (Sigma) was used as the primary Ab (1:100), with TRITC-conjugated sheep anti-rabbit polyclonal Ab as the secondary Ab (1:100; Sigma). For immunostaining of D2R, rabbit anti-dopamine D2 receptor polyclonal Ab (Abcam) was used as the primary Ab (1:35), with TRITC-conjugated sheep anti-rabbit polyclonal Ab mentioned above used as the secondary Ab (1:100). Tissue staining by primary Abs was done by overnight incubation at 4˚C, and fluorescently labeled secondary Abs were incubated on tissues for 1 h at room temperature in a humidified chamber in the dark on the following day. Washes were done in PBS (pH 7.4). For positive control for anti-mouse IgG1a staining, mouse brain tissue was incubated with IgG1a Ab (mouse mAb to neuron-specific b-III tubulin [Abcam]) (1:500) for 2 h, followed by washes and incubation with biotinlabeled anti-mouse IgG1a and streptavidin-FITC, as previously described. Mouse liver tissue was used as negative control for TH Ab staining. Prior to viewing, slides were treated with Prolong Gold Anti-fade reagent with DAPI (Invitrogen), per the manufacturer’s recommended protocol, to reduce photobleaching and stain nuclei. Slides were viewed with an Olympus BX41 microscope equipped with DAPI, FITC, and TRITC filters, and micrographs were imaged with a SPOT InSight 2 FireWire Camera. Images were merged using SPOT Software V. 4.6 (Diagnostic Instruments). Colocalization studies were performed on paraffin-embedded normal mouse brain tissue sections using SC-derived human mAbs 24.3.1, 37.2.1, and 31.1.1 (100 ng/ml). Detection of human mAbs was by FITCconjugated goat anti-human IgM (1:50; Jackson ImmunoResearch). Incubation with media only (IMDM supplemented with 10% FCS) was performed as a control.

Generation of chimeric Ab–secreting hybridomas Spleens from Tg mice were harvested and mashed through screens using Histopaque-1083 Hybri-Max (Sigma). Cells were fused with K6H6/B5


was detected using alkaline phosphatase conjugated to specific secondary Ab or to streptavidin. Plates were developed with 1 mg/ml pnitrophenylphosphate-104 substrate (Sigma) at 50 ml/well. OD was quantified at 405 nm in an Opsys MR microplate reader (Dynex Technologies) or a Synergy HT Multidetection microplate reader (Bio-Tek) using KC4 software. Capture ELISAs were performed using purified mouse anti-mouse IgG1a (Igh-4a) mAb (BD Pharmingen) or goat anti-mouse IgG1 (Sigma) as the coating Ab. Biotin-conjugated mAbs [mouse anti-mouse IgG1a, mouse anti-mouse IgG1b (Igh-4b), rat anti-mouse Igk (BD Pharmingen)] diluted 1/5000 in 1% BSA-PBS (or 1/500 for anti-Igk)] were used as secondary Ab where appropriate. Biotinylated conjugates were further incubated with ExtrAvidin-Alkaline Phosphatase (Sigma) at the same dilution. Ag panel ELISA testing included ds- and ssDNA (Invitrogen), human dopamine receptor D2L (D2R long isoform; PerkinElmer) (41), and b-tubulin (MP Biomedical), as well as rabbit skeletal tropomyosin, mouse laminin, and BSA (all from Sigma). Also tested in the ELISA were pepsin cleavage products of streptococcal M5 protein (PepM5) and GlcNAc-BSA, which were prepared as previously described (42, 43). Lysoganglioside (Sigma) was also tested and was coated at 20 mg/ml on microtiter plates, as previously described (10). Biotin-conjugated mAb mouse anti-mouse IgG1a was used as secondary Ab in the Ag panel ELISA. Alkaline phosphatase– conjugated anti-human IgM (Sigma) was used for detection of human mAb 24.3.1. For testing of human sera for the presence of D2R Abs, plates were coated with human dopamine receptor D2L (PerkinElmer) at 10 mg/ml. Alkaline phosphatase–conjugated goat anti-human IgG (g-chain specific) F(ab9)2 fragment (Sigma) was used for detection. To determine the D2R Ab titer, sera were diluted 1/100 in 1% BSA in PBS buffer and subsequently diluted 2-fold, and ELISA was performed as described above. For the D2R Ab titers, tests were performed separately three times, and the titration was done in duplicate in each assay. Titers were determined as the highest dilution with OD value of 0.10 at 2 h. Controls used included serum alone, secondary Ab conjugate alone, and 1% BSA alone.

5527

5528


hybridoma fusion partner, a nonsecreting human 3 mouse heterohybridoma line (ATCC CRL-1823; American Type Culture Collection), using polyethylene glycol 1000, as previously described (32). Hybridomas were selected using hypoxanthine, aminopterin, and thymidine–supplemented media and allowed to proliferate in TH medium, after which cell culture supernatants were tested for Ig production and specific Ag binding. Subsequently, hybridomas were cloned by limiting dilution at ,1 cell/well and then subcloned twice to produce B cell hybridoma clones. Clones were maintained in DMEM with 10% FCS under standard cell culture conditions.

Screening of hybridomas Hybridoma supernatants were screened by capture ELISA for isotype (IgG1, IgK) and allotype (IgG1a, IgG1b) of Ab and by Ag panel ELISA for antigenic specificity. V-gene cDNA sequence analysis was performed on each hybridoma clone. Total RNA was extracted from 5 3 106 hybridoma cells using TRI Reagent (Molecular Research Center). RT-PCR was performed using mAb 24.3.1 V-gene specific primers, Mouse Ig-Primers (Novagen), and primers specific to g and k constant regions. The resulting RT-PCR products were purified and sequenced.

Assays were done using A9 L-hD2 S.C.18 (ATCC CRL-10225), a fibroblast cell line expressing human D2R. The untransfected A9 cell line (ATCC CCL-1.4) was used as a control. Cells were grown and isolated for the assay following the published procedure of Tang et al. (47). Briefly, cells were plated in 12-well culture plates and grown to confluence (∼1 3 106 cells/ well) in IMDM supplemented with 10% FBS (Life Technologies) at 37˚C. Prior to assays, cells were washed three times with prewarmed DMEM supplemented with 0.1% ascorbic acid and 20 mM Tris (pH 7.4) and preincubated in 400 ml the same medium for 10 min at 37˚C. Incubations were started by adding 100 ml the above-mentioned prewarmed DMEM containing test drugs (i.e., dopamine, 10 mg/ml [Sigma]), human serum (1:50), or hybridoma cell supernatant. Incubations were done for 20 min at 37˚C. Overnight treatment with pertussis toxin (100 ng/ml; Sigma) was done as a control. cAMP assay was performed using a cAMP Direct Immunoassay Kit (BioVision), following the manufacturer’s protocol, and a standard curve from 3.12 to 200 pmol was run on each plate. Concentration of cAMP in samples was calculated from the standard curve using GraphPad Prism 5 or KC4 software.

Ab-binding experiments using FLAG epitope-tagged D2R transfectants HEK293T cells were cultured in 96-well plates in DMEM with 10% FBS (Sigma), 50 U/ml penicillin, and 50 mg/ml streptomycin. Transient expression of D2R was achieved by transfecting cells with a plasmid vector (pcDNA/Zeo; Invitrogen) containing a FLAG-tagged D2L receptor cDNA construct using Lipofectamine LTX (Invitrogen) transfection reagent. Control cells were transfected with the empty vector. Forty-eight hours posttransfection, cells were fixed using 4% w/v formaldehyde (15 min at 4˚ C) in PBS. Cells were blocked for 45 min with 3% BSA in PBS before incubation with the indicated Abs (1 h, 20˚C) in the blocking buffer. The M2 anti–FLAG-tagged mouse mAb (Sigma) was used at a dilution of 1:250 as a positive control. The affinity-purified human mAbs were used at a concentration ∼3 mg/ml. Human sera from PANDAS and SC patients and normal healthy controls were used at 1:100 dilution. Cells were washed three times with PBS at 4˚C and then incubated (1 h, 20˚C) with the appropriate HRP-conjugated anti-mouse or anti-human secondary Abs (Jackson ImmunoResearch; 1:5000 dilution in blocking buffer). HRP-catalyzed

FIGURE 1. Schematic representation of DNA constructs used to generate 24.3.1 Tg mice. (A) LC construct. The Vk construct contains the human mAb 24.3.1 SalI-flanked VJ region in addition to Ig promoter (Pk) and leader (Lk) sequences and the mouse k C region (Ck). (B) HC construct. Human mAb 24.3.1 VDJ region flanked by SalI restriction sites was cloned into a mouse IgG1a Tg construct that was described previously (37). Restriction sites: B, BamHI; C, ClaI; N, NotI. S, Switch region; M, membrane region.

Statistical analysis For ELISA and cAMP assays, the effect of multiple treatment groups was evaluated by one-way ANOVA using GraphPad Prism 5 software. Difference of the means was evaluated by the Tukey test. For human sera ELISA data (Fig. 7), analysis was performed using Mann–Whitney and Kruskal–Wallis tests.

Results Tg mice To further investigate in vivo targets of human mAb 24.3.1 from SC, Tg mice expressing HC and LC V-region genes of antistreptococcal/anti-brain human mAb 24.3.1 were generated by pronuclear microinjection of HC and LC Tg vector constructs into C57BL/6 mouse embryos. The human VL and VH genes were cloned into Tg vectors containing upstream regulatory (promoter, leader, and enhancer) and constant regions of murine Igk (Fig. 1A) and murine IgG1 allotype a (Fig. 1B). The HC construct also contained the murine IgG1 membrane exons. Tg constructs were coinjected into C57BL/6 mouse embryos by Xenogen Biosciences-Caliper Life Sciences (Cranbury, NJ). Litters were screened with mAb 24.3.1 V-gene–specific primers for incorporation of the gene(s). The chimeric VH transgene IgG1a allotype allowed detection of expression in the C57BL/6 background (b allotype) by anti-allotypic Ab. Tg mice produced were primarily single Tg (containing VH only). Expression of transgene(s) in mice resulted in production of a chimeric (human V-gene/mouse IgG1a C-region) Ab. The Tg24.3.1IgG1a Ab was expressed in serum at 1–4 mg/ml, with the highest levels observed when the double Tg (VH+VL) was expressed (Fig. 2). Expression levels were monitored at monthly intervals. Fig. 2 shows levels in representative 6-mo-old Tg mice. FACS analysis determined B cell surface expression of Tg24.3.1IgG1a chimeric Ab. Splenic B cells from Tg mice expressed similar levels of IgG1a and endogenous IgG1b (data not shown), indicating no allelic exclusion. In bone marrow, some Tg mice had B cells that expressed more than twice as many chimeric IgG1a receptors as IgG1b receptors. Previous work suggests that Tg mice expressing Ig genes have reductions in relative B cell numbers in spleen, bone marrow, and peripheral blood and accelerated maturation and more rapid emigration of B cells due to earlier, more synchronous expression of the Tg HC (48).


cAMP assays

chemiluminescence was generated using SuperSignal West Femto Chemiluminescent Substrate (Pierce) and measured using a GloMax Microplate Luminometer (Promega). To normalize the signal for cell number, cells were incubated with ethidium bromide (1 mM in PBS, 5 min), and fluorescence intensity was measured using a SpectraMax Microplate Reader (Molecular Devices; excitation, 530 nm; emission, 590 nm). Data are reported as the ratio of luminescence/ethidium bromide fluorescence intensity.


