Free Radical Biology and Medicine 67 (2014) 221–234

Contents lists available at ScienceDirect

Free Radical Biology and Medicine journal homepage: www.elsevier.com/locate/freeradbiomed

Original Contribution

Caffeine protects neuronal cells against injury caused by hyperoxia in the immature brain Stefanie Endesfelder n, Irina Zaak, Ulrike Weichelt, Christoph Bührer, Thomas Schmitz Department of Neonatology, Charité University Medical Center, D-13353 Berlin, Germany

art ic l e i nf o

a b s t r a c t

Article history: Received 5 April 2013 Received in revised form 3 September 2013 Accepted 27 September 2013 Available online 12 October 2013

Caffeine administered to preterm infants has been shown to reduce rates of cerebral palsy and cognitive delay, compared to placebo. We investigated the neuroprotective potential of caffeine for the developing brain in a neonatal rat model featuring transient systemic hyperoxia. Using 6-day-old rat pups, we found that after 24 and 48 h of 80% oxygen exposure, apoptotic (TUNEL þ ) cell numbers increased in the cortex, hippocampus, and central gray matter, but not in the hippocampus or dentate gyrus. In the dentate gyrus, high oxygen exposure led to a decrease in the number of proliferating (Ki67 þ ) cells and the number of Ki67 þ cells double staining for nestin (immature neurons), doublecortin (progenitors), and NeuN (mature neurons). Absolute numbers of nestin þ , doublecortin þ , and NeuN þ cells also decreased after hyperoxia. This was mirrored in a decline of transcription factors expressed in immature neurons (Pax6, Sox2), progenitors (Tbr2), and mature neurons (Prox1, Tbr1). Administration of a single dose of caffeine (10 mg/kg) before high oxygen exposure almost completely prevented these effects. Our findings suggest that caffeine exerts protection for neonatal neurons exposed to high oxygen, possibly via its antioxidant capacity. & 2013 Elsevier Inc. All rights reserved.

Keywords: Postnatal neurogenesis Hyperoxia Methylxanthine Oxidative stress Preterm infants Developmental brain Free radicals

Preterm infants often suffer from neurologic impairment caused by perturbed development of the immature brain in an unphysiological, ex utero environment. Aims of current research are to design strategies effective for brain protection in these patients. Caffeine has been used as a drug for over 30 years for respiratory stimulation to prevent apnea in preterm infants [1,2]. In a large randomized placebo-controlled multicenter trial [2], a decline in cerebral palsy and neurodevelopmental impairment was achieved by administration of caffeine to preterm infants [3]. The neuroprotective properties of caffeine therapy in preterm infants have been confirmed by observational studies [2–6]. The benefits of caffeine for the brain have also been observed in animal models of Parkinson disease [7], stroke [8,9], Alzheimer disease [10], and oxygen-induced seizures [11]. In newborn rats reared under chronic

Abbreviations: DAPI, 4′,6-diamidino-2-phenylindole; DCX, doublecortin; DG, dentate gyrus; DGM, deep gray matter; FAM, 6-carboxy-fluorescein; GCL, granule cell layer; HPRT, hypoxanthine–guanine phosphoribosyltransferase; NSC, neuronal stem cell; NeuN, neuronal nuclei; 8-oxodG, 8-hydroxy-2′-deoxyguanosine; P, postnatal day; Pax6, paired box 6; PL, polymorphic layer; Prox1, prospero homeobox 1; SOX2, sex-determining region Y-box 2; SGZ, subgranular zone; SVZ, subventricular zone; TAMRA, 6-carboxy-tetramethylrhodamine; Tbr1/2, T-box brain gene 1/2; TUNEL, terminal deoxynucleotidyl transferase dUTP nick-end labeling. n Corresponding author. Fax: þ 49 30 450 559979. E-mail address: [email protected] (S. Endesfelder). 0891-5849/$ - see front matter & 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.freeradbiomed.2013.09.026

