Toxicology Letters 229 (2014) 150–157

Contents lists available at ScienceDirect

Toxicology Letters journal homepage: www.elsevier.com/locate/toxlet

Bystander effects of PC12 cells treated with Pb2+ depend on ROSmitochondria-dependent apoptotic signaling via gap-junctional intercellular communication Shu Guo a,b , Jin Zhou c , Xuemei Chen a , Yunjiang Yu b , Mingzhong Ren b , Guocheng Hu b , Yun Liu b , Fei Zou a, * a Department of Occupational Health and Occupational Medicine, School of Public Health and Tropical Medicine, Southern Medical University, No. 1838, North Guangzhou Road, Guangzhou 510515, PR China b Center for Environmental Health Research, South China Institute of Environmental Sciences, Ministry of Environmental Protection, No. 7 Yuancunxi Street, Guangzhou 510655, PR China c Department of Ophthalmology, Guangzhou Women and Children's Medical Center, No. 9 Jinsui Street, Tianhe District, Guangzhou 510623, PR China

H I G H L I G H T S

G R A P H I C A L A B S T R A C T


Confirms the existence of bystander effects that propagated by Pb2+-induced cells.
An ingenious co-culture system for studying bystander effects.
Parachute assay demonstrates the forming of GJIC in co-culture system.
Certifies bystander effects of Pb2 + -induced PC12 cells exert through GJIC.

A R T I C L E I N F O

A B S T R A C T

Article history: Received 29 April 2014 Received in revised form 30 May 2014 Accepted 30 May 2014 Available online 21 June 2014

The demonstration of bystander effect, which means injured cells propagate damage to neighboring cells, in whole organisms has clear implication of the potential relevance of the non-targeted response to human health. Here we show that 10 mM lead acetate, the optimum concentration for inducing apoptosis confirmed by the expression levels of Bax and Bcl-2, can also induce rat pheochromocytoma (PC12) cells to exert bystander effects to neighboring cells. In a novel co-culture system, GFP-PC12 (Pb2+) cells, which were stable transfected with EF1A-eGFP and pre-exposed with lead acetate, were co-cultured with unexposed PC12 cells at a 1:5 ratio. Parachute assays demonstrated the functional gap-junctional intercellular communication (GJIC) formed between Pb2+-exposed and unexposed cells. The Pb2 + -exposed cells induced very similar effects on neighboring unexposed cells to apoptosis coincide with intracellular ROS generation and the collapse of mitochondrial membrane potential (Dcm). Furthermore, carbenoxolone (CBX), a blocker of GJIC, inhibited the bystander effects. The results indicate that the Pb2+-induced insults propagate through GJIC between PC12 cells, while inducing the bystander cells to apoptosis via ROS-mitochondria-dependent apoptotic signaling. ã 2014 Elsevier Ireland Ltd. All rights reserved.

Keywords: Bystander effect Lead acetate Reactive oxygen species Apoptosis Mitochondrial membrane potential Gap-junctional intercellular communication

1. Introduction * Corresponding author. Tel. : +86 20 6164 8301; fax: +86 20 6164 8324. E-mail address: [email protected] (F. Zou). http://dx.doi.org/10.1016/j.toxlet.2014.05.026 0378-4274/ ã 2014 Elsevier Ireland Ltd. All rights reserved.

Lead (Pb2+) is one of the most commonly used metals in industry and is highly toxic through inhalation and gastrointestinal

S. Guo et al. / Toxicology Letters 229 (2014) 150–157

absorption (Lu et al., 2014; Kul and Koyuncu, 2010). Lead can accumulate in fetal tissue as developmental neurotoxin (Ronchetti et al., 2006). Children are more vulnerable to the toxic effects of lead, particularly affecting potentially permanent learning and behavior disorders (Nigg et al., 2008; Banerjee et al., 2007; Fraser et al., 2006). It is well-known that higher blood lead levels are associated with poor educational outcomes (Bellinger, 2008; Chen et al., 2007). But many recent studies demonstrate neurodevelopmental effects of lead have no lower threshold for injury identified, suggesting that the decline rate in IQ scores might be greater even at lower doses (Lanphear et al., 2005; Canfield et al., 2003). To date, the mechanism of neurotoxin with low blood lead levels have not been well studied. It is known that the response of the cells to the external stimuli depends on both the properties of the cells themselves and the microenvironment around them. For example, low dose radiation damages the DNA of the directly irradiated cells and causes these cells to release molecules that damage the DNA of neighboring non irradiated cells (Tong et al., 2014; Soleymanifard et al., 2013; Little, 2006; Mothersill and Seymour, 2006). A low and short dose of Cr (VI) induces stem cells, cancer cells, and fibroblasts to chronically secrete bystander signals, which cause DNA damage in neighboring cells by a ‘bystander effect’ (Cogan et al., 2010). The demonstration of a bystander effect in 3D human tissues and, more recently, in whole organisms have clear implication of the potential relevance of the non-targeted response to human health (Bertucci et al., 2009; Sedelnikova et al., 2007). Base on the above, we hypothesized that lead insult parts of cells which propagate the damage to neighboring cells by bystander effects. Bystander effects have been observed in both in vitro and in vivo toxicological studies (Culver et al., 1992; Kishikawa et al., 2006; Mothersill and Seymour, 2001; Xue et al., 2002). The mechanism may be related to the active signaling molecules transferred between cells. Gap-junctions, which are composed of six transmembrane connexin subunits arranged as cylindrical channels (1.5 nm diameter) between connecting adjacent cells, can facilitate the transfer of 1- to 3-kDa molecules with some dependence on the cell type and physiological status (Higgins et al., 2010; García-Dorado et al., 2004). It is reasonable to hypothesize that gap-junctional intercellular communication (GJIC) plays an important role in mediating bystander effects. Although Pb2+-induced apoptosis is well-reported, it is unclear whether the Pb2+-injured cells transmit the damaged information to neighboring cells. In this study, we analyzed the bystander effects of lead on rat pheochromocytoma (PC12) cells, a model for neurotoxicology, and developed a novel co-culture system, in which PC12 cells were co-cultured in direct contact with GFPlabeled PC12 (GFP-PC12) cells that pretreated with lead acetate. The apoptosis, intracellular ROS generation and mitochondrial membrane potential (MMP) of PC12 cells were subsequently detected in the co-culture system. Gap junction blocker (CBX) was used to test the hypothesis that the Pb2+-induced damage can propagate between cells via GJIC.