5529

FIGURE 2. Expression of chimeric IgG1a in sera of Tg mice. Capture ELISA using anti-mouse IgG1a confirmed the expression of 24.3.1 VH chimeric Ab in sera of 6-mo-old 24.3.1 Tg mice.

To determine whether binding specificities of chimeric Tg24.3.1IgG1a Ab matched those recognized by human mAb 24.3.1, sera from Tg mice were reacted with a panel of streptococcal and brain Ags. Single VH 24.3.1 and double VH+VL 24.3.1 Tg serum IgG1a Ab retained specificity to brain Ags lysoganglioside and tubulin, as well as streptococcal group A carbohydrate epitope GlcNAc and streptococcal wall membrane Ag (Fig. 3A, 3B). These sera did not react with ssDNA, dsDNA, or BSA, indicating the specificity of the Tg Abs. Fig. 3A shows double Tg serum reactivity, and single VH Tg sera are shown in Fig. 3B. Furthermore, mAbs were produced from splenic B cells of VH 24.3.1 Tg mice. Thirteen Tg B cell hybridoma clones producing strong antilysoganglioside binding by the Tg IgG1a Ab were selected. VH transgene expression in the hybridomas was verified by RT-PCR and subsequent cDNA sequencing through the V(D)J junction. All thirteen Tg-derived VH 24.3.1 mAbs (IgG1a) were similar and retained specificities to tubulin, lysoganglioside, and GlcNAc; three representative clones are shown in Fig. 3C. The specificities found in Tg mouse sera or Tg hybridomas expressing the 24.3.1 VH transgene were very similar to the human chorea-derived mAb 24.3.1. Twelve mAbs, including three mAbs shown, did not react with ssDNA or dsDNA. One 24.3.1 Tg-derived mAb (66-4.8) was unique in that it strongly recognized dsDNA (OD = 0.6). None of the Tg-derived mAbs reacted with BSA. These data further confirm the validity of the VH 24.3.1 Tg Ab in the Tg mice. Nucleotide sequence analysis of Tg B cell hybridoma–derived VL genes showed similarities in LC VL gene usage, with some clones preferentially using Vk 21E and Vk 1 (bb1) LC genes previously described in mouse anti–peptide-DWEYSVWLSN/dsDNA cross-reactive autoantibodies associated with lupus and neurologic symptoms (49, 50). Five Abs used the Vk 21E subgroup (21.12) LC gene, and two used the Vk 1 (bb1) LC gene (Table I). Tgderived mAbs encoded by the 21.12 LC gene (66-1.23, 66-2.5, 662.11, 66-4.8, and 66-4.12) had .95% homology with mouse mAbs (16-9, 19-43, and 37g) that reacted with the DWEYS peptide [associated with neuropsychiatric lupus (50)] and with multiple autoantigens, including dsDNA, cardiolipin, and fibronectin. VL LCs pairing with our Tg VH24.3.1 have often been repeated in other reported autoantibody specificities, especially systemic lupus erythematosus (49). To summarize, our chimeric Tg24.3.1-IgG1a Ab was expressed in B cells and sera of Tg mice. We expected that our Ab would originate from the sera and penetrate the brain. Therefore, we conducted experiments to determine whether the Tg24.3.1-IgG1a Ab could target brain tissues. The studies described below show

FIGURE 3. Chimeric IgG1a Tg Ab expressed in 24.3.1 Tg mouse sera and Tg-derived mAbs react with streptococcal and neuronal Ags. Double (VH+VL) Tg mouse sera (A) and single (VH) Tg sera (B) tested against a panel of Ags by ELISA using anti-mouse IgG1a retained cross-reactive Ab specificities to tubulin, lysoganglioside, and streptococcal Ags. (C) Ag panel reactivity of 24.3.1 Tg mAbs (IgG1a) in ELISA. mAbs produced from Tg mouse splenic B cells retained cross-reactive specificities to tubulin, lysoganglioside, and streptococcal Ags. The p value was obtained by the Tukey test using one-way ANOVA. ns, Not significant.

that Tg24.3.1-IgG1a could be detected in serum, expressed by B cells, and deposited in brain. Therefore, the Tg24.3.1-IgG1a Ab expressed in B cells and released from plasma cells in serum penetrated the brain and was taken up by neuronal cells in vivo. In vivo chimeric Tg Ab localized in dopaminergic neurons in basal ganglia of Tg VH24.3.1 mice To determine where chimeric Tg 24.3.1-IgG1a Ab (IgG1a) was localized in the brain in vivo, we investigated tissue sections of brains from Tg VH24.3.1 mice. Anti-IgG1a allotypic Ab detected Tg24.3.1-IgG1a within neuronal cell bodies in the basal ganglia,


Chimeric IgG1a Ab expressed in Tg mice demonstrated cross-reactive anti-streptococcal/anti-brain Ab specificities in Tg sera and Tg mAbs similar to human mAb 24.3.1

5530


Table I. VL gene usage in Tg mAbs derived from 24.3.1 VH Tg mouse Hybridoma

66-1.9 66-1.23 66-1.24 66-2.5 66-2.11 66-4.8 66-4.12

Vk

1 (bb1) 21.12b 1 (bb1) 21.12b 21.12b 21.12b 21.12b

Jk

2 2 2 2 2 2 4

(86%)a (98%) (92%) (97%) (94%) (95%) (91%)

Hybridoma cell lines are listed with the most closely homologous reported germline variable and joining segments. a Percentage homology to germline sequence is noted in parentheses. Sequencing was performed on at least three replications and with different primer combinations. b Vk21E subgroup.

FIGURE 4. Chimeric Tg24.3.1 VH IgG1a Ab–targeted dopaminergic neurons in Tg mouse brain in vivo. Colocalization of Tg 24.3.1 IgG1a (anti-IgG1a Ab, green) and TH (anti-TH Ab, red) by immunofluorescent staining of mouse brain tissue. TH is a marker for dopaminergic neurons. (A–I) For each row, left panel shows IgG1a (FITC labeled), center panel shows TH Ab (TRITC labeled), and right panel is merged image (FITC-TRITC). Brain sections (basal ganglia) of Tg mouse (original magnification 320), showing FITClabeled anti-mouse IgG1a (A), TRITC-labeled TH Ab (B), and merged image (C). (D–F) Enlarged images of (A–C). Brain sections (basal ganglia) of non-Tg littermate tested with anti-mouse IgG1a (G), anti-TH Ab (H), and both (merged image; I). Conjugated secondary Ab controls (secondary Ab, no primary Ab): FITCconjugated streptavidin (1:20; J) and TRITC-conjugated sheep anti-rabbit Ab (1:100; K). (L) Tg mouse brain stained with DAPI. Rectangle denotes basal ganglia region of colocalization of images shown in (A–I) (original magnification 34). Cortex tissue section of Tg mouse brain: DAPI staining (original magnification 310) of cortex tissue section (M). (N) 24.3.1 IgG1a-positive (FITC-labeled) cells shown in rectangle in (M). (O) Enlarged image of cortex tissue section. Hippocampus tissue section of Tg mouse brain: DAPI staining (original magnification 310) of hippocampus tissue section (P). (Q) No staining for 24.3.1 IgG1a observed in the hippocampus. (R) Enlarged image of hippocampus.


most likely the substantia nigra or ventral tegmental area (Fig. 4A). Ab to TH was used to identify dopaminergic neurons of Tg mouse brain (Fig. 4B) because TH converts tyrosine to dopamine and is a marker for dopaminergic neurons (51, 52). Chimeric Tg24.3.1-IgG1a Ab colocalized in TH-rich dopaminergic neurons in vivo (Fig. 4A–C). Fig. 4A–F show Tg 24.3.1-IgG1a Ab within dopaminergic neurons in brains of Tg VH24.3.1 mice; enlarged images are also shown (Fig. 4D–F). Similar results were observed in five of seven Tg VH24.3.1 mice, whereas no IgG1a was detected in brains of non-Tg mice (Fig. 4G). Fig. 4H shows TH Ab staining in non-Tg brain, and Fig. 4I shows the merged image for Fig. 4G and Fig. 4H. Secondary Ab controls were negative in all experiments

(Fig. 4J, 4K). In Fig. 4L, DAPI-stained brain denotes the basal ganglia region where colocalized fluorescence (Fig. 4A–F) was observed. IgG1a-positive neuronal cells were also observed in the cortex of Tg mouse brain and did not stain with anti-TH Ab (Fig. 4N, 4O). Therefore, our data suggest that our Tg autoantibody localized in vivo in both dopaminergic and nondopaminergic neurons in the basal ganglia within the substantia nigra/ventral tegmental area and cortex, respectively. The presence of D2R on other types of neurons could explain our results (53–55). DAPIstained brain (Fig. 4M) indicates the region where IgG1a–FITC staining in the cortex was observed. No IgG1a staining was seen in the hippocampus (Fig. 4Q, 4R). Fig. 4P shows DAPI staining of hippocampus. Our Tg24.3.1-IgG1a Ab colocalized in dopaminergic neurons in the substantia nigra or ventral tegmental area, which are part of the basal ganglia. Dopaminergic neurons originating in the substantia nigra/ventral tegmental area and terminating in the dorsal striatum play a critical role in basal ganglia functions (56–59). The substantia nigra and the adjacent ventral tegmental area, both intrinsic nuclei of the basal ganglia, contain dopaminergic neurons that project into the striatum. Nigrostriatal axon terminals release dopamine into the striatum. D2Rs are expressed on the dopaminergic neurons in the substantia nigra and ventral tegmental area, as well as on neurons in the striatum (55, 58, 60, 61). However, dopaminergic neuronal cell bodies are only seen in the substantia nigra and ventral tegmental area, and the axons of these cells project into the striatum. All dopamine receptor subtypes are expressed in