hypoxia, caffeine administration was demonstrated to reduce hypomyelination and ventriculomegaly [12]. In humans, the period of fastest brain growth is observed during the last 3 months of a full-term pregnancy. In contrast, this brain growth spurt occurs between postnatal days 2 and 10 in newborn rats and mice [13,14]. Therefore, newborn rodents have been used as an experimental model in studies to investigate the mechanisms of vulnerability in the developing brain. Birth is associated with an approximately three- to fourfold sudden increase in the partial pressure of oxygen in all tissues of the body [15,16], and the immature antioxidative defense system in preterm infants is unable to handle this oxygen surge. As a result, the risk of neurological and cognitive sequelae in neonates rises with further increases in oxygen tension [17–20], such as when infants are rescued with oxygen instead of room air. A fourfold increase in the oxygen concentration in P6 rat and mouse pups for 24 to 48 h has been shown to induce apoptosis in neurons and in immature oligodendroglia [21–24], whereas mature oligodendrocytes seem to be more resistant to oxygen toxicity [25]. Two mechanisms are thought to be responsible for hyperoxia-induced injury in the immature brain: the oxidative stress response [26,27], which involves the production of reactive oxygen species, and changes in gene expression and phosphorylation of proteins that control neural cell survival during development [22,28]. Therefore, the postnatal brain and organs of immature preterm infants are vulnerable to oxygen toxicity and the consequences can be severe [20].

222

S. Endesfelder et al. / Free Radical Biology and Medicine 67 (2014) 221–234

Postnatal neurogenesis in mammals, whose sequence follows the order in the adult dentate gyrus (DG) [29,30], persists in the subgranular zone (SGZ) of the DG in the hippocampus and in the subventricular zone (SVZ) of the lateral ventricles [31–33]. Newly generated granule cell layer (GCL) neurons are integrated into the DG, a process that is tightly regulated and seems to be susceptible to perturbation by environmental factors (reviewed by [34]). Neuronal progenitor cells in the SGZ and SVZ divide slowly and are maintained in adults. Postnatal neuronal progenitor cells differentiate into precursors and give rise to more differentiated neuroblasts [31,33]. Neuroblasts in the hippocampal SGZ migrate into the GCL of the DG, differentiate, and integrate into previously established neuronal networks, where they are thought to play a role in certain forms of hippocampal-dependent learning and memory [35,36]. These neuronal differentiation stages are characterized by the expression of specific neuronal markers and relevant transcription factors [36–38]; see Fig. 1. Although caffeine is currently one of the 10 most used drugs in neonatology, its effect on the immature brain is largely underinvestigated. The results of our study in rats showed that a single dose of caffeine was efficient to protect neurons in the brain against injury caused by oxygen toxicity, highlighting caffeine as a promising drug for neuroprotection in preterm infants.

Materials and methods Animals and drug administration Six-day-old (P6) Wistar rats from timed-pregnant dams (Charité-Universitätsmedizin, Berlin, Germany) were divided into four biological groups: (1) normoxia (FiO2 21%, room air) and 0.9% NaCl solution intraperitoneally (ip), (2) normoxia and caffeine (10 mg/kg body wt, ip; Sigma–Aldrich, Steinheim, Germany), (3) hyperoxia (FiO2 80%; OxyCycler BioSpherix, Lacona, NY, USA) and 0.9% NaCl solution (ip), and (4) hyperoxia and caffeine (10 mg/kg body wt, ip; Sigma–Aldrich). Pups were treated once with either saline or caffeine at the beginning of normoxia or hyperoxia exposure lasting for 24 h (P7) or 48 h (P8). The animals were weighed before the caffeine or vehicle administration at the beginning of the experiment, and the caffeine and vehicle dosages were adjusted according to the body weight measurements. For both conditions, pups were kept with their dam, and for the 48-h pups, nursing dams were switched every 24 h between the normoxic and the hyperoxic chambers to provide equal nutrition to each litter. All procedures were approved by the state animal welfare authorities (LAGeSo G-0307/09) and followed institutional guidelines.