151

MBI (MBI Fermentas, Canada). RPMI-1640 medium, Dulbecco’s modified Eagle’s medium (DMEM), fetal calf serum (FCS), and other chemicals were purchased from Hyclone (Hyclone, USA). 2.2. Cell culture PC12 cells were obtained from the Cell Bank of the Animal Experiment Center, North School Region, Sun Yat Sen University, People’s Republic of China. The cells were cultured routinely with RPMI-1640 phenol-free medium containing 5% heat-inactivated fetal bovine serum (FBS), 5% heat-inactivated horse serum, and 1% penicillin/streptomycin. All of the cells were cultured at 37  C in a 95% humidified incubator with 5% CO2. 2.3. Apoptosis and cell death The degree of apoptosis and cell death of PC12 cells were assessed by flow cytometry using an Annexin V-PE/7-AAD kit according to the manufacturer’s instructions. The final suspension was analyzed using a FACS Calibur flow cytometer (BD Biosciences), and the results were analyzed using the CellQuest Pro software (BD Biosciences). 2.4. RNA extraction and reverse transcription polymerase chain reaction (RT-PCR) To determine the exact concentration of lead acetate required for the induction of apoptosis, the expression levels of the Bax and Bcl-2 genes were detected by RT-PCR. The total RNA was extracted according to the manufacturer’s instructions and was reversetranscribed using Trizol reagents. The primer exhibited as Table 1. The PCR was performed with the following temperature program: denaturation at 94  C for 5 min followed by 30 cycles of denaturation at 94  C for 30 s, annealing at 60  C for 30 s, and extension at 72  C for 5 min (n = 3). The PCR reaction products were detected through gel electrophoresis and ultraviolet transillumination. 2.5. Co-culture system to detect the bystander effects of Pb2+-exposed PC12 cells 2.5.1. PC12 cells were stable transfected with EF1A-eGFP and were exposed to lead acetate To distinguish the unexposed PC12 cells from the Pb2+-exposed PC12 cells in the direct cell-to-cell contact culture system, some of the PC12 cells were transfected with the EF1A-eGFP vector (GFPPC12) and selected with 400 mg/ml G418. The transfections were performed according to the standard protocol from Cyagen. The expression of GFP was identified by fluorescence microscopy and flow cytometry analysis. Then, the GFP-PC12 cells were exposed to 10 mM lead acetate for 24 h (GFP-PC12(Pb)). The cells were harvested with 0.025% trypsin and 0.02% EDTA.

2. Materials and methods 2.1. Materials Lead acetate and dihydroethidium (DHE) were purchased from Sigma (Sigma, Germany). CM-DiI, calcein-acetoxymethyl ester (Calcein-AM), carbenoxolone (CBX), Trizol reagent, PCR mix, tetramethylrhodamine methyl ester (TMRM), and Hoechst 33342 were purchased from Invitrogen (Invitrogen, USA). The Annexin V-PE/7-AAD apoptosis detection kit was purchased from Abnova (Abnova, USA). EF1A-EGFP and G418 were purchased from Cyagen (Cyagen, USA). The CDNA synthesis kit was purchased from

Table 1 Primer pairs used in RT-PCR. Gene

Primer sequence (50 –30 )

Amplicon

Bax

(F) CCAAGAAGCTGAGCGAGTGTCTC (R) AGTTGCCATCAGCAAACATGTCA

246

Bcl-2

(F) TGCAGAGATGTCCAGTCAGC (R)CAT CCA CAG AGCGAT GTTGT

506

b-actin

(F) CCTCTGAACCCTAAGGCCAA (R) AGCCTGGATGGCTACGTACA

90

152

S. Guo et al. / Toxicology Letters 229 (2014) 150–157

2.5.2. Direct contact co-culture system to test the bystander effects of Pb2+-exposed cells The GFP-PC12 cells (1 103 cells/ml) were co-cultured with PC12 cells (5  103 cells/ml) in three groups. First, GFP-PC12 cells co-cultured with PC12 cells were assumed to be the control group (GFP-PC12 + PC12). Second, GFP-PC12(Pb2+) cells co-cultured with PC12 cells (GFP-PC12(Pb2+) + PC12) were used to determine the bystander effects of the Pb2+-exposed cells. To determine the effect of CBX, an inhibitor of gap junction, on the bystander effect, GFPPC12(Pb2+) cells were co-cultured with PC12 cells in medium with 100 mM CBX (GFP-PC12(Pb2+) + PC12 + CBX). The cells were harvested after co-cultured 24 h. 2.6. ROS detection Dihydroethidium (DHE) was used to measure the ROS generation in PC12 cells as previously reported with slight modifications (Nazarewicz et al., 2013; Chen et al., 2013). Briefly, at the end of the treatment period, the cells were washed and incubated with 2.5 mM DHE (red) at 37  C for 30 min and Hoechst 33342 (blue) to stain the nucleus for 30 min. The examination was performed with a laser-scanning confocal microscope (LSM 510 META; Carl Zeiss, Hamburg, Germany). The images were analyzed with the Image-Pro Plus software (version 6.0). The mean fluorescence intensity of each cell was calculated, and the total cell emission signals per field were averaged for data analysis.