5531


FIGURE 5. Tg24.3.1-IgG1a and human SC mAb 24.3.1 reacted and colocalized with D2R. (A) Reactivity of 24.3.1 Tg mAbs and Tg mouse serum (IgG1a) with human D2R in the ELISA using anti-mouse IgG1a. Tg mAbs reacted similarly to human mAb 24.3.1 with D2R. Other human chorea-derived mAbs 37.2.1 and 31.1.1 reacted less with D2R than mAb 24.3.1. The p value was obtained by the Tukey test using one-way ANOVA. (B) Chimeric Tg24.3.1 VH IgG1a Ab colocalized with anti-D2R in Tg mouse brain in vivo. Colocalization of Tg 24.3.1 IgG1a (anti-IgG1a Ab) and rabbit polyclonal antiD2R Ab by immunofluorescent staining of mouse brain tissue. Top row, Brain sections of Tg mouse, showing FITC-labeled anti-mouse IgG1a (left panel), TRITC-labeled anti-D2R Ab (center panel), and merged image (right panel) (original magnification 320). Middle row, Enlarged images from top row. Bottom row, Secondary Ab controls: FITC-conjugated streptavidin (1:20; left panel) and TRITC-conjugated sheep anti-rabbit Ab (1:100; right panel) were negative. (C) Human SC-derived mAb 24.3.1 (IgM) colocalized with anti-D2R in normal mouse brain tissue sections. (Figure legend continues)

5532


Tg serum Ab and IgG1a Tg-derived mAbs reacted with human D2R To investigate the possibility that the Tg-derived Abs, as well as the chorea-derived human mAb 24.3.1, might bind to human D2R, a receptor present on dopaminergic neurons (54, 55), human mAb 24.3.1, Tg sera, and Tg-derived mAbs were tested for reactivity with human D2R. Single- and double-Tg mouse serum and Tg hybridoma mAbs (IgG1a) exhibited strong reactivity (OD . 2.0) with human D2R (Fig. 5A). All 13 Tg-derived mAbs exhibited reactivity with D2R; three of those tested are shown in Fig. 5A. Strong reactivity with D2R was seen for chorea-derived human mAb 24.3.1, from which the VH and VL genes were derived and expressed in the Tg mice (Fig. 5A). Tg sera, as well as Tg-derived mAbs, reacted with D2R similar to mAb 24.3.1. Reactivity of chorea-derived mAbs 37.2.1 and 31.1.1 with D2R was considerably lower than seen with mAb 24.3.1. To determine whether our chimeric Tg24.3.1-IgG1a Ab colocalized with D2R, we treated the Tg brain sections with rabbit polyclonal anti-D2R Ab and anti-IgG1a Ab to detect the Tg24.3.1 Ab. As shown in Fig. 5B, chimeric Tg24.3.1–IgG1a Ab colocalized with anti-D2R (merged images shown in right panels) in Tg mouse brain. Secondary Ab controls were negative. To compare binding of Tg24.3.1-IgG1a Ab after expression in Tg mice with direct binding of human mAb 24.3.1 to brain tissues, normal mouse brain tissue sections were reacted with SC-derived human mAb 24.3.1 and rabbit polyclonal Ab to D2R. As shown in Fig. 5C, human mAb 24.3.1 colocalized with anti-D2R similar to Tg 24.3.1-IgG1a Ab (merged images, right panels). Media controls and secondary Ab controls were negative. Chorea-derived mAb 24.3.1 strongly reacted with FLAG epitope-tagged D2R transfectants on the cell surface and D2R extracellular peptide sequence To further confirm dopamine receptor binding of our human chorea-derived mAb 24.3.1, we examined the binding of the Ab to HEK293T cells transiently expressing a D2R construct that contained a FLAG epitope tag at the extracellular N terminus (62, 63).

Transient expression of FLAG-tagged D2R is evidenced by the enhanced binding of the anti-FLAG Ab specifically to the cells transiently transfected with cDNA for the D2R construct (Fig. 6A). Enhanced binding of human chorea-derived mAb 24.3.1 to cells transiently expressing the D2R construct is observed relative to untransfected cells that do not express D2R. Chorea-derived mAbs 31.1.1 and 37.2.1 exhibited significantly enhanced binding to the FLAG-tagged D2R–expressing cells but were less reactive compared with mAb 24.3.1 (Fig. 6B). Thus, all three SC mAbs bind significantly to D2R (Fig. 6B). To determine whether IgG in SC and PANDAS sera reacted with extracellular D2R surface exposed with a FLAG tag, human sera from SC and PANDAS patients and normal control sera were tested in the FLAG assay. We found that all SC sera tested reacted consistently with extracellular D2R in the FLAG epitope-tagged transfected cell line, whereas all PANDAS sera were negative (Fig. 6C). Our data correlate well with other studies that found SC IgG positive and PANDAS IgG negative by FACS analysis of HEK293 cell lines expressing D2R (64). Table II compares results from the FLAG-tagged D2R assay with other D2R assays, including ELISA and signaling through D2R in the cAMP assay (cAMP results described below indicate that both SC and PANDAS sera signal through D2R, whereas only the SC IgG binds to the FLAG-tagged D2R). To investigate the reactivity of human SC mAb 24.3.1 with D2R, mAb 24.3.1 was reacted in ELISA with several peptides that we synthesized from the D2R extracellular region; the most reactive peptide was chosen for a competitive-inhibition ELISA. Chorea mAbs 24.3.1, 31.1.1, and 37.2.1 all reacted most strongly with D2R peptide E1.1 (OD 1.0) and were tested further to determine whether binding to whole D2R could be inhibited in vitro by blocking with D2R E1.1 in competitive-inhibition ELISA. D2R peptide E1.1 was a strong inhibitor of SC mAb 24.3.1, 31.1.1, and 37.2.1 binding to D2R and inhibited D2R recognition by chorea mAbs in a dosedependent manner (Fig. 6D, right panel, Fig. 6E). A commercial anti-human D2R mAb, specific for the region included in the D2R E1.1 peptide (mAb 1B11; Sigma), was compared with mAb 24.3.1 in the competitive-inhibition ELISA (Fig. 6D, left panel). A previously characterized peptide from human cardiac myosin (45, 46) did not strongly inhibit binding of either anti-D2R mAb 1B11 or chorea mAb 24.3.1 to whole D2R in ELISA (Fig. 6D, control peptide). In Fig. 6D, the y-axis scale is different for the two Abs shown; the condition “no peptide” shows an OD of 2 with the commercial D2R E1.1 Ab and an OD ∼1 with the SC mAb 24.3.1. Fig. 6D shows that the two Abs differ significantly in the inhibition curves. A higher concentration of inhibitor peptide D2R E1.1 (∼62 mg/ml) was required to reach ∼50% inhibition of crossreactive SC mAb 24.3.1, whereas ,1 mg/ml peptide produced ∼50% blocking of the commercial positive-control D2R E1.1 peptide Ab. Neither Ab was significantly inhibited with 500 mg/ml of a “control peptide”: 25% inhibition was seen for the SC mAb 24.3.1, and 12% inhibition was observed for the commercial positive-control anti-D2R E1.1 peptide Ab. Inhibition of both mAbs was significantly greater with the D2R E1.1 peptide (Fig. 6D). In addition, extracellular D2R peptide E1.2 did not exhibit strong inhibition, and it behaved similarly when reacted with the commercial anti-D2R Ab and SC mAb 24.3.1 (Fig. 6D). Two

Colocalization of human SC mAb 24.3.1 (anti-human IgM Ab) and rabbit polyclonal anti-D2R Ab in normal mouse brain tissue sections. Top row, Brain tissue sections of normal mouse (original magnification 310), incubated in vitro with human SC mAb 24.3.1, showing FITC-labeled anti-human IgM (left panel), TRITC-labeled rabbit polyclonal D2R Ab (center panel), and merged image (right panel). Second row, Enlarged images from top row. Media controls (IMDM supplemented with 10% FBS) and secondary Ab controls (FITC-conjugated anti-human IgM, 1:50; TRITC-conjugated sheep anti-rabbit Ab, 1:100) were negative. The concentration of mAbs tested (24.3.1, 37.2.1, 31.1.1) was 100 ng/ml. ns, Not significant.


the striatum, but D1Rs and D2Rs are most abundant (58). D2Rs are also expressed by striatal interneurons (54). D2Rs have presynaptic and postsynaptic localizations and functions (54, 55, 61). The basal ganglia location of the Tg24.3.1-IgG1a–targeted dopaminergic TH+ neurons was determined based on the presence of TH as a marker for dopaminergic neurons in the substantia nigra/ventral tegmental area of the basal ganglia. Dopaminergic (TH+) neuronal cell bodies are absent from the striatum. Additional colocalization studies were performed on normal mouse brain tissue to determine whether SC-derived human mAb 24.3.1 (IgM) reacted with dopaminergic neurons. As shown in Supplemental Fig. 1, mAb 24.3.1 binds to TH-rich dopaminergic neurons as expected, because dopaminergic neurons were targeted in the Tg mice (Fig. 4). The right panels in Supplemental Fig. 1 are merged images. Human mAbs 37.2.1 and 31.1.1 were observed to bind dopaminergic neurons (Supplemental Fig. 1). Media controls and secondary Ab controls were negative in all experiments. Thus, both the chorea-derived mAb 24.3.1 and the Tg expressed 24.3.1 Ab bind to dopaminergic neurons (Fig. 4, Supplemental Fig. 1).


5533


FIGURE 6. Human SC mAb 24.3.1 reacted with FLAG epitope-tagged D2R at the cell surface and with a D2R peptide. (A) Quantification of the relative levels of cell surface binding of anti-FLAG M2 Ab to HEK293T cells transfected with cDNA for the FLAG-tagged D2R construct or HEK293T cells transfected with an empty vector (untransfected cells). White bars represent HEK293T cells treated with control media (no Ab), and black bars represent HEK293T cells treated with anti-FLAG M2 Ab (mean 6 SD, n = 5). (B) Quantification of the relative levels of cell surface binding of human choreaderived SC mAbs to HEK293T cells transfected with cDNA for the FLAG-tagged D2R construct (black bars) or with empty vector (untransfected cells, white bars) (mean 6 SD, n = 5). All of the chorea-derived SC mAbs showed significant binding to D2R transfectants compared with cells transfected with empty vector. (C) Human SC sera reacted with FLAG epitope-tagged D2R at the cell surface. Quantification of the relative levels of cell surface binding of human PANDAS sera (P), SC sera (SC), and sera from normal healthy controls (N) to HEK293T cells transfected with cDNA for the FLAG-tagged D2R construct (black bars) or with empty vector (untransfected cells, gray bars) (mean 6 SD, n = 4). Four SC sera tested (SC1–4) (Figure legend continues)

5534

BRAIN AUTOANTIBODY TARGETS DOPAMINERGIC NEURONS Table II. Summary of immunoreactivity of human SC and PANDAS sera Human Sera ID No.