Tissue preparation At 24 and 48 h of oxygen exposure, depending on condition, pups were anesthetized with an ip injection of ketamine (50 mg/kg) and xylazine (10 mg/kg). Pups were perfused with normal saline (pH 7.4) for molecular analysis and with 4% paraformaldehyde at pH 7.4 for immunohistochemical analysis. After decapitation, the olfactory bulb and cerebellum were removed. For molecular studies, brain hemispheres were snap-frozen in liquid nitrogen and stored at 80 1C until further analysis. For immunohistochemical studies, brains were postfixed at 4 1C for 3 days, embedded in paraffin, and processed for histological staining. RNA extraction and real-time PCR Total RNA was isolated by acidic phenol/chloroform extraction (peqGOLD RNApure; PEQLAB Biotechnologie, Erlangen, Germany), and 2 mg of RNA was reverse transcribed. The PCR products of Pax6, SOX2, Tbr2, Prox1, Tbr1, and HPRT were quantified in real time, using dye-labeled fluorogenic reporter oligonucleotide probes with the sequences summarized in Table 1. The probes were labeled at the 5′ end with the reporter dye 6-carboxy-fluorescein (FAM) and at the 3′ end with the quencher dye 6-carboxy-tetramethylrhodamine (TAMRA). The FAM spectral data were collected from reactions carried out in separate tubes using the same stock of cDNA to avoid spectral overlap between FAM/TAMRA and limitations of reagents. PCR and detection were performed in triplicate and repeated two times for each sample in 11 ml reaction mix, which contained 5 ml of 2  KAPA PROBE FAST qPCR Mastermix (PEQLAB Biotechnologie), 2.5 ml of 1.25 mM oligonucleotide mix, 0.5 ml (0.5 mM) of probe (BioTeZ, Berlin, Germany), and 3 to 17 ng of cDNA template with HPRT used as an internal reference. The PCR amplification was performed in 96-well optical reaction plates for 40 cycles with each cycle at 94 1C for 15 s and 60 1C for 1 min. The expression of target genes was analyzed with the StepOnePlus real-time PCR system (Applied BiosysΔΔ tems, Life Technologies, Carlsbad, CA, USA) according to the 2  CT method [39]. Immunoblotting Snap-frozen brain tissues were homogenized in radioimmunoprecipitation assay buffer (Sigma–Aldrich) with complete Mini EDTA-free Protease Inhibitor Cocktail Tablets (Roche Diagnostics, Mannheim, Germany). The homogenate was centrifuged at 3000g (4 1C) for 10 min, and the microsomal fraction was subsequently centrifuged at 17,000g (4 1C) for 20 min. After collecting the supernatant, protein concentrations were determined using the

Fig. 1. Maturation of neuronal progenitors in the postnatal hippocampus. Shown are the stages of neurogenesis with expression patterns of selective markers relevant for neural lineage cell development (modified from [36,56,57]). Presented are only transcription factors and neuronal markers relevant for neural lineage cell development: Pax6, paired box 6; SOX2, sex-determining region Y-box2; Tbr1/2, T-box brain gene 1/2; DCX, doublecortin; and Prox1, prospero homeobox 1.

S. Endesfelder et al. / Free Radical Biology and Medicine 67 (2014) 221–234

Table 1 Oligonucleotides and loci. cDNA Pax6 Forward Reverse Probe SOX2 Forward Reverse Probe Tbr2 Forward Reverse Probe Prox1 Forward Reverse Probe Tbr1 Forward Reverse Probe HPRT Forward Reverse Probe

Oligonucleotide sequence 5′–3′

Accession No.

TCCCTATCAGCAGCAGTTTCAGT GTCTGTGCGGCCCAACAT CTCCTCCTTTACATCGGGTT

NM_013001.2

ACAGATGCAGCCGATGCA GGTGCCCTGCTGCGAGTA CAGTACAACTCCATGACCAG

NM_001109181

ACGCAGATGATAGTGTTGCAGTCT ATTCAAGTCCTCCACACCATCCT CACAAATACCAACCTCGACT

XM_001061749.2

TGCCTTTTCCAGGAGCAACTAT CCGCTGGCTTGGAAACTG ACATGAACAAAAACGGTGGC

NM_001107201

TCCCAATCACTGGAGGTTTCA GGATGCATATAGACCCGGTTTC AAATGGGTTCCTTGTGGCAA

NM_0011911070

GGAAAGAACGTCTTGATTGTTGAA CCAACACTTCGAGAGGTCCTTTT CTTTCCTTGGTCAAGCAGTACAGCCCC

NM_012583.2

Pax6, paired box 6; SOX2, sex-determining region Y-box 2; Tbr1/2, T-box brain gene 1/2; Prox1, prospero homeobox 1; HPRT, hypoxanthine–guanine phosphoribosyl transferase.