2.7. Measurements of mitochondrial membrane potential (Dcm) The Dcm, which has been suggested to be central to the apoptotic pathway (Ly et al., 2003), was measured by flow cytometry with the TMRM detection kit according to the manufacturer’s instructions. The cells were incubated in the presence of 50 nM TMRM for 30 min at room temperature in the dark and then stored on ice until analysis by flow cytometry. For each sample, 10,000 particles were analyzed. The final suspension was analyzed using a FACS Calibur flow cytometer, and the results were analyzed with the CellQuest Pro software. The arithmetic mean values of the fluorescence signals in arbitrary units were determined for each sample and graphically represented. All of the experiments were repeated three times. 2.8. Parachute assay for gap junction function To confirm the function of gap junctions in the co-culture system, the parachute assay was used. To avoid overlaps between the green fluorescences of GFP and calcein-AM, which is converted intracellularly into the gap junction-permeable dye calcein, the parachute assay was performed as described by Goldberg et al. (1995) and Koreen et al. (2004) with minor modifications. Briefly, before coculture, GFP-PC12(Pb2+) cells were double-labeled with 5 mM CMDiI, a membrane dye that does not spread to coupled cells, and 5 mM Calcein-AM, which is converted intracellularly into the gap junctionpermeable dye calcein. After incubation for 30 min, the GFP-PC12

Fig. 1. Lead acetate is toxic to PC12 cells dose-dependently. (A) Flow cytometry analysis of the toxic effects of lead acetate on PC12 cells determined by Annexin-V/PE and 7AAD staining. Flow cytometric diagrams show that the number of apoptosis and dead cells increased dose-dependently after treated with lead acetate. Data are shown as mean  SD (n = 3), normalized by untreated PC12 cells as 1. *P < 0.05, **P < 0.01; (B) Effect of lead acetate on the mRNA expression levels of the apoptosis-associated markers. Representative images show the mRNA expression levels of Bax and Bcl-2 in PC12 cells after treatment with lead acetate at different concentrations, as determined by RT-PCR with b-actin as an internal control. Quantified data are shown at the right panel. Results are shown as mean  SD (n = 3) and expressed as relative fold increase to the control group (normalized to 1). **P < 0.01.

S. Guo et al. / Toxicology Letters 229 (2014) 150–157

(Pb2+) cells were trypsinized and used as the donor cells. Two groups of PC12 cells without any treatment were used as receptor cells: one group of cells was incubated with the donor solution, and the other group of cells was incubated with the donor solution supplemented with 100 mM CBX, which inhibits the formation of gap junctions without affecting the activity of connexin. The donor cells were cocultured with the receiver cells at a 1:5 ratio. The cells were incubated for approximately 4 h in 5% CO2 at 37  C and then examined with an inverted fluorescence microscope. 2.9. Statistical analysis All results were statistically analyzed with SAS software (version 8.01) to have ANOVA and post hoc Tukey HSD tests. All of the values are presented as the mean  SE, and a probability value of 0.05 was considered to be statistically significant. 3. Results 3.1. Lead acetate is toxic to PC12 cells dose-dependently 3.1.1. Effect of lead acetate on apoptosis and death of PC12 cells As shown in Fig. 1A, the flow cytometry analysis reveals that the percentage of apoptosis in the untreated PC12 cell population was 0.40%  0.46%, and significantly higher percentages of PC12 cells underwent apoptosis after treatment with 0.1 mM, 1 mM, 10 mM, and 100 mM lead acetate (1.33%  0.42%, 5.40%  0.51%,

153

38.33%  3.06%, and 46.67%  4.51%, respectively). The percentages of apoptotic cells in the 10 mM and 100 mM groups were not significantly different. However, 18.67%  2.08% of the cells in the 100 mM group died, whereas a lower percentage of cells (9.97%  1.95%) died in the 10 mM group (P < 0.01, n = 3). The percentage of apoptosis and died cells in the 10 mM group was 48.3%  4.59%, while it was significantly raised to 65.33%  4.62% in 100 mM group (P < 0.01, n = 3). 3.1.2. Effect of lead acetate on Bax and Bcl-2 levels of PC12 cells To determine the exact concentration of lead acetate for use in the subsequent studies, we performed RT-PCR to detect the gene expression levels of Bax and Bcl-2 in PC12 cells after treatment with lead acetate at different concentrations. All of the RT-PCR results were standardized to the levels observed in the unexposed PC12 cells (normalized to 1). The data are shown in Fig. 1B. The RTPCR analysis demonstrated that the expression of Bax mRNA was significantly (P < 0.01, n = 3) increased to 3.38, 3.18, and 4.42 after treatment with 1 mM, 10 mM, and 100 mM lead acetate, respectively, compared with the untreated PC12 cells. There were not significant differences between 1 mM, 10 mM, and 100 mM treatment groups. The expression levels of Bcl-2 mRNA were decreased significantly in the 10 mM and 100 mM groups (33.3%, 4.42%, respectively, P < 0.01, n = 3), compared with the untreated PC12 cells. Consistent with the apoptosis assay and RT-PCR, a lead acetate concentration of 10 mM was selected for the subsequent studies.