D2R ELISA IgG Titer

8,000

SC2

16,000

SC3

16,000

SC4

32,000

SC5

16,000

SC6 (mAb donor)

32,000

SC7

16,000

SC8

16,000

PANDAS P1

5,120

P2

8,000

P3

8,000

P4

128,000

P5

8,000

P6

16,000

P7

32,000

Normals N1 N2 N3 N4 N5 N6 N7

16,000 2,000 8,000 2,000 16,000 2,000 4,000

other SC mAbs, 31.1.1 and 37.2.1, produced from the same individual, also showed similar peptide reactivity and inhibition patterns (Fig. 6E). D2R peptide E1.2 did not show significant inhibition compared with E1.1. There was a significant difference between the inhibition observed for peptide E1.1 versus E1.2 (mAb 24.3.1 and mAb 31.1.1, p , 0.001; mAb 37.2.1, p , 0.01) (Fig. 6D, 6E). Tg mAbs also reacted with D2R peptides in the direct ELISA and showed stronger specificity to D2R E1.1 peptide compared with D2R E1.2 peptide (Fig. 6F). Although all three SC mAbs reacted similarly with the D2R peptide, they differed with regard to their signaling and binding properties of D2R and did not react with D2R with the same intensity in the ELISA.

D2 FLAG

Positive (p , 0.001) Positive (p , 0.001) Positive (p , 0.001) Positive (p , 0.0001) Positive (p , 0.001) Positive (p , 0.0001) Positive (p , 0.0001) Positive (p , 0.001)

Positive (p , 0.001) Positive (p , 0.05) Positive (p , 0.05) Positive (p , 0.001) Not tested

Positive (p , 0.01) Positive (p , 0.001) positive (p , 0.001) positive (p , 0.0001) Positive (p , 0.001) Positive (p , 0.001) Positive (p , 0.001)

Negative

Negative Negative Negative Negative Negative Negative Negative

Not tested Not tested Not tested

Negative Negative Negative Not tested Not tested Not tested Negative Negative Negative Negative Not tested Not tested Not tested

IgG in SC and PANDAS with fine choreiform movements reacted with D2R To determine whether autoantibodies against D2R were elevated in sera from humans with SC and related disorders, we used ELISA to investigate a small group of well-characterized human sera from SC, PANDAS, TS, and OCD. Our PANDAS (22) group represents children who had acute-onset OCD and/or tics, as well as fine choreiform piano-playing movements (fingers and toes), following a streptococcal infection, which may indicate a type of PANDAS. Human sera were titrated in the ELISA against the D2R membrane Ag. As shown in Fig. 7A, IgG reactivity with D2R was significantly elevated in SC and in a PANDAS group with fine

showed significant (p , 0.001 or p , 0.05) binding to D2R transfectants compared with cells transfected with empty vector. Four PANDAS sera tested (P1– 4) were negative and did not show significant binding. Normal control sera tested were negative. *, **, ***, #, and ## in (A)–(C) denote p values shown below the graphs. (D) D2R peptide E1.1 significantly inhibited binding of human SC mAb 24.3.1 to D2R in a dose-dependent manner. Left panel, Dosedependent inhibition of anti-D2R mAb 1B11 binding to D2R by extracellular D2R peptide E1.1 (p , 0.001). Right panel, Significant (p , 0.001) inhibition of chorea-derived mAb 24.3.1 binding to D2R by D2R peptide E1.1. Control peptide and extracellular D2R peptide E1.2 did not strongly inhibit binding and behaved similarly when reacted with the commercial mouse anti-D2R mAb and our chorea-derived human mAb 24.3.1. p , 0.001, D2R E1.1 versus E1.2. Media control (negative) not shown. (E) Dose-response inhibition of two other human SC mAbs 31.1.1 and 37.2.1 by D2R peptide E1.1. Dosedependent binding inhibition of human SC mAbs 31.1.1 and 37.2.1 to D2R by extracellular D2R peptide E1.1 (p , 0.001). D2R peptide E1.2 did not show significant inhibition compared with E1.1 (mAb 31.1.1, p , 0.001; mAb 37.2.1, p , 0.01). D2R peptide E1.2 did not strongly inhibit. Extracellular D2R peptide E1.2 did not strongly inhibit. Media control (negative) not shown. mAb concentration used was 100 ng/ml. (F) SC Tg VH24.3.1 mAbs reacted with D2R peptides in the ELISA. Tg mAbs expressing human mAb 24.3.1 HC (VH) were tested in the direct ELISA for reactivity with D2R peptides E1.1 and E1.2. Tg mAbs showed specificity for peptide D2R E1.1. Media control (negative) not shown. p , 0.001, D2R E1.1 versus D2R E1.2.


SC SC1

cAMP


5535

choreiform movements but not in TS, OCD, ADHD, or normal age-matched subjects. The dot plot shows normal controls with an anti-D2R mean titer of 6,000, whereas the mean titer in SC was 17,600 (∼3-fold increase). In PANDAS, the mean titer was 13,449 (.2-fold the normal mean). Our ELISA data suggest that autoantibodies against D2R were associated more significantly with movement disorders, such as SC or PANDAS with fine choreiform movements, and not with TS, OCD, or ADHD. Fig. 7B shows IgG reactivity of SC and PANDAS IgG with D2R compared with dopamine D1 receptor (D1R). When anti-D2R was compared with anti-D1R in SC and PANDAS, the p values were significantly different (p = 0.001 and p , 0.0001, respectively; Fig. 7B). Fig.

7C used the same data as shown in Fig. 7B, but it shows OD values at 1:500 serum dilution rather than titers for comparison. Chorea-derived human mAb 24.3.1 signaled human D2R and inhibited adenylate cyclase activity in D2R transfectants To study Ab activation of the D2 inhibitory receptor, D2R-expressing transfectants were reacted with human mAbs, and changes in adenylate cyclase were measured as cAMP levels in cell lysates. Chorea-derived human mAb 24.3.1, which reacted with the human D2R membrane Ag in the ELISA, signaled D2R and inhibited cAMP in the D2R-expressing transfectants, comparable to activation of D2R by dopamine. Fig. 8A shows D2R transfectants after


FIGURE 7. IgG in SC and PANDAS reacted with D2R. (A) IgG from SC and PANDAS sera reacted with human D2R. Human sera from SC, PANDAS, TS/OCD, and ADHD were titrated for reactivity with human D2R. A strong reaction of SC (p = 0.0005) and PANDAS (p = 0.0291) sera was observed with D2R in the ELISA. (B and C) IgG from SC and PANDAS reacted with D2R compared with the different response against D1R. Reactivity of human sera from SC, PANDAS, TS/OCD, and ADHD with dopamine receptors D1R and D2R in the ELISA. Ab titers are shown in (B) and OD values are shown in (C) for comparison of titers versus OD at 405 nm (1:500 dilution). Horizontal line indicates mean. The p values were obtained using the Mann–Whitney and Kruskal–Wallis tests.

5536


treatment with dopamine and human chorea-derived mAbs 24.3.1, 31.1.1, and 37.2.1. Transfectants treated with 1 mM dopamine as a positive control showed 53% inhibition of cAMP compared with untreated transfectants, which is consistent with results of previous studies that showed ∼50% inhibition (47). Human choreaderived mAb 24.3.1–treated D2R-transfected cells showed a reduction in cAMP that was comparable to that of dopamine stimulation. Although D2R transfectants incubated with chorea-derived mAb 31.1.1 also showed a small reduction in cAMP (∼18%), it was significantly less than with mAb 24.3.1, and chorea-derived mAb


FIGURE 8. Human mAb 24.3.1 signaled human D2R in transfected D2R cells by inhibiting adenylate cyclase activity comparable to dopamine. Inhibition of adenylate cyclase by receptor activation in human D2R-transfected cell lines (A9-hD2R) was quantified by cAMP levels measured in cell lysates. Incubation of the D2R cell line with chorea-derived mAbs 24.3.1, 31.1.1, and 37.2.1. Results are shown from cAMP direct-competition immunoassay. (A) D2R-transfected cells treated with mAb 24.3.1 showed a 53% decrease in cAMP, which was comparable to dopamine-treated cells (p , 0.001). Cells treated with pertussis toxin are also shown; this treatment was used as an experimental control, because D2R-mediated activation and inhibitory signaling with concomitant decreases in cAMP can be blocked by preincubation of cells with pertussis toxin. (B) Unresponsive control (nontransfected) A9 cells treated with dopamine and mAbs. (C) Dose-response curve showed cAMP levels in D2R-transfected cells following treatment with mAb 24.3.1 at 1, 5, 10, 25, and 50 ng and unresponsive control (nontransfected) A9 cells after same treatment. Assays were performed in triplicate. The p value was obtained by the Tukey test using one-way ANOVA. The following concentrations of mAbs were tested: 24.3.1, 90 ng/ml; 31.1.1, 100 ng/ml; and 37.2.1, 100 ng/ml. ns, not significant.

37.2.1 did not activate D2R (0% for mAb 37.2.1) because cAMP was not significantly reduced. As expected, a receptor-mediated decrease in cAMP levels was not inhibited in cells preincubated with pertussis toxin. D2Rs are coupled to G proteins of the Gi/o subfamily, which are pertussin toxin sensitive; consequently, pertussin toxin treatment blocked D2R-mediated decreases in cAMP (47, 65). Control nontransfected A9 cells showed no significant differences in cAMP levels in untreated and treated cells (Fig. 8B). Thus, human chorea-derived mAb 24.3.1 showed a significant activation of D2R compared with the same isotype and


5537

concentrations of other chorea-derived mAbs. Fig. 8C shows a dose-response curve of D2R transfectants treated with 1, 5, 10, 25, or 50 ng of mAb 24.3.1, whereas nontransfected A9 cells were unresponsive after the same treatment. The data show that mAb 24.3.1 inhibitory signaling through D2R is dose dependent. mAbs derived from Tg24.3.1-IgG1a mice were tested for D2R signaling, but no reduction in cAMP was seen (data not shown). Lack of D2R signaling by Tg mAbs may be due to mouse LC pairing with our human/mouse Tg VH 24.3.1–IgG1a, which may affect the epitope recognition or avidity required for signaling. Because Tg 24.3.1-IgG1a Ab localized in dopaminergic neurons in vivo, and human mAbs and Tg mAbs all recognized D2R, the data strongly suggest that D2R on neurons may be one of the Ab targets in vivo, as was shown in our colocalization studies on Tg mouse brain tissue (Fig. 5B).