Bicinchoninic Acid Protein Assay kit (Pierce/Thermo Scientific, Rockford, IL, USA). Aliquots of protein extracts (20 mg per 10 ml final loading volume for each sample) were denatured in Laemmli sample loading buffer (Bio-Rad, Munich, Germany) at 95 1C for 5 min, cooled on ice, separated electrophoretically on 12% MiniPROTEAN TGX precast gels (Bio-Rad), and transferred onto nitrocellulose membrane (0.2 mm pore; Bio-Rad) using a semidry electrotransfer unit at 15 V for 45 min. Equal loading and transfer of proteins was confirmed by staining the membranes with Ponceau S solution (Fluka, Buchs, Switzerland). Nonspecific protein binding was prevented by blocking the membrane with 5% bovine serum albumin in Tris-buffered saline/0.1% Tween 20 for 1 h at room temperature. The membranes were incubated overnight at 4 1C with the following antibodies: rabbit polyclonal antidoublecortin (DCX; 45 kDa; 1:2000; US Biological, Swampscott, MA, USA), rabbit monoclonal anti-calretinin (29 kDa; 1:1000; Abcam, Cambridge, UK), mouse monoclonal anti-β-actin (42 kDa; 1:10,000; Sigma–Aldrich), or rabbit anti-α-actinin (100 kDa; 1:1.000; Cell Signaling, Danvers, MA, USA), respectively. Secondary incubations were performed with horseradish peroxidase-linked polyclonal donkey anti-rabbit (1:10,000; Dianova, Hamburg, Germany) or polyclonal rabbit anti-mouse (1:1000; DAKO, Glostrup; Denmark) antibodies. Positive signals were visualized using enhanced chemiluminescence (Amersham Biosciences, Freiburg, Germany) and quantified using a ChemiDoc XRSþ system and the software Image Lab (Bio-Rad). To ensure the equal loading and accuracy of changes in protein abundance, the protein levels of calretinin were normalized to β-actin and DCX normalized to α-actinin. Each experiment was repeated three times. Immunohistochemistry Tissue fixation Paraffin-embedded brain tissues were cut in 5-mm sections and mounted onto Super Frost Plus-coated slides (Menzel, Braunschweig, Germany). Each section was deparaffinized in Roti-Histol (Carl Roth, Karlsruhe, Germany) twice for 10 min each and then

223

rehydrated in ethanol (100, 90, 80, and 70%), distilled water, and phosphate-buffered saline (PBS) for 3 min each at room temperature. Immunostaining of neuronal and proliferation markers Sections were fixed in citrate buffer (pH 6.0) at 600 W for 12 min in a microwave oven to increase cell membrane permeability and, thus, demask intracellular epitopes. Afterward, the sections were cooled and washed three times in PBS. The slices were blocked with blocking buffer I (10% goat serum, 1% bovine serum albumin (BSA), and 0.3% Triton X-100 in PBS for nestin and NeuN) or blocking buffer II (3% donkey serum and 0.1% Triton X-100 in PBS for DCX) for 2 h at room temperature. Sections were washed once with PBS and subsequently incubated overnight at 4 1C with either monoclonal mouse anti-rat nestin (1:200; Millipore, Darmstadt, Germany) or monoclonal mouse anti-rat NeuN (1:200; Millipore) diluted in carrier solution I (1% goat serum, 1% BSA, and 0.3% Triton X-100 in PBS) or with polyclonal goat anti-rat DCX (1:100; Santa Cruz Biotechnology, Heidelberg, Germany) diluted in carrier solution II (1% donkey serum and 0.1% Triton X-100 in PBS). Slices were washed three times in PBS. The secondary fluorescein-conjugated goat anti-mouse IgG (Dianova) or fluorescein-conjugated donkey anti-goat IgG (Dianova) was applied at a dilution of 1:200 with the respective carrier solution of the first antibody and incubated at room temperature in the dark for 4 h. For double staining with the proliferation marker Ki67, the sections were washed once with PBS and incubated with blocking buffer I for 60 min in the dark. After being washed with PBS, sections were incubated with rabbit anti-rat Ki67 (1:200; Abcam) in carrier solution I overnight at 4 1C. The secondary labeling with tetramethylrhodamine isothiocyanate-conjugated goat anti-rabbit IgG (Dianova) was incubated for 90 min in the dark. After three washes with PBS, slides were counterstained and mounted with aqueous 4′,6-diamidino-2-phenylindole (DAPI)containing fluorescence-protecting mounting medium (Vectashield HardSet mounting medium with DAPI; Vector Laboratories, Burlingame, CA, USA). Sections of the DG were viewed blinded under fluorescent light using a Leica DM 2000 microscope equipped with 200  magnification and analyzed employing Leica Application Suite-LAS software (Leica Microsystems, Wetzlar, Germany). Double-labeled images for nestin, DCX, and NeuN/DAPI double-labeled cells and triple-labeled images in combination with Ki67 within the GCL (dentate gyrus) and the polymorphic layer (PL; hilus) were counted in four separate sections per animal. We analyzed doubleand triple-labeled cell numbers using ImageJ (National Institutes of Health, Bethesda, MD, USA). Immunostaining of an oxidative stress marker 8-Hydroxy-2′-deoxyguanosine (8-oxodG) is a commonly used marker for oxidative stress-derived DNA damage [40]. Deparaffinized sections were immunostained with an anti-8-oxodG monoclonal antibody (clone 2E2; Trevigen, Gaithersburg, MD, USA) according to the manufacturer's protocol. The secondary fluorescein-conjugated goat anti-mouse IgG (Dianova) was applied at a dilution of 1:200 in 0.1% BSA in PBS and incubated in the dark at room temperature for 60 min. After being washed four times with PBS, the slides were counterstained and mounted with Vectashield HardSet Mounting Medium with DAPI (Vector Laboratories). Sections with the retrosplenial cortices, frontal cortices, parietal cortices, and DG were viewed blinded under fluorescent light using a Leica DM 2000 microscope equipped with 400  or 200  (for representative microphotographs) and 200  (for quantitation) magnification and analyzed employing Leica Application Suite-LAS software. 8-oxodG-positive cells (200  magnification) in the cortices were counted in 10 separate fields