Fig. 2. Direct contact co-culture system for test the bystand effects of GFP-PC12(Pb2+) cells. (A) Stable transfection of PC12 cells with EF1A-eGFP. Representative images show the transfection efficiency of PC12 cells labelled with the EGFP-N1 vector (GFP-PC12 cells), evaluated by fluorescence microscopy and flow cytometry analysis; (B) representative images show PC12 cells without green staining can be isolated from GFP-PC12 cells pre-treated with lead acetate in the co-culture system by fluorescence microscopy; (C) parachute assay detects the gap junction formation between GFP-PC12(Pb2+) cells (donor) and PC12 cells (receiver) in the co-culture system. The donor cells were double-labeled with CM-Dil (red), a dye that does not spread to coupled cells, and Calcein-AM (green), which was converted intracellularly into the gap junctionpermeable dye calcein. The donor cells were co-cultured with the receiver cells at a 1:5 ratio. Inverted fluorescence microscope images show that green fluorescent is spread through functional gap junction and CBX, an blocker of functional gap junctions, inhibit the green fluorescent transmission between cells.(For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

154

S. Guo et al. / Toxicology Letters 229 (2014) 150–157

3.2. Direct contact co-culture system for test the bystand effects of GFP-PC12(Pb2+) cells. To distinguish the Pb2+-exposed cells and unexposed PC12 cells, the former were stably transfected with the EF1A-EGFP vector (GFP-PC12) before being exposed to lead acetate, and approximately 99% of the GFP-PC12 cells were found to be GFP-positive, which evaluated by an inverted fluorescence microscope and flow cytometry analysis (Fig. 2A). After successful transfection, the GFP-PC12 cells were incubated in medium containing 10 mM lead acetate for 24 h, and the GFPPC12(Pb2+) cells (GFP+) were co-cultured with unexposed PC12 cells (GFP). The fluorescence microscopy data are shown in Fig. 2B. The parachute assay results demonstrate that functional gap junctions were formed between GFP-PC12(Pb2+) cells and PC12 cells. The red fluorescence represents the donor cells, e.g., GFPPC12(Pb2+) cells, and the green fluorescence demonstrated that the donor cells transmitted the signals to the receptor cells (PC12 cells) through functional gap junctions. After incubation with CBX, an inhibitor of functional gap junctions, the donor cells did not convey any signals (Fig. 2C). 3.3. The bystander effects of GFP-PC12(pb2+) cells We test the bystander effects in the GFP-PC12(Pb2+) + PC12 group. In the co-culture system, GFP-PC12(Pb2+) cells were GFP(+), whereas the normal PC12 cells were GFP(). GFP-PC12 + PC12 group is the control group. Images of the ROS immunofluorescent staining are shown in Fig. 3A, and the diagram is shown as Fig. 3B. Data indicates that

minimal red fluorescence (ROS) was detected in the GFP()PC12 cells of the GFP-PC12 + PC12 group (normalized to 1). However, the GFP()PC12 cells of the GFP-PC12(Pb2+) + PC12 group expressed a significantly higher level of red fluorescence in the nucleus (3.48  0.59) (P < 0.01, n = 3). The Dcm was measured by FACS analysis with the fluorescent probe TMRM. In the co-culture system, only the GFP()PC12 cells were investigated. As shown in Fig. 4, the selected cells from the GFP-PC12(Pb2+) + PC12 group exhibited the lower Dcm. The Annexin V-PE/7-AAD apoptosis detection kit was used to detect the apoptosis of GFP() cells, which stains apoptosis cells a red color. The data are shown as Fig. 5, where Annexin V-PE is the abscissa, and GFP is the ordinate. The Annexin V(+)GFP() cells represent the cells that were affected by the Pb2+-exposed cells and need to be further analyzed. The diagram shown in Fig. 5 demonstrates that the Annexin V(+)GFP() PC12 cells in the coculture system endure the higher percentage of apoptosis (43.52%  8.07%) (P < 0.01, n = 3), . 3.4. The bystander effects of GFP-PC12(Pb2+) cells are inhibited by cbx GFP() PC12 cells of the GFP-PC12(Pb2+) + PC12 + CBX group generate a lower level of ROS (1.64  0.42) than that of GFP-PC12 (Pb2+) + PC12 group (P < 0.01, n = 3), and generate a higher level of ROS than that of GFP-PC12 + PC cells (P < 0.01, n = 3), shown as Fig. 3. With the analysis of FACS analysis shown in Fig. 4, the Dcm of GFP() cells of the GFP-PC12(Pb2+) + PC12 + CBX group presented a lower intensity compared with that of GFP-PC12 + PC12 group. At the meaning time, The diagram shown in Fig. 5 demonstrates CBX significantly inhibits the apoptosis of GFP() PC12 cells of the