In support of the hypothesis that SC mAb 24.3.1 and Tg 24.3.1IgG1a Ab came from chorea donor sera with D2R signaling, acute serum from the mAb 24.3.1 human B cell donor was shown to have an elevated serum anti-D2R IgG titer of 32,000 by ELISA, which is ∼5-fold greater than the normal mean (6,000), and the acute serum showed strong signaling inhibition of D2R comparable to dopamine (Fig. 9A). Assay results, shown in Fig. 9A, illustrate the inhibition as a decrease in cAMP levels in transfected cell lysates of human D2R transfectants by the mAb 24.3.1 donor serum but not in control A9 cells (Fig. 9B). Results are shown after treatment with dopamine, anti-D2R serum, normal serum, and mAb 24.3.1. As shown in Fig. 9A, transfectants treated with mAb donor sera (SC6) showed significantly decreased cAMP levels (40% decrease) relative to untreated cells, and this was comparable to the inhibitory response of mAb-treated transfected cells (43%). Transfectants treated with another SC sera (SC7), with a serum anti-D2R IgG titer of 16,000, also showed a similar decreased (∼40%) cAMP level. Additionally, cAMP levels were significantly decreased (p , 0.001) in transfectants treated with five other SC sera with anti-D2R titers of 8,000 or 16,000. Dopamine-treated D2R transfectants showed a 48% reduction in cAMP levels, whereas levels in transfected cells treated with normal serum (anti-D2R titers of 2,000, 8,000, or 16,000) were not significantly inhibited (Fig. 9A). Control nontransfected A9 cells (Fig. 9B) showed no significant differences in cAMP levels between treated and untreated cells. Our results suggest that the high level of anti-D2R Abs detected in ELISA (32,000) in the human SC mAb 24.3.1 donor sera and other human SC sera signaled the human D2R, with a concomitant reduction in adenylate cyclase (cAMP) activity. Normal sera with an anti-D2R titer of 2,000, 8,000, or 16,000 did not signal D2R. Our results illustrate how the human chorea donor sera elicited the same inhibitory signaling response as did mAb 24.3.1 in D2R-transfected cells, whereas normal sera with comparable anti-D2R ELISA titers did not. Inhibitory signaling of adenylate cyclase activity in D2R transfectants by human PANDAS sera Using the D2R-transfected cell line, human PANDAS sera with elevated anti-D2R Ab ELISA titers (P7: 32,000, P6: 16,000, P2: 8,000) were examined for signaling of D2R and adenylate cyclase, as measured by decreased cAMP. Fig. 10 shows inhibitory signal in cAMP levels in transfected cell lysates of D2R transfectants (Fig. 10A) but not in control (nontransfected) A9 cells (Fig. 10B). Importantly, the cAMP response of D2R transfectants to PANDAS sera P7 (32,000 D2R titer) was comparable to their response to


Inhibitory signaling of adenylate cyclase activity in D2R transfectants by human SC sera

FIGURE 9. D2R transfectants treated with human SC sera with elevated anti-D2R Ab show decreased cAMP levels. Inhibition of adenylate cyclase by receptor stimulation in human D2R-transfected cell lines (A9-hD2R) was quantified by cAMP levels measured in cell lysates. Incubation with human SC mAb 24.3.1 Ab donor serum, other SC sera, and normal healthy control sera. Results are shown from cAMP direct-competition immunoassay. (A) D2R-transfected cells treated with SC Ab donor serum (SC6; anti-D2R titer 32,000) and SC serum 7 (SC7; anti-D2R titer 16,000) showed a 40% decrease in cAMP levels comparable to dopamine (48%)and mAb 24.3.1–treated cells (43% decrease); p , 0.0001. cAMP levels were also significantly decreased (p , 0.001) in transfectants treated with five other SC sera (SC1, SC2, SC3, SC5, SC8) with anti-D2R titers of 8,000 and 16,000. cAMP level was not reduced significantly in transfectants treated with normal serum (anti-D2R titers 2,000, 8,000, or 16,000). (B) Control (nontransfected) A9 cells were unresponsive. Assays were performed in triplicate. The p values were obtained by the Tukey test using one-way ANOVA. Concentration of mAb used was 24.3.1–90 ng/ml. ns, Not significant.

5538

BRAIN AUTOANTIBODY TARGETS DOPAMINERGIC NEURONS difference in cAMP levels. Our results suggest that sera from SC, as well as from other streptococcal-associated neuropsychiatric sequelae, such as PANDAS with fine piano playing choreiform movements, signal the human D2R.

Discussion

dopamine (44%), as well as chorea-derived mAb 24.3.1 (48%) (Fig. 10A). cAMP was not inhibited or decreased in the D2Rtransfected cells treated with normal sera of various anti-D2R ELISA titers (Normal N2: 2000; Normal N7: 4000; Normal N3: 8000). Nontransfected A9 cells (Fig. 10B) showed no significant


FIGURE 10. D2R-transfected cells treated with PANDAS sera showed decreased cAMP levels compared with transfectants treated with normal control sera. (A) D2R-transfected cells were treated with PANDAS sera and sera from normal controls. PANDAS sera with elevated human antiD2R Ab ELISA titers were assayed for inhibitory signaling [anti-D2R titers: P7: 32,000; P6: 16,000; P2: 8,000] and showed significantly decreased cAMP levels (46%, 39%, 23%) comparable to decreased cAMP levels in response to the neurotransmitter dopamine (44%) and chorea mAb 24.3.1 (48%) treatments. D2R transfectants treated with normal sera of various ELISA anti-D2R titers (N2: 2000, N7: 4000, N3: 8000) did not show significant reductions in cAMP. (B) Control (nontransfected) A9 cells were unresponsive. Assays were performed in triplicate. The p value was obtained by Tukey test using one-way ANOVA. Concentration of mAb 24.3.1 used was ∼90 ng/ml. PANDAS sera and normal controls: n = 7 (three of each are shown in the figure). ns, Not significant.

Little is known about the targets of autoantibodies in the brain in movement or behavioral disorders, and the effects of autoantibody targeting dopaminergic neurons or their dopamine receptors is virtually unknown. Studies suggest that anti-streptococcal Abs target the brain in human disease or their animal models and may lead to altered behaviors or movements (10, 13, 15, 16, 35, 64, 66– 68). Two recent studies (35, 64) suggested that Abs in SC recognize the D2R in humans, and studies (35, 66, 67) in rats and mice linked behavioral changes with streptococcal exposure and D2R. Our studies and those of other investigators used different methodologies to detect autoantibodies against D2R (64). Table II summarizes our human sera studies in three immunoassays, as shown in Figs. 6, 7, 9, and 10. The SC-derived human mAb studies are found in Figs. 5–8 and Supplemental Fig. 1, and the Tg Ab studies are found in Figs. 2–6. Collectively, the studies suggest that D2R is the target of autoantibodies produced in SC and PANDAS. Abs against D2R measured by ELISA recognize both extracellular and intracellular epitopes, whereas functional Ab signaling or extracellular binding assays would recognize only extracellular domains of the receptor. Our peptide, which inhibited mAb 24.3.1, was an extracellular epitope at the exposed N terminus of D2R. To test the hypothesis that autoantibodies from movement and behavioral disorders target neurons and possibly D2R in the brain, we developed a novel Tg mouse expressing an SC-derived brain autoantibody. The Tg autoantibodies exhibited cross-reactive antineuronal specificities, in particular D2R reactivity, and targeted dopaminergic neurons in vivo. We show in our study that a human SC-derived Ab, with defined specificity and with a defined VHregion gene linked to a mouse IgG1a C-region gene, targeted neurons in the Tg mouse brain that was most likely the substantia nigra/ventral tegmental area of the basal ganglia. Only the substantia nigra and ventral tegmental area contain dopaminergic neuronal cell bodies that project long axonal extensions into the striatum. Dopaminergic neuronal cell bodies are not observed in the striatum. The Tg24.3.1-IgG1a construct was found within the cytoplasm of dopaminergic neurons in vivo, sparing the nucleus. Tg serum Ab, as well as mAbs produced from Tg VH24.3.1 B cells, retained cross-reactive Ab specificities to tubulin, lysoganglioside, and streptococcal Ags, even when the human VL was replaced with a mouse VL chain. During these studies, a new functional reactivity of human mAb 24.3.1 was found that signaled D2R and that may be the consequence of Tg24.3.1 IgG1a targeting dopaminergic or other types of neurons expressing D2R. Tg serum Ab and IgG1a hybridoma mAbs demonstrated the same strong reactivity with D2R as did human SC-derived mAb 24.3.1. Our data support the hypothesis that, in human disease, Abs against D2R in SC or PANDAS with fine choreiform movements may target dopaminergic neurons in the basal ganglia and cortex and alter brain function to contribute to movement and behavioral disorders. Fine choreiform movements were reported in 95% of the first 50 cases of PANDAS (22). We have suspected for some time that mAb 24.3.1 signaled a functional receptor on the surface of neuronal cells. Our current results from our Tg mouse studies reveal that chimeric Tg24.3.1 Ab deposited in neurons in Tg brain tissues and colocalized with D2R. Our new data link the signaling of D2R with autoantibodies in SC and other diseases for which treatment with D2R blocker