224

S. Endesfelder et al. / Free Radical Biology and Medicine 67 (2014) 221–234

per animal in four different sections and, in the area of DG, in four separate sections per animal. We analyzed cell numbers using ImageJ by creating a set threshold for particle size. DNA fragmentation assay After deparaffinization of sections, in situ detection of cells with DNA-strand breaks was performed using the TUNEL labeling method using a TdT-FragEL DNA fragmentation detection kit (Millipore) according to the manufacturer's instructions. Negative controls were performed by substituting Tris-buffered saline for the TdT enzyme. Sections with TUNEL-positive cells in the retrosplenial cortices, frontal cortices, parietal cortices, dentate gyrus (GCL), hilus (PL), thalamus, and hypothalamus were viewed by light microscopy while blinded using a Leica DM 2000 microscope equipped with 200  magnification. TUNEL-positive cells were counted in the anatomical regions of the brain in four different sections per animal. Statistical analyses All data are expressed as the mean 7standard error of the mean. Groups were compared using a one-way analysis of variance (ANOVA), and significance was determined using Bonferroni's correction for multiple comparisons with independent sample t test. A two-sided p value of o0.05 was considered significant. All graphics and statistical analyses were performed using the GraphPad Prism 5.0 software.

Results Neuronal differentiation and proliferation Caffeine protects neuronal cells of various developmental stages against hyperoxia-induced toxicity To define toxicity of hyperoxia on neuronal lineage cells in the immature brain, we determined the number of cells expressing nestin, as a marker for neuronal progenitor cells; DCX, for immature neurons; or NeuN, for mature neurons in the DG of P7 rats exposed to 24 h hyperoxia (from P6 to P7). Based on fluorescent immunostaining, cell numbers in the DG were significantly reduced by hyperoxia for all three neuronal markers analyzed (Fig. 2). In contrast, in animals receiving a single dose of caffeine (10 mg/kg) at the beginning of hyperoxia exposure, neuronal numbers were preserved in the range of control litters in room air (Fig. 2). The protective effect was seen in all neuronal lineage stages analyzed (Figs. 2 and 3). To investigate whether the single dose of caffeine would also provide protection against an enhanced duration of hyperoxia, we performed 48 h hyperoxia in rats from P6 to P8. Notably, the one-dose administration of caffeine led to a similar improvement in neuronal cell numbers in the tissue of those animals exposed to 48 h hyperoxia (Fig. 3). These results point out an efficient protection of neuronal lineage cells by caffeine in our injury model. In normoxic animals, caffeine treatment caused a significant decrease in neuronal cell numbers, mainly in the polymorphic layer after 48 h hyperoxia, and showed side effects for caffeine without an additional insult