Fig. 3. CBX inhibits the ROS generation of GFP() PC12 cells in co-culture system. (A) ROS observed by fluorescence microscopy; (B) representative images show that after coculture with Pb2+-exposed GFP-PC12 cells, GFP() PC12 cells generated more ROS (red) than that of co-culture with unexposed GFP-PC12 cells. CBX could partially inhibit ROS generation in GFP () PC12 cells in the co-culture system. Quantified data are shown as relative fold increase to the control group (GFP-PC12 + PC12) that normalized to 1. **P < 0.01.(For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

S. Guo et al. / Toxicology Letters 229 (2014) 150–157

155

Fig. 4. CBX prevents the mitochondrial membrane potential (Dcm) collapse of GFP () PC12 cells in co-culture system. The X-axis is the intensity of fluorescence, the Y-axis is the cell number. The cells of GFP-PC12 + PC12 group, GFP-PC12(Pb2+) + PC12 group and GFP-PC12(Pb2+) + PC12 + CBX group were stained with 50 nM TMRM (red) and the Dcm were detected by flow cytometry. Then compare the Dcm of the GFP() PC12 cells of three groups. A merged diagram is shown at the bottom panel.(For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Fig. 5. CBX inhibits the apoptosis of GFP() cells in co-culture system. GFP(+) cells (green) represent the cells exposed to 10 mM lead acetate. Annexin V-PE(+) cells (red) represent the apoptosis cells in the co-culture system. Annexin V(+)GFP() cells present the unexposed cells affected by the Pb2+exposed cells. After treated with 100 mM CBX, the percentage of annexin V(+)GFP() cells decreased. Quantified data are shown as mean  SD (n = 3) and expressed as relative fold increase to the control group (GFPPC12 + PC12) (normalized to 1). **P < 0.01.(For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

GFP-PC12(Pb2+) + PC12 + CBX group (12.19%  1.13%) compared with that of GFP-PC12(Pb2+) + PC12 group. Fig. 5. GFP(+) cells (green) represent the cells exposed to 10 mM lead acetate. Annexin V-PE(+) cells (red) represent the apoptosis cells in the co-culture system. Annexin V(+)GFP() cells present the unexposed cells affected by the Pb2+-exposed cells. After treated with 100 mM CBX, the percentage of annexin V(+)GFP() cells decreased. Quantified data are shown as mean  SD (n = 3) and expressed as relative fold increase to the control group (GFPPC12 + PC12) (normalized to 1). **P < 0.01. These results indicate that the bystander effects on PC12 cells transferred from GFP-PC12(Pb2+) cells are dependent on functional GJIC because CBX can inhibit the bystander effects by blocking the GJIC. 4. Discussion Several research groups have postulated that lead may exert toxicity through apoptosis (He et al., 2000, 2003; Pulido and Parrish, 2003). But there is no consensus on a suitable concentration of lead acetate for the neurotoxicity research of PC12 cells (Xu

et al., 2008; Sharifi et al., 2005; Kim et al., 1997). In our study, the apoptosis assay and apoptosis related gene detection were used to determine the optimal concentration of lead acetate for subsequent studies. The percentages of apoptosis cells in the 10 mM groups were higher than normal PC12 cells while there were no difference between 10 mM and 100 mM groups. Further study showed that there were more dead cells in the 100 mM group than 10 mM group. Xu et al. (2008) found that lead can induce apoptosis and change the levels of Bax and Bcl-2. Then, we detected the expression level of key apoptosis-related proteins, namely Bax and Bcl-2, in PC12 cells exposed to different concentration of lead acetate. Bax the outer membrane component of the mitochondrial permeability transition pore (MPTP), can enhance the outer membrane permeability, permit MPTP-dependent mitochondrial swelling, and accelerate cell apoptosis (Karch et al., 2013). Bcl-2, an integral membrane protein located mainly on the outer membrane of the mitochondria, can prevent cells from undergoing apoptosis (Yang et al., 1997). The RT-PCR analysis showed that the expression levels of Bax mRNA were increased significantly after treatment with 1 mM. However, the expression of Bcl-2 mRNA was decreased after treatment with 10 mM. These results suggest that lead acetate