protein–mediated signaling (53). D1Rs typically stimulate an increase in cAMP, whereas, in contrast, D2 is inhibitory, with a decrease in cAMP, as shown for mAb 24.3.1 and chorea and PANDAS sera. The roles of D2Rs are generally more complex than D1Rs because they are expressed as both pre- and postsynaptic receptors (53). If D2R is an in vivo Ag, we would expect TH+ neurons, as well as postsynaptic TH2 negative neurons expressing D2R in the cortex, to be targeted by Tg24.3.1-IgG1a Ab. Future studies will be required to determine whether postsynaptic or other types of neurons are involved in the reaction with and uptake of mAb 24.3.1. Although D2R was the focus of our current study, it is quite possible that other neuronal cell surface extracellular Ags and receptors may be involved in the signaling of neuronal cells by Abs in chorea, PANDAS, and other related movement and neuropsychiatric conditions. In this study, we did not establish a Tg mouse line or test behavior in mice expressing Tg 24.3.1-IgG1a. The continual loss of viable litters from the Tg 24.3.1 mothers could have been due to the presence of Tg24.3.1-IgG1a in serum of mothers where Ab may have affected development of the neonatal mice. Evidence suggests that maternal autoantibodies may affect development of the brain (81). Our previous work demonstrated cross-reactivity of human mAb 24.3.1 with lysoganglioside GM1 (10) and tubulin (11). Lysoganglioside is associated with lipid rafts in the membrane, whereas tubulin is intracellular and is the most abundant protein in the brain. Tubulin was reported to be associated with postsynaptic density (82). Our previous studies also showed that human mAb 24.3.1 activates CaM kinase in a human neuronal SKNSH cell lines (10). CaM kinase activation was reported in association with heterodimers of dopamine receptors containing both D1 and D2 (83). A recent study of SC reports that the ratios of Abs against both D1R and D2R correlated directly with the Universidade Federal de Minas Gerais Sydenham’s Chorea Rating Scale for symptoms of SC (84). In this study, we compared the reactivity of SC and PANDAS sera against D1R and D2R. Although anti-D1R was much less reactive than was anti-D2R IgG, it was significantly elevated in the sera from SC and PANDAS and will be investigated further in future studies. Cross-reactivity of anti-neuronal autoantibodies alone may not lead to disease, as suggested by the results with normal sera and other mAbs, but when the avidity of the Ab causes signaling of a receptor it may be a risk factor in the development of movement or neuropsychiatric symptoms. The similarity in Ag specificity, but differences in signaling, of D2R by the human chorea-derived mAbs 24.3.1, 37.2.1, and 31.1.1 illustrates this principle that crossreactivity by itself may not necessarily lead to signaling of a receptor. Thus, our studies of mAb 24.3.1 in comparison with the two other chorea-derived human mAbs show their differences in signaling, avidity (10), and perhaps recognition of different epitopes in the CaM kinase assay (10), as well as in the D2R-signaling assay (Fig. 8). The molecular basis for the cross-reactivity of mAb 24.3.1 with D2R and two other neuronal Ags may be due, in part, to Abs against the group A streptococcal carbohydrate Ag GlcNAc and its crossreactivity with lysoganglioside (10) and tubulin (11). We know from extensive studies (31) that Abs against a helical or specific peptide sequences containing aromatic and nonpolar residues are cross-reactive with GlcNAc. It is notable that the peptide most strongly recognized (Fig. 6) by mAb 24.3.1 has many nonpolar and aromatic amino acids in sequence. The previous study by Shikhman et al. (31) used alanine substitutions to prove that the presence of these nonpolar and aromatic residues contributed to the cross-reactivity between dissimilar molecules.


drugs are effective (68–72). Our studies published in Brimberg et al. (35) demonstrated reactivity of SC and PANDAS IgG in ELISA, whereas studies by Dale et al. (64) demonstrated antiD2R Ab in SC using cell-based flow cytometry assays. Neither of these studies investigated anti-D2R Ab function/signaling or localization in brain tissues. This study extends these findings to demonstrate the anti-D2R Ab targeting of neurons in basal ganglia and cortex. Previous studies (10, 12, 13) showed that SC and PANDAS IgG, as well as chorea-derived mAb 24.3.1, activated CaM kinase II in a human neuronal cell line, leading to TH activation and subsequent dopamine release. TH is the rate-limiting enzyme in dopamine synthesis and was increased in the brain of Lewis rats after intrathecal infusion of mAb 24.3.1 (12). Dopamine is the main catecholamine neurotransmitter in the CNS and is synthesized from tyrosine via TH and stored in vesicles in axon terminals. Dopaminergic signaling is a balance between dopamine release and reuptake by the presynaptic terminal. The five dopamine receptor types are divided into two families: D1-like (stimulatory) and D2-like (inhibitory), both of which act through G protein– coupled protein receptors (73, 74). Dopamine plays a pivotal role in modulating the functioning of the basal ganglia brain circuitry (56, 59, 73), and abnormalities in the functioning of this neurotransmitter have been implicated in disorders like SC (75). Tg24.3.1-IgG1a mice provided ample evidence to show that human-derived V-gene 24.3.1 retained cross-reactive specificities to streptococcal and neuronal Ags, as expressed in vivo as a chimeric human V-gene/mouse C-region IgG1a Ab molecule. Human chorea-derived mAb 24.3.1 is an IgM (10); however, we developed a chimeric human/mouse Tg24.3.1-IgG1a construct that is more likely than IgM to cross into the brain. In humans with chorea, it is well-established that their cerebrospinal fluid and sera contain IgG anti-neuronal signaling autoantibodies against the Ag specificities reported for our Tg24.3.1-IgG1a construct, as well as our human mAb 24.3.1 (10). Thus, it is noteworthy that human mAb 24.3.1 and Tg mAbs possessed the same neural Ag specificities (Figs. 3, 5) and peptide epitopes (Fig. 6) as did those found for IgG in chorea (Fig. 7). In addition, the signaling properties of sera can be abrogated by removal of IgG (35). Our Tg24.3.1-IgG1a construct was expressed in mouse sera and penetrated the brain targeting dopaminergic neurons (Fig. 4). Our focus was on Tg Ab expression and targeting of neuronal cells. To open the BBB, we used LPS and streptococcal cell walls in the mice to promote Ab penetration of the brain. Requirements for BBB penetration were established previously by Kowal et al. (40) in the pathogenesis of anti-DNA Abs and in neurologic lupus (50, 76). Tg24.3.1-IgG1a mice not receiving the BBB stimulants did not have Tg24.3.1-IgG1a Ab in the brain. Most importantly, in vivo, Tg 24.3.1 Ab (IgG1a) colocalized with TH Ab, a marker for dopaminergic neurons (51). Thus, our study identified dopaminergic neurons as the in vivo targets of Tg24.3.1-IgG1a in mouse brain. Colocalization studies gave the appearance that in vivo Tg24.3.1-IgG1a was internalized within TH+ neuronal cells in cross-sections of the Tg mouse basal ganglia. Internalization might be expected, because previous studies showed that Abs to neuronal receptors can be internalized (77), and it is well established that dopamine receptors undergo recycling (78–80). Additionally, our current work confirms colocalization of deposited chimeric Tg24.3.1-IgG1a with dopamine receptor D2R. Our study strongly supports the in vitro recognition of D2R by both Tg24.3.1-IgG1a Ab and chorea-derived human mAb 24.3.1. Dopamine is critically involved in numerous physiological processes, and dopamine receptor functions are associated with the regulation of the second messenger cAMP through G

5539

5540


7.

8.

9.

10.

11.

12.

13.

14.

15. 16.

17. 18.

19. 20. 21.

Acknowledgments We thank Dr. Chris Goodnow for the IgG1a HC vector and Dr. Brett Aplin for the Igk LC vector. We also thank Janet Baker, Adita Blanco, and Kathy Alvarez for expert technical assistance. We acknowledge Dr. David Dyer and Dr. Allison Gillaspy and the University of Oklahoma Health Sciences Center Laboratory for Genomics and Bioinformatics for DNA sequencing, as well as Jim Henthorn and the University of Oklahoma Flow and Image Cytometry Laboratory for FACS analysis. We thank the dedicated parents of children with movement and behavioral disorders for support. We also thank Dr. Shu Man Fu (University of Virginia College of Medicine, Charlottesville, VA) for critical review of the original manuscript and Dafna Lotan and Dr. Daphna Joel (Tel Aviv University, Tel Aviv, Israel) for helpful discussions.

Disclosures M.W.C. serves as Chief Scientific Officer of Moleculera Labs, which provides testing of anti-neuronal Abs in children with neuropsychiatric and movement disorders. M.W.C. and C.J.C. declare a financial interest in Moleculera Labs. J.F.L. serves on the medical advisory board of Moleculera Labs.

References 1. Stollerman, G. H. 2001. Rheumatic fever in the 21st century. Clin. Infect. Dis. 33: 806–814. 2. Marques-Dias, M. J., M. T. Mercadante, D. Tucker, and P. Lombroso. 1997. Sydenham’s chorea. Psychiatr. Clin. North Am. 20: 809–820. 3. Taranta, A., and G. H. Stollerman. 1956. The relationship of Sydenham’s chorea to infection with group A streptococci. Am. J. Med. 20: 170–175. 4. Taranta, A. 1959. Relation of isolated recurrences of Sydenham’s chorea to preceding streptococcal infections. N. Engl. J. Med. 260: 1204–1210. 5. Kurlan, R., and E. L. Kaplan. 2004. The pediatric autoimmune neuropsychiatric disorders associated with streptococcal infection (PANDAS) etiology for tics and obsessive-compulsive symptoms: hypothesis or entity? Practical considerations for the clinician. Pediatrics 113: 883–886. 6. Kurlan, R., D. Johnson, and E. L. Kaplan; Tourette Syndrome Study Group. 2008. Streptococcal infection and exacerbations of childhood tics and obsessive-

22.

23.

24.

25.

26. 27.

28. 29.

30.

31.

32.

33.