Fig. 2. Hyperoxia in newborn rats decreased the number of nestin þ , DCX þ , and NeuN þ cells in the DG: benefit of caffeine treatment. In immunostaining of the postnatal dentate gyrus, hyperoxia decreased the numbers of nestin þ neuronal progenitors, DCX þ immature neurons, and NeuN þ mature neurons. Caffeine prevented the hyperoxiainduced damage. Caffeine treatment under room air showed no relevant regulation. Shown are representative immunostaining images of (A) nestin, (B) DCX, and (C) NeuN in the DG of P7 control pups in room air without (A1, B1, C1) and with caffeine administration (A2, B2, C2) and after 24 h hyperoxia from P6 to P7 without (A3, B3, C3) and with caffeine administration (A4, B4, C4). All images were taken at identical magnification. Scale bar, 100 μm.

S. Endesfelder et al. / Free Radical Biology and Medicine 67 (2014) 221–234

(Fig. 3). There were no significant differences in the total number of cells (DAPI-positive cells, data not shown) found in the DG.

Caffeine improves proliferation capacity of neuronal cells in rats exposed to hyperoxia The high proliferation capacity of neural cells is described as a feature of the immature brain that is critical for physiological development, and toxic stimuli often cause injury by perturbing cellular proliferation (reviewed by [41]). To investigate whether hyperoxia inhibits proliferation in neuronal cells and whether benefits of caffeine also extend to improved proliferation of neuronal cells under hyperoxia, we analyzed cells positive for Ki67 immunostaining colabeled for nestin, DCX, or NeuN in both the GCL and the hilus (PL). As a result, after 24 h hyperoxia from P6 to P7, the number of Ki67-positive cells was decreased in both the GCL and the PL for all three neuronal subpopulations labeled (Figs. 4 and 5). However, animals receiving treatment with caffeine before hyperoxia had significant improvement in proliferation of all neuronal cell types, both after 24 h (Figs. 4 and 5) and after 48 h hyperoxia (Fig. 5). Caffeine treatment under normoxic exposure showed inhibitory side

225

effects, mainly for the proliferation capacity of nestin þ neuronal progenitors in both the GCL and the PL at P7 and P8 (Fig. 5). Neuronal damage caused by neonatal hyperoxia was also detected in Western blot analysis of DCX and calretinin proteins as markers of immature and mature neurons, respectively. In comparison to control litters kept in room air, DCX level significantly decreased at 24 h (Fig. 6 A), whereas calretinin levels decreased significantly at both 24 and 48 h (Fig. 6B) after hyperoxia exposure. Again, administration of caffeine prevented hyperoxia-induced neuronal injury; caffeine significantly increased DCX protein expression after both 24 and 48 h (Fig. 6 A). The protection by caffeine was also found for calretinin protein expression after hyperoxia at 24 and 48 h. Interestingly, caffeine treatment under room air resulted in a significant increase in calretinin protein expression at 24 h (Fig. 6B). Hyperoxia decreases and caffeine increases mRNA expression of neuronal transcription factors The transcription factor Pax6 is expressed in the proliferating zones of the developing rodent brain. Pax6 is a transcription factor of radial glial progenitors that promotes the expression of Tbr2 in neuronal lineage cells, starting with SOX2 at immature stages and

Fig. 3. Changes in neuronal cell numbers in P7/P8 rats after hyperoxia with and without caffeine. Hyperoxia reduced the number of nestin þ , DCX þ , and NeuN þ cells in the postnatal dentate gyrus and hilus, and caffeine reversed this effect. Quantitation of (A) nestin þ , (B) DCX þ , and (C) NeuN þ cells in the (1) granular cell layer and (2) polymorphic layer showed that relative to the control (normoxia, white bars), hyperoxia at 24 and 48 h significantly decreased the number of these cells (black bars). The decreases were attenuated by systemic caffeine pretreatment (dark gray bars). Caffeine treatment under room air diminished neuronal cell numbers mainly at 48 h in the postnatal hilus (light gray bars). Data are expressed as total number of cells in the granular layer or polymorphic layer. Error bars represent SEM, n¼ 4/group. np o0.05, nn p o 0.01, and nnnp o 0.001 vs normoxia; ##p o0.01 and ###p o 0.001 vs hyperoxia (Bonferroni post hoc test after one-way ANOVA).