156

S. Guo et al. / Toxicology Letters 229 (2014) 150–157

induces cytotoxicity in a concentration-dependent manner and 10 mM should be considered the optimal concentration for the induction of apoptosis in PC12 cells. 10 mM lead acetate elevated the expression of Bax while decreased the expression of Bcl-2, which indicates that lead decreases the anti-apoptotic ability of the cells. Cells can interact with each other in the culture microenvironment, which including the signaling molecules and extracellular matrix (Loubaki et al., 2013). Many studies of ionizing radiation and some chemicals have confirmed the existence of the bystander effect, which was characterized as a signaling process from injured cells to neighboring cells (Widel et al., 2013). All of these findings suggest that bystander effect may be part of a general cellular stress response. We hypothesized that the cells injured by lead acetate can expand the damage to neighboring cells. The parachute assay results demonstrate that functional gap junctions were formed between GFP-PC12(Pb2+) cells and PC12 cells. Accordance with the parachute assay procedure, we co-cultured Pb2+-exposed cells and unexposed PC12 cells at a 1:5 ratio for further research. In the co-culture system, our study provides the first demonstration that Pb2+-exposed PC12 cells can exert very similar effects on their neighboring cells, which were induced to apoptosis coincides with intracellular ROS generation in the cytosol and Dcm collapse. The physiological function of the mitochondria, which acts as a biological switch in determining cell fate, is to produce adenosine triphosphate (ATP) that provides energy to the cell, and cause cell apoptosis in response to noxious stimuli (Chen et al., 2011; Pandya et al., 2013). During ATP production, the mitochondria also produce ROS as a by-product, which can inflict serious damage to lipids, proteins, and DNA and lead to cell death (Sairam et al., 2005). In our study, the unexposed cells were co-cultured with Pb2+-exposed PC12 cells and the homeostatic balance between oxidants and antioxidants was tipped unfavorably toward the overproduction and/or insufficient elimination of ROS and other oxidants. Oxidative stress promotes the opening of a nonspecific pore in the inner membrane, known as the MPTP, which normally remains closed but can open in response to cellular oxidative stress with dire consequences (Halestrap et al., 2004). The opening of the MPTP leads to mitochondrial dysfunction, increases in the permeability of the membrane, and the releases of a series of molecules that trigger a signaling cascade resulting ultimately in cell apoptosis through the so-called mitochondriadependent pathway (Liu et al., 1995). All of the above-described results indicate that Pb2+-induced bystander effects in the unexposed cells may be regulated indirectly through a ROSdependent mitochondrial pathway. The bystander effects of Pb2+-exposed cells imply that the information exchange between direct contact cells. It has been known that gap junctions, which are channels between adjacent cells, allow for the transport of ions, nutrients, and other substances that enable cells to communicate through direct contact (Vinken et al., 2006; Kojima et al., 2003; Evans and Martin 2002; Lampe and Lau, 2004). Previous studies have certificated that GJIC can spatially extend apoptosis through the communication of cell death signals from apoptotic to healthy cells (Decrock et al., 2009). To further explore the underlying mechanisms and signaling transduction pathways, we used CBX, a blocker of GJIC, to investigate whether the blockage of GJIC also blocks the bystander effects. In our experiment, CBX treatment affected the generation of ROS and the Dcm, as well as the apoptosis rate of the bystander cells. The results demonstrate that functional GJIC may provide a path for the spreading of the bystander effect signals and lead to the initiation of apoptotic events in the neighboring cells and that these effects can be inhibited by gap junction blockage.

Based on our data and that presented in the literature, we speculated that lead initiates the apoptosis of PC12 cells via a ROSdependent mitochondrial pathway that results in increased apoptosis. Functional GJIC among Pb2+-exposed PC12 cells and unexposed PC12 cells in the co-culture system was shown to be mandatory for the transmission of the bystander signals from the injured PC12 cells. The observations presented in this manuscript may have an impact on future clinical interventions treating Pb2+ poisoning. Conflict of interest The authors declare that there are no conflicts of interest. Transparency document The transparency document associated with this article can be found in the online version. Acknowledgments This work was supported by Natural Science Foundation of China (81272180) and National Basic Research Program of China (2012CB518200) References Banerjee, T.D., Middleton, F., Faraone, S.V., 2007. Environmental risk factors for attention-deficit hyperactivity disorder. Acta Paediatr. 96, 1269–1274 [PubMed: 17718779]. Bellinger, D.C., 2008. Very low lead exposures and children's neurodevelopment. Curr. Opin. Pediatr. 20, 172–177 [PubMed: 18332714]. Bertucci, A., Pocock, R.D., Randers-Pehrson, G., Brenner, D.J., 2009. Microbeam irradiation of the C. elegans nematode. J. Radiat. Res. 50 (Suppl A), A49–A54 [PubMed: 19346684]. Canfield, R.L., Henderson Jr., C.R., Cory-Slechta, D.A., Cox, C., Jusko, T.A., Lanphear, B. P., 2003. Intellectual impairment in children with blood lead concentrations below 10 mg per deciliter. N. Engl. J. Med. 348, 1517–1526 [PubMed: 12700371]. Chen, A., Cai, B., Dietrich, K.N., Radcliffe, J., Rogan, W.J., 2007. Lead exposure, IQ, and behavior in urban 5- to 7-year-olds: does lead affect behavior only by lowering IQ? Pediatrics 119, e650–e658 [PubMed: 17332184]. Chen, J., Rogers, S.C., Kavdia, M., 2013. Analysis of kinetics of dihydroethidium fluorescence with superoxide using xanthine oxidase and hypoxanthine assay. Ann. Biomed. Eng. 41, 327–337 [PubMed: 22965641]. Chen, S.D., Yang, D.I., Lin, T.K., Shaw, F.Z., Liou, C.W., Chuang, Y.C., 2011. Roles of oxidative stress, apoptosis, PGC-1a and mitochondrial biogenesis in cerebral ischemia. Int. J. Mol. Sci. 12, 7199–7215 [PubMed: 22072942]. Cogan, N., Baird, D.M., Phillips, R., Crompton, L.A., Caldwell, M.A., Rubio, M.A., Newson, R., Lyng, F., Case, C.P., 2010. DNA damaging bystander signalling from stem cells cancer cells and fibroblasts after Cr(VI) exposure and its dependence on telomerase. Mutat. Res. 683, 1–8 [PubMed: 19800897]. Culver, K.W., Ram, Z., Wallbridge, S., Ishii, H., Oldfield, E.H., Blaese, R.M., 1992. In vivo gene transfer with retroviral vector-producer cells for treatment of experimental brain tumors. Science (Washington DC) 256, 1550–1552 [PubMed: 1317968]. Decrock, E., De Vuyst, E., Vinken, M., Van Moorhem, M., Vranckx, K., Wang, N., Van Laeken, L., De Bock, M., D'Herde, K., Lai, C.P., Rogiers, V., Evans, W.H., Naus, C.C., Leybaert, L., 2009. Connexin 43 hemichannels contribute to the propagation of apoptotic cell death in a rat C6 glioma cell model. Cell Death Differ. 16, 151–163 [PubMed: 18820645]. Evans, W.H., Martin, P.E., 2002. Gap junctions: structure and function (review). Mol. Membr. Biol. 19, 121–136 [PubMed: 12126230]. Fraser, S., Muckle, G., Després, C., 2006. The relationship between lead exposure, motor function and behaviour in Inuit preschool children. Neurotoxicol. Teratol. 28, 18–27 [PubMed: 16337107]. García-Dorado, D., Rodriguez-Sinovas, A., Ruiz-Meana, M., 2004. Gap junctionmediated spread of cell injury and death during myocardial ischemiareperfusion. Cardiovasc. Res. 61, 386–401 [PubMed: 14962471]. Goldberg, G.S., Bechberger, J.F., Naus, C.C., 1995. A pre-loading method of evaluating gap junctional communication by fluorescent dye transfer. Biotechniques 18, 490–497 [PubMed: 7779401]. Halestrap, A.P., Clarke, S.J., Javadov, S.A., 2004. Mitochondrial permeability transition pore opening during myocardial reperfusion a target for cardioprotection. Cardiovasc. Res. 61, 372–385 [PubMed: 14962470]. He, L., Poblenz, A.T., Medrano, C.J., Fox, D.A., 2000. Lead and calcium produce rod photoreceptor cell apoptosis by opening the mitochondrial permeability transition pore. J. Biol. Chem. 275, 12175–12184 [PubMed: 10766853]. He, L., Perkins, G.A., Poblenz, A.T., Harris, J.B., Hung, M., Ellisman, M.H., 2003. Fox D. A. Bcl-xL overexpression blocks bax-mediated mitochondrial contact site