compulsive symptoms: a prospective blinded cohort study. Pediatrics 121: 1188– 1197. Murphy, T. K., R. Kurlan, and J. Leckman. 2010. The immunobiology of Tourette’s disorder, pediatric autoimmune neuropsychiatric disorders associated with Streptococcus, and related disorders: a way forward. J. Child Adolesc. Psychopharmacol. 20: 317–331. Gause, C., C. Morris, S. Vernekar, C. Pardo-Villamizar, M. A. Grados, and H. S. Singer. 2009. Antineuronal antibodies in OCD: comparisons in children with OCD-only, OCD+chronic tics and OCD+PANDAS. J. Neuroimmunol. 214: 118–124. Murphy, T. K., E. A. Storch, A. B. Lewin, P. J. Edge, and W. K. Goodman. 2012. Clinical factors associated with pediatric autoimmune neuropsychiatric disorders associated with streptococcal infections. J. Pediatr. 160: 314–319 Kirvan, C. A., S. E. Swedo, J. S. Heuser, and M. W. Cunningham. 2003. Mimicry and autoantibody-mediated neuronal cell signaling in Sydenham chorea. Nat. Med. 9: 914–920. Kirvan, C. A., C. J. Cox, S. E. Swedo, and M. W. Cunningham. 2007. Tubulin is a neuronal target of autoantibodies in Sydenham’s chorea. J. Immunol. 178: 7412–7421. Kirvan, C. A., S. E. Swedo, D. Kurahara, and M. W. Cunningham. 2006. Streptococcal mimicry and antibody-mediated cell signaling in the pathogenesis of Sydenham’s chorea. Autoimmunity 39: 21–29. Kirvan, C. A., S. E. Swedo, L. A. Snider, and M. W. Cunningham. 2006. Antibody-mediated neuronal cell signaling in behavior and movement disorders. J. Neuroimmunol. 179: 173–179. Brilot, F., V. Merheb, A. Ding, T. Murphy, and R. C. Dale. 2011. Antibody binding to neuronal surface in Sydenham chorea, but not in PANDAS or Tourette syndrome. Neurology 76: 1508–1513. Bronze, M. S., and J. B. Dale. 1993. Epitopes of streptococcal M proteins that evoke antibodies that cross-react with human brain. J. Immunol. 151: 2820–2828. Husby, G., I. van de Rijn, J. B. Zabriskie, Z. H. Abdin, and R. C. Williams, Jr. 1976. Antibodies reacting with cytoplasm of subthalamic and caudate nuclei neurons in chorea and acute rheumatic fever. J. Exp. Med. 144: 1094–1110. Zabriskie, J. B. 1967. Mimetic relationships between group A streptococci and mammalian tissues. Adv. Immunol. 7: 147–188. Zabriskie, J. B., K. C. Hsu, and B. C. Seegal. 1970. Heart-reactive antibody associated with rheumatic fever: characterization and diagnostic significance. Clin. Exp. Immunol. 7: 147–159. Zabriskie, J. B. 1985. Rheumatic fever: the interplay between host, genetics, and microbe. Lewis A. Conner memorial lecture. Circulation 71: 1077–1086. Swedo, S. E. 1994. Sydenham’s chorea. A model for childhood autoimmune neuropsychiatric disorders. JAMA 272: 1788–1791. Perlmutter, S. J., S. F. Leitman, M. A. Garvey, S. Hamburger, E. Feldman, H. L. Leonard, and S. E. Swedo. 1999. Therapeutic plasma exchange and intravenous immunoglobulin for obsessive-compulsive disorder and tic disorders in childhood. Lancet 354: 1153–1158. Swedo, S. E., H. L. Leonard, M. Garvey, B. Mittleman, A. J. Allen, S. Perlmutter, L. Lougee, S. Dow, J. Zamkoff, and B. K. Dubbert. 1998. Pediatric autoimmune neuropsychiatric disorders associated with streptococcal infections: clinical description of the first 50 cases. Am. J. Psychiatry 155: 264–271. Swedo, S. E., H. L. Leonard, B. B. Mittleman, A. J. Allen, J. L. Rapoport, S. P. Dow, M. E. Kanter, F. Chapman, and J. Zabriskie. 1997. Identification of children with pediatric autoimmune neuropsychiatric disorders associated with streptococcal infections by a marker associated with rheumatic fever. Am. J. Psychiatry 154: 110–112. Swedo, S. E., J. L. Rapoport, D. L. Cheslow, H. L. Leonard, E. M. Ayoub, D. M. Hosier, and E. R. Wald. 1989. High prevalence of obsessive-compulsive symptoms in patients with Sydenham’s chorea. Am. J. Psychiatry 146: 246–249. Swedo, S. E., H. L. Leonard, M. B. Schapiro, B. J. Casey, G. B. Mannheim, M. C. Lenane, and D. C. Rettew. 1993. Sydenham’s chorea: physical and psychological symptoms of St Vitus dance. Pediatrics 91: 706–713. Swedo, S. E., and P. J. Grant. 2005. Annotation: PANDAS: a model for human autoimmune disease. J. Child Psychol. Psychiatry 46: 227–234. Giedd, J. N., J. L. Rapoport, M. J. Kruesi, C. Parker, M. B. Schapiro, A. J. Allen, H. L. Leonard, D. Kaysen, D. P. Dickstein, W. L. Marsh, et al. 1995. Sydenham’s chorea: magnetic resonance imaging of the basal ganglia. Neurology 45: 2199– 2202. Singer, H. S., C. R. Loiselle, O. Lee, K. Minzer, S. Swedo, and F. H. Grus. 2004. Anti-basal ganglia antibodies in PANDAS. Mov. Disord. 19: 406–415. Giedd, J. N., J. L. Rapoport, M. A. Garvey, S. Perlmutter, and S. E. Swedo. 2000. MRI assessment of children with obsessive-compulsive disorder or tics associated with streptococcal infection. Am. J. Psychiatry 157: 281–283. Allen, A. J., H. L. Leonard, and S. E. Swedo. 1995. Case study: a new infectiontriggered, autoimmune subtype of pediatric OCD and Tourette’s syndrome. J. Am. Acad. Child Adolesc. Psychiatry 34: 307–311. Shikhman, A. R., N. S. Greenspan, and M. W. Cunningham. 1994. Cytokeratin peptide SFGSGFGGGY mimics N-acetyl-beta-D-glucosamine in reaction with antibodies and lectins, and induces in vivo anti-carbohydrate antibody response. J. Immunol. 153: 5593–5606. Shikhman, A. R., and M. W. Cunningham. 1994. Immunological mimicry between N-acetyl-beta-D-glucosamine and cytokeratin peptides. Evidence for a microbially driven anti-keratin antibody response. J. Immunol. 152: 4375– 4387. Shikhman, A. R., N. S. Greenspan, and M. W. Cunningham. 1993. A subset of mouse monoclonal antibodies cross-reactive with cytoskeletal proteins and group A streptococcal M proteins recognizes N-acetyl-beta-D-glucosamine. J. Immunol. 151: 3902–3913.


We do not completely understand the basis of the discrepancy in lack of binding of PANDAS sera to FLAG-tagged extracellular D2R expressed in transfected HEK293T cells (extracellular Nterminal octapetide DYKDDDDK [FLAG]-tagged D2L isoform) (63) compared with PANDAS sera signaling through D2R expressed on live mouse fibroblast A9 L-hD2 S.C.18 cells (A9 L cell line hD2 subclone #18, ATCC CRL-10225) (Fig. 10A). The differences could be explained if PANDAS and SC Abs bind different extracellular epitopes on D2R. It is conceivable that the FLAG tag may interfere with the binding of PANDAS Abs in HEK293T cell experiments. Alternatively, differences in posttranslational modifications of D2R in different cell lines also could result in interference in PANDAS Abs binding one cell line but not the other. In summary, based on several pieces of evidence, our findings support recognition of D2R by mAb 24.3.1. We demonstrated mAb 24.3.1 binding to a FLAG-tagged dopamine D2R, as well as induction of cAMP signaling in vitro in D2R-transfected cell lines. Although mAb 24.3.1 identified a peptide epitope of D2R, we cannot be certain of the in vivo target. Our Tg24.3.1-IgG1a Ab mouse model translated to human SC by evidence of in vivo expression of chorea-derived human VH Ab that targeted dopaminergic neurons. In addition, human sera IgG from SC and PANDAS induced inhibitory signaling of the D2R in transfectants. Reactivity with D2R may be present in SC and PANDAS that displays small choreiform piano playing movements (22). Finally, our evidence supports the hypothesis that in brain disorders, such as SC and PANDAS/pediatric acute-onset neuropsychiatric syndrome, Ab-mediated D2R signaling on dopaminergic neurons could contribute to alteration of the central dopamine pathways and development of movement and neuropsychiatric symptoms.


58. Surmeier, D. J., L. Carrillo-Reid, and J. Bargas. 2011. Dopaminergic modulation of striatal neurons, circuits, and assemblies. Neuroscience 198: 3–18. 59. Graybiel, A. M. 2000. The basal ganglia. Curr. Biol. 10: R509–R511. 60. Kawaguchi, Y., C. J. Wilson, S. J. Augood, and P. C. Emson. 1995. Striatal interneurones: chemical, physiological and morphological characterization. Trends Neurosci. 18: 527–535. 61. Gerfen, C. R., K. A. Keefe, and E. B. Gauda. 1995. D1 and D2 dopamine receptor function in the striatum: coactivation of D1- and D2-dopamine receptors on separate populations of neurons results in potentiated immediate early gene response in D1-containing neurons. J. Neurosci. 15: 8167–8176. 62. Celver, J., M. Sharma, and A. Kovoor. 2010. RGS9-2 mediates specific inhibition of agonist-induced internalization of D2-dopamine receptors. J. Neurochem. 114: 739–749. 63. Celver, J., M. Sharma, and A. Kovoor. 2012. D(2)-Dopamine receptors target regulator of G protein signaling 9-2 to detergent-resistant membrane fractions. J. Neurochem. 120: 56–69. 64. Dale, R. C., V. Merheb, S. Pillai, D. Wang, L. Cantrill, T. K. Murphy, H. BenPazi, S. Varadkar, T. D. Aumann, M. K. Horne, et al. 2012. Antibodies to surface dopamine-2 receptor in autoimmune movement and psychiatric disorders. Brain 135: 3453–3468. 65. Fukunaga, K., and N. Shioda. 2012. Novel dopamine D2 receptor signaling through proteins interacting with the third cytoplasmic loop. Mol. Neurobiol. 45: 144–152. 66. Yaddanapudi, K., M. Hornig, R. Serge, J. De Miranda, A. Baghban, G. Villar, and W. I. Lipkin. 2010. Passive transfer of Streptococcus-induced antibodies reproduces behavioral disturbances in a mouse model of pediatric autoimmune neuropsychiatric disorders associated with streptococcal infection. Mol. Psychiatry 15: 712–726. 67. Hoffman, K. L., M. Hornig, K. Yaddanapudi, O. Jabado, and W. I. Lipkin. 2004. A murine model for neuropsychiatric disorders associated with group A betahemolytic streptococcal infection. J. Neurosci. 24: 1780–1791. 68. Dale, R. C. 2005. Post-streptococcal autoimmune disorders of the central nervous system. Dev. Med. Child Neurol. 47: 785–791. 69. Shannon, K. M., and G. M. Fenichel. 1990. Pimozide treatment of Sydenham’s chorea. Neurology 40: 186. 70. Demiroren, K., H. Yavuz, L. Cam, B. Oran, S. Karaaslan, and S. Demiroren. 2007. Sydenham’s chorea: a clinical follow-up of 65 patients. J. Child Neurol. 22: 550–554. 71. Moretti, G., M. Pasquini, G. Mandarelli, L. Tarsitani, and M. Biondi. 2008. What every psychiatrist should know about PANDAS: a review. Clin. Pract. Epidemol Ment. Health 4: 13. 72. Sokol, M. S. 2000. Infection-triggered anorexia nervosa in children: clinical description of four cases. J. Child Adolesc. Psychopharmacol. 10: 133–145. 73. Pivonello, R., D. Ferone, G. Lombardi, A. Colao, S. W. Lamberts, and L. J. Hofland. 2007. Novel insights in dopamine receptor physiology. Eur. J. Endocrinol. 156(Suppl. 1): S13–S21. 74. Pollack, A. 2004. Coactivation of D1 and D2 dopamine receptors: in marriage, a case of his, hers, and theirs. Sci. STKE 2004: pe50. 75. Harris, K., and H. S. Singer. 2006. Tic disorders: neural circuits, neurochemistry, and neuroimmunology. J. Child Neurol. 21: 678–689. 76. Kowal, C., L. A. Degiorgio, J. Y. Lee, M. A. Edgar, P. T. Huerta, B. T. Volpe, and B. Diamond. 2006. Human lupus autoantibodies against NMDA receptors mediate cognitive impairment. Proc. Natl. Acad. Sci. USA 103: 19854–19859. 77. Hughes, E. G., X. Peng, A. J. Gleichman, M. Lai, L. Zhou, R. Tsou, T. D. Parsons, D. R. Lynch, J. Dalmau, and R. J. Balice-Gordon. 2010. Cellular and synaptic mechanisms of anti-NMDA receptor encephalitis. J. Neurosci. 30: 5866–5875. 78. Wolstencroft, E. C., G. Simic, N. thi Man, I. Holt, T. Lam, P. R. Buckland, and G. E. Morris. 2007. Endosomal location of dopamine receptors in neuronal cell cytoplasm. J. Mol. Histol. 38: 333–340. 79. Parton, R. G., and A. A. Richards. 2003. Lipid rafts and caveolae as portals for endocytosis: new insights and common mechanisms. Traffic 4: 724–738. 80. Sudhof, T. C. 2004. The synaptic vesicle cycle. Annu. Rev. Neurosci. 27: 509– 547. 81. Lee, J. Y., P. T. Huerta, J. Zhang, C. Kowal, E. Bertini, B. T. Volpe, and B. Diamond. 2009. Neurotoxic autoantibodies mediate congenital cortical impairment of offspring in maternal lupus. Nat. Med. 15: 91–96. 82. Gardoni, F., E. Marcello, and M. Di Luca. 2009. Postsynaptic density-membrane associated guanylate kinase proteins (PSD-MAGUKs) and their role in CNS disorders. Neuroscience 158: 324–333. 83. Hasbi, A., B. F. O’Dowd, and S. R. George. 2011. Dopamine D1-D2 receptor heteromer signaling pathway in the brain: emerging physiological relevance. Mol. Brain 4: 26. 84. Ben-Pazi, H., J. A. Stoner, and M. W. Cunningham. 2013. Dopamine receptor autoantibodies correlate with symptoms in Sydenham’s Chorea. PLoS ONE 8: e73516.