226

S. Endesfelder et al. / Free Radical Biology and Medicine 67 (2014) 221–234

Fig. 4. Hyperoxia in newborn rats reduced the proliferation capacity of neuronal cells in the postnatal DG: caffeine improved the proliferation capacity. Hyperoxia in newborn rats reduced the numbers of Ki67 þ neuronal progenitors, immature neurons, and mature neurons (labeled by nestin, DCX, and NeuN, respectively) in the postnatal dentate gyrus. Caffeine abolished the hyperoxia-induced damage. Normoxia and caffeine treatment showed no relevant changes. Representative microphotographs show double immunostaining of (A) nestin/Ki67, (B) DCX/Ki67, and (C) NeuN/Ki67 in the DG of P7 pups under control conditions (A1, B1, C1) without and (A2, B2, C2) with caffeine administration and after 24 h hyperoxia from P6 to P7 (A3, B3, C3) without and (A4, B4, C4) with caffeine administration. All micrographs were taken at identical magnification. Scale bar, 100 μm.

Tbr1 and Prox1 after further maturation. Neuronal progenitor cell proliferation and their optimum numbers are indispensable for neurogenesis, which is determined by cell cycle length and cell cycle quitting rate of the dividing progenitors. Therefore, we used real-time PCR to determine the differential mRNA expression of these neuronal transcription factors. Hyperoxia caused a marked downregulation of all analyzed transcription factors after 48 h exposure (from P6 to P8) and of some of the genes after a shorter duration of 24 h (P6 to P7) (Fig. 7). Hyperoxia caused a significant decrease in Pax6 expression at 48 h (Fig. 7A), a significant decrease in SOX2 expression at 24 and 48 h (Fig. 7B), a significant decrease in Tbr2 expression at 24 and 48 h (Fig. 7C), a significant decrease in Prox1 expression at 24 and 48 h (Fig. 7D), and a significant decrease in Tbr1 at 48 h (Fig. 7E). Caffeine treatment effectively eliminated any hyperoxiamediated decrease in transcription factor mRNA expression. Treatment of pups with a single dose of caffeine (10 mg/kg) before hyperoxic exposure significantly increased mRNA expression of Pax6, SOX2, Tbr2, Prox1, and Tbr1 at 24 and/or 48 h (Fig. 7), compared with hyperoxic pups. Surprisingly, in both hyperoxic and normoxic animals, caffeine treatment caused a strong decrease in Tbr2 expression at 48 h (Fig. 7C). Caffeine and hyperoxia alone or in combination had no effect on the mRNA expression of Pax6 and Tbr1 at 24 h (Figs. 7 A and 7E).

Oxidative DNA damage and apoptotic cell death It is well known that triggers of oxidative stress and apoptosis play a crucial role in the injury of immature neural cells. We analyzed changes in oxidative stress by fluorescent labeling with 8-oxodG, a DNA injury product that results from oxidation damage, and apoptotic cell death was determined by TUNEL assay. All of these analyses were performed in the cortex (retrosplenial, frontal, and parietal), in the hippocampus (dentate gyrus and hilus), and in deep gray matter regions (thalamus and hypothalamus). In detail, exposure to 24 and 48 h hyperoxia from P6 to P7 and P8 resulted in a large increase in 8-oxodG-labeled cells in the cortical and hippocampal regions, in comparison to normoxia animals (Figs. 8 and 9). In the deep gray matter (DGM), no increased oxidative stress was detected after hyperoxia in our analysis. Interestingly, a single systemic administration of caffeine at the beginning of the hyperoxia exposure significantly reduced the counts of 8-oxodG fluorescently labeled cells (Figs. 8 and 9). Caffeine under normoxic conditions showed significant decreases in both the cortices and the hippocampus (Fig. 9). Our analysis of TUNEL assays in rat brain tissue indicated increased apoptosis after hyperoxia exposure (Fig. 10). Compared to normoxia litters, 24 and 48 h hyperoxia increased TUNEL þ cells in the cortex and deep gray matter (Fig. 10). The antiapoptotic property of caffeine was demonstrated by blocking this increase after either 24 or 48 h of

S. Endesfelder et al. / Free Radical Biology and Medicine 67 (2014) 221–234

227

Fig. 5. Neuronal proliferation in the DG is diminished by hyperoxia and improved by caffeine. Hyperoxia in P6 rat pups diminished the proliferation capacity of nestin þ , DCX þ , and NeuN þ cells in the postnatal dentate gyrus and hilus, and caffeine significantly attenuated this effect. Quantitation of cells positive for neuronal markers (A) nestin þ , (B) DCX þ , and (C) NeuN þ double-labeled for Ki67 in the (1) granular cell layer and (2) polymorphic layer revealed that caffeine enhanced neuronal cell proliferation under hyperoxia both for 24 and for 48 h (dark gray bars) in comparison to hyperoxia alone (black bars). Caffeine under normoxic conditions decreased the proliferation capacity primarily of nestin þ cells (light gray bars). Data are expressed as total number of cells in the granular layer or polymorphic layer. Error bars represent SEM, n¼ 4/group. np o0.05, nnp o 0.01, and nnnp o0.001 vs normoxia; #p o 0.05, ##p o 0.01, and ###po 0.001 vs hyperoxia (Bonferroni post hoc test after one-way ANOVA).

hyperoxia (Fig. 10). There was no increase in the dentate gyrus under hyperoxic conditions, but a decrease in apoptotic cells at 24 h with caffeine after normoxia and hyperoxia, respectively (Fig. 10).

Discussion Neuronal differentiation and proliferation The results of our studies demonstrate that acute hyperoxia is sufficient to affect neurogenesis and neurodegeneration in the developing brain. Dysregulation of neuronal maturation markers and transcription factors, as well as cell death and DNA damage in hyperoxic injury, can be significantly reduced by systemic administration of a low dose of caffeine. In this study of newborn rats, we point out that acute hyperoxia at P6 decreased neurogenesis, interfered with neuronal differentiation and maturation in the DG, and increased oxidative DNA damage and neural cell death in the immature brain. Our data suggest that hyperoxia exposure affects specific differentiation

stages within the DG region of the hippocampus. We found that high oxygen not only diminished proliferation of neural progenitors but also affected maturation of neurons in the GCL and PL regions of the hippocampus. Our findings show that hyperoxia exposure during the early stages of life causes a reduction in the number of proliferating, Ki67-positive, cells in the postnatal rat hippocampus compared with controls. During development, proliferating cells in the PL migrate toward the GCL, differentiate terminally within the GCL, and get integrated into the circuits [42,43]. In our experiments, reduction of Ki67-positive cells was restricted to the DG and did not occur in the molecular layer surrounding the DG, which might point to a decrease in mainly neuronal stem cells in the DG, representing the major source of neuronal precursors. Age-related studies in rat models have implied an increase in quiescent stages of neuronal stem cells as an underlying cause rather than a higher loss of neural stem cells in the SGZ of the DG [44,45]. Kaindl et al. [28,46] documented changes in the expression of cell cycle regulatory proteins after hyperoxia. Oxidative stress and DNA damage have been associated with activation of p53 and, thereby,

228

S. Endesfelder et al. / Free Radical Biology and Medicine 67 (2014) 221–234

Fig. 6. Changes in protein expression of neuronal markers in P7/P8 rats after hyperoxia with and without caffeine. Hyperoxia reduced the expression of neuronal markers DCX and calretinin in the rat brain, and caffeine abolished this effect. Representative Western blot bands and quantitation of (A) DCX and (B) calretinin expression using lysates from the rat brain show significant decreases after 24 and/or 48 h hyperoxia (black bars) compared to controls in room air (white bars). Marker levels were significantly elevated through systemic caffeine pretreatment (dark gray bars). Notably, after 48 h hyperoxia, expression of DCX and calretinin is even higher than in control animals and caffeine administration in room air resulted in an upregulation of calretinin at P7 (light gray bars). α-Actinin and β-actin were used as internal standards for DCX and calretinin, respectively. Error bars represent SEM, n¼6/group. np o 0.05, nnp o 0.01, and nnnpo 0.001 vs normoxia