S. Guo et al. / Toxicology Letters 229 (2014) 150–157 formation and apoptosis in rod photoreceptors of lead-exposed mice. Proc. Natl. Acad. Sci. U. S. A. 100, 1022–1027 [PubMed: 12540825]. Higgins, G.C., Beart, P.M., Shin, Y.S., Chen, M.J., Cheung, N.S., Nagley, P., 2010. Oxidative stress: emerging mitochondrial and cellular themes and variations in neuronal injury. J. Alzheimer Dis. 20, 453–473 [PubMed: 20463398]. Karch, J., Kwong, J.Q., Burr, A.R., Sargent, M.A., Elrod, J.W., Peixoto, P.M., Martinez-Caballero, S., Osinska, H., Cheng, E.H., Robbins, J., Kinnally, K.W., Molkentin, J.D., 2013. Bax and Bak function as the outer membrane component of the mitochondrial permeability pore in regulating necrotic cell death in mice. Elife 2, e00772 [PubMed: 23991283]. Kim, K., Annadata, M., Goldstein, G.W., Bressler, J.P., 1997. Induction of c-fos mRNA by lead in PC12 cells. Int. J. Dev. Neurosci. 15, 175–182 [PubMed: 9178036]. Kishikawa, H., Wang, K., Adelstein, S.J., Kassis, A.I., 2006. Inhibitory and stimulatory bystander effects are differentially induced by iodine-125 and iodine-123. Radiat. Res. 165, 688–694 [PubMed: 16802869]. Kojima, T., Yamamoto, T., Murata, M., Chiba, H., Kokai, Y., Sawada, N., 2003. Regulation of the blood-biliary barrier: interaction between gap and tight junctions in hepatocytes. Med. Electron Microsc. 36, 157–164 [PubMed: 14505059]. Koreen, I.V., Elsayed, W.A., Liu, Y.J., Harris, A.L., 2004. Tetracycline-regulated expression enables purification and functional analysis of recombinant connexin channels from mammalian cells. Biochem. J. 383, 111–119 [PubMed: 15242349]. Kul, A.R., Koyuncu, H., 2010. Adsorption of Pb(II) ions from aqueous solution by native and activated bentonite: kinetic, equilibrium and thermodynamic study. J. Hazard. Mater. 179, 332–339 [PubMed: 20356674]. Lampe, P.D., Lau, A.F., 2004. The effects of connexin phosphorylation on gap junctional communication. Int. J. Biochem. Cell Biol. 36, 1171–1186 [PubMed: 15109]. Lanphear, B.P., Hornung, R., Khoury, J., Yolton, K., Baghurst, P., Bellinger, D.C., Canfield, R.L., Dietrich, K.N., Bornschein, R., Greene, T., Rothenberg, S.J., Needleman, H.L., Schnaas, L., Wasserman, G., Graziano, J., Roberts, R., 2005. Low-level environmental lead exposure and children's intellectual function: an international pooled analysis. Environ. Health Perspect. 113, 894–899 [PubMed: 16002379]. Little, J.B., 2006. Cellular radiation effects and the bystander response. Mutat. Res. 597, 113–118 [PubMed: 16413041]. Liu, X.H., Blazsek, I., Comisso, M., Legras, S., Marion, S., Quittet, P., Anjo, A., Wang, G. S., Misset, J.L., 1995. Effects of norcantharidin, a protein phosphatase type-2A inhibitor, on the growth of normal and malignant haemopoietic cells. Eur. J. Cancer 31, 953–963 [PubMed: 7646929]. Loubaki, L., Hadj-Salem, I., Fakhfakh, R., Jacques, E., Plante, S., Boisvert, M., Aoudjit, F., Chakir, J., 2013. Co-culture of human bronchial fibroblasts and CD4 + T cells increases Th17 cytokine signature. PLoS One 8, e81983 [PubMed: 24349168]. Lu, X., Zhang, X., Li, L.Y., Chen, H., 2014. Assessment of metals pollution and health risk in dust from nursery schools in Xi’an, China. Environ. Res. 128, 27–34 [PubMed: 24407476]. Ly, J.D., Grubb, D.R., Lawen, A., 2003. The mitochondrial membrane potential (Dcm) in apoptosis; an update. Apoptosis 8, 115–128. Mothersill, C., Seymour, C., 2001. Radiation-induced bystander effects: past history and future directions. Radiat. Res. 155, 759–767 [PubMed:11352757].