34. Conners, C. K., K. C. Wells, J. D. Parker, G. Sitarenios, J. M. Diamond, and J. W. Powell. 1997. A new self-report scale for assessment of adolescent psychopathology: factor structure, reliability, validity, and diagnostic sensitivity. J. Abnorm. Child Psychol. 25: 487–497. 35. Brimberg, L., I. Benhar, A. Mascaro-Blanco, K. Alvarez, D. Lotan, C. Winter, J. Klein, A. E. Moses, F. E. Somnier, J. F. Leckman, et al. 2012. Behavioral, pharmacological, and immunological abnormalities after streptococcal exposure: a novel rat model of Sydenham chorea and related neuropsychiatric disorders. Neuropsychopharmacology 37: 2076–2087. 36. Aplin, B. D., C. L. Keech, A. L. de Kauwe, T. P. Gordon, D. Cavill, and J. McCluskey. 2003. Tolerance through indifference: autoreactive B cells to the nuclear antigen La show no evidence of tolerance in a transgenic model. J. Immunol. 171: 5890–5900. 37. Pogue, S. L., and C. C. Goodnow. 2000. Gene dose-dependent maturation and receptor editing of B cells expressing immunoglobulin (Ig)G1 or IgM/IgG1 tail antigen receptors. J. Exp. Med. 191: 1031–1044. 38. Kim-Saijo, M., T. Akamizu, K. Ikuta, Y. Iida, K. Ohmori, K. Matsubara, Y. Matsuda, M. Suzuki, F. Matsuda, and K. Nakao. 2003. Generation of a transgenic animal model of hyperthyroid Graves’ disease. Eur. J. Immunol. 33: 2531–2538. 39. Li, J., Y. Wang, Q. X. Li, Y. M. Wang, J. J. Xu, and Z. W. Dong. 1998. Cloning of 3H11 mAb variable region gene and expression of 3H11 human-mouse chimeric light Chain. World J. Gastroenterol. 4: 41–44. 40. Kowal, C., L. A. DeGiorgio, T. Nakaoka, H. Hetherington, P. T. Huerta, B. Diamond, and B. T. Volpe. 2004. Cognition and immunity; antibody impairs memory. Immunity 21: 179–188. 41. Dal Toso, R., B. Sommer, M. Ewert, A. Herb, D. B. Pritchett, A. Bach, B. D. Shivers, and P. H. Seeburg. 1989. The dopamine D2 receptor: two molecular forms generated by alternative splicing. EMBO J. 8: 4025–4034. 42. Krisher, K., and M. W. Cunningham. 1985. Myosin: a link between streptococci and heart. Science 227: 413–415. 43. Swerlick, R. A., M. W. Cunningham, and N. K. Hall. 1986. Monoclonal antibodies cross-reactive with group A streptococci and normal and psoriatic human skin. J. Invest. Dermatol. 87: 367–371. 44. Galvin, J. E., M. E. Hemric, K. Ward, and M. W. Cunningham. 2000. Cytotoxic mAb from rheumatic carditis recognizes heart valves and laminin. J. Clin. Invest. 106: 217–224. 45. Cunningham, M. W., H. C. Meissner, J. S. Heuser, B. A. Pietra, D. K. Kurahara, and D. Y. Leung. 1999. Anti-human cardiac myosin autoantibodies in Kawasaki syndrome. J. Immunol. 163: 1060–1065. 46. Li, Y., J. S. Heuser, S. D. Kosanke, M. Hemric, and M. W. Cunningham. 2004. Cryptic epitope identified in rat and human cardiac myosin S2 region induces myocarditis in the Lewis rat. J. Immunol. 172: 3225–3234. 47. Tang, L., R. D. Todd, A. Heller, and K. L. O’Malley. 1994. Pharmacological and functional characterization of D2, D3 and D4 dopamine receptors in fibroblast and dopaminergic cell lines. J. Pharmacol. Exp. Ther. 268: 495–502. 48. Goodnow, C. C. 1992. Transgenic mice and analysis of B-cell tolerance. Annu. Rev. Immunol. 10: 489–518. 49. Putterman, C., B. Deocharan, and B. Diamond. 2000. Molecular analysis of the autoantibody response in peptide-induced autoimmunity. J. Immunol. 164: 2542–2549. 50. DeGiorgio, L. A., K. N. Konstantinov, S. C. Lee, J. A. Hardin, B. T. Volpe, and B. Diamond. 2001. A subset of lupus anti-DNA antibodies cross-reacts with the NR2 glutamate receptor in systemic lupus erythematosus. Nat. Med. 7: 1189–1193. 51. Lo Bianco, C., J. L. Ridet, B. L. Schneider, N. Deglon, and P. Aebischer. 2002. alpha -Synucleinopathy and selective dopaminergic neuron loss in a rat lentiviral-based model of Parkinson’s disease. Proc. Natl. Acad. Sci. USA 99: 10813–10818. 52. Pickel, V. M., T. H. Joh, and D. J. Reis. 1975. Ultrastructural localization of tyrosine hydroxylase in noradrenergic neurons of brain. Proc. Natl. Acad. Sci. USA 72: 659–663. 53. Beaulieu, J. M., and R. R. Gainetdinov. 2011. The physiology, signaling, and pharmacology of dopamine receptors. Pharmacol. Rev. 63: 182–217. 54. De Mei, C., M. Ramos, C. Iitaka, and E. Borrelli. 2009. Getting specialized: presynaptic and postsynaptic dopamine D2 receptors. Curr. Opin. Pharmacol. 9: 53–58. 55. Anzalone, A., J. E. Lizardi-Ortiz, M. Ramos, C. De Mei, F. W. Hopf, C. Iaccarino, B. Halbout, J. Jacobsen, C. Kinoshita, M. Welter, et al. 2012. Dual control of dopamine synthesis and release by presynaptic and postsynaptic dopamine D2 receptors. J. Neurosci. 32: 9023–9034. 56. Gerfen, C. R., T. M. Engber, L. C. Mahan, Z. Susel, T. N. Chase, F. J. Monsma, Jr., and D. R. Sibley. 1990. D1 and D2 dopamine receptor-regulated gene expression of striatonigral and striatopallidal neurons. Science 250: 1429–1432. 57. Sano, H., Y. Yasoshima, N. Matsushita, T. Kaneko, K. Kohno, I. Pastan, and K. Kobayashi. 2003. Conditional ablation of striatal neuronal types containing dopamine D2 receptor disturbs coordination of basal ganglia function. J. Neurosci. 23: 9078–9088.

5541

Lower Dopamine D2 Receptor Expression Levels in Human Dopaminergic Neurons Derived From Opioid-Dependent iPSCs.

The cloned dopamine D2 receptor reveals different densities for dopamine receptor antagonist ligands. Implications for human brain positron emission tomography.

Visualization of dopamine D1, D2 and D3 receptor mRNAs in human and rat brain.

Visualization of extrastriatal dopamine D2 receptors in the human brain.

Reduced striatal dopamine DA D2 receptor function in dominant-negative GSK-3 transgenic mice.

D3 receptor availability in the human brain.

Generation of monoclonal antibodies against a human T cell receptor beta chain expressed in transgenic mice.

Human FGF1 promoter is active in ependymal cells and dopaminergic neurons in the brains of F1B-GFP transgenic mice.

D1 and D2 dopamine receptor mRNA in rat brain.

Site-directed mutagenesis of the human dopamine D2 receptor.

Distribution of D2 dopamine receptor mRNA in the primate brain.

Ontogeny of dopamine D2 receptor mRNA in rat brain.

Neurotensin Induces Presynaptic Depression of D2 Dopamine Autoreceptor-Mediated Neurotransmission in Midbrain Dopaminergic Neurons.

Sydenham chorea in a 5-year-old Saudi patient.

Pharmacology of human dopamine D3 receptor expressed in a mammalian cell line: comparison with D2 receptor.

[The computed tomographic findings in chorea minor (Sydenham)].

An electrophysiological study of D2 dopaminergic actions in normal human retina: a tool in Parkinson's disease.

Exogenous dopamine reduces GABA receptor availability in the human brain.

Melanocortin 4 Receptor and Dopamine D2 Receptor Expression in Brain Areas Involved in Food Intake.

Hypothalamic dopaminergic neurons in transgenic dwarf mice: histofluorescence, immunocytochemical, and in situ hybridization studies.

Sydenham chorea in a 5-year-old Saudi patient.

Sydenham chorea in a 5-year-old Saudi patient.

An Efficient and Versatile System for Visualization and Genetic Modification of Dopaminergic Neurons in Transgenic Mice.

Role of Dopamine and D2 Dopamine Receptor in the Pathogenesis of Inflammatory Bowel Disease.