157

Mothersill, C., Seymour, C.B., 2006. Radiation-induced bystander effects and the DNA paradigm: an “out of field” perspective. Mutat. Res. 597, 5–10 [PubMed: 16414088]. Nazarewicz, R.R., Bikineyeva, A., Dikalov, S.I., 2013. Rapid and specific measurements of superoxide using fluorescence spectroscopy. J. Biomol. Screen. 18, 498–503 [PubMed: 23190737]. Nigg, J.T., Knottnerus, G.M., Martel, M.M., Nikolas, M., Cavanagh, K., Karmaus, W., Rappley, M.D., 2008. Low blood lead levels associated with clinically diagnosed attention-deficit disorder/hyperactivity disorder and mediated by weak cognitive control. Biol. Psychiatry 63, 325–331 [PubMed: 17868654]. Pandya, J.D., Nukala, V.N., Sullivan, P.G., 2013. Concentration dependent effect of calcium on brain mitochondrial bioenergetics and oxidative stress parameters. Front. Neuroenergetics 5, 10 [PubMed: 24385963]. Pulido, M.D., Parrish, A.R., 2003. Metal-induced apoptosis: mechanisms. Mutation Research 533, 227–241 [PubMed: 14643423]. Ronchetti, R., van den Hazel, P., Schoeters, G., Hanke, W., Rennezova, Z., Barreto, M., Villa, M.P., 2006. Lead neurotoxicity in children: is prenatal exposure more important than postnatal exposure? Acta Paediatr. Suppl. 95, 45–49 [PubMed: 17000569]. Sairam, R.K., Srivastava, G.C., Agarwal, S., Meena, R.C., 2005. Differences in antioxidant activity in response to salinity stress in tolerant and susceptible wheat genotypes. Biol. Plantarum 49, 85–91. Sedelnikova, O.A., Nakamura, A., Kovalchuk, O., Koturbash, I., Mitchell, S.A., Marino, S.A., Brenner, D.J., Bonner, W.M., 2007. DNA double-strand breaks form in bystander cells after microbeam irradiation of three-dimensional human tissue models. Cancer Res. 67, 4295–4302 [PubMed: 17483342]. Sharifi, A.M., Mousavi, S.H., Bakhshayesh, M., Tehrani, F.K., Mahmoudian, M., Oryan, S., 2005. Study of correlation between lead-induced cytotoxicity and nitric oxide production in PC12 cells. Toxicol. Lett. 160, 43–48 [PubMed: 16039808]. Soleymanifard, S., Bahreyni Toossi, M.T., Sazgarnia, A., Mohebbi, S., 2013. The role of target and bystander cells in dose-response relationship of radiation-induced bystander effects in two cell lines. Iran. J. Basic Med. Sci. 16, 177–183 [PubMed: 24298387]. Tong, L., Yu, K.N., Bao, L., Wu, W., Wang, H., Han, W., 2014. Low concentration of exogenous carbon monoxide protects mammalian cells against proliferation induced by radiation-induced bystander effect. Mutat. Res. 759, 9–15 [PubMed: 24333162]. Vinken, M., Vanhaecke, T., Papeleu, P., Snykers, S., Henkens, T., Rogiers, V., 2006. Connexins and their channels in cell growth and cell death. Cell Signal. 18, 592– 600 [PubMed: 16183253]. Widel, M., Krzywon, A., Gajda, K., Skonieczna, M., Rzeszowska-Wolny, J., 2013. Induction of bystander effects by UVA, UVB, and UVC radiation in human fibroblasts and the implication of reactive oxygen species. Free Radic. Biol. Med. 68, 278–287 [PubMed: 24373962]. Xu, J., Lian, L.J., Wu, C., Wang, X.F., Fu, W.Y., Xu, L.H., 2008. Lead induces oxidative stress, DNA damage and alteration of p53, Bax and Bcl-2 expressions in mice. Food Chem. Toxicol. 46, 1488–1494 [PubMed: 18226849]. Xue, L.Y., Butler, N.J., Makrigiorgos, G.M., Adelstein, S.J., Kassis, A.I., 2002. Bystander effect produced by radiolabeled tumor cells in vivo. Proc. Natl. Acad. Sci. U. S. A. 99, 13765–13770 [PubMed: 12368480]. Yang, J., Liu, X., Bhalla, K., Kim, C.N., Ibrado, A.M., Cai, J., Peng, T.I., Jones, D.P., Wang, X., 1997. Prevention of apoptosis by Bcl-2: release of cytochrome c from mitochondria blocked. Science 275, 1129–1132 [PubMed: 9027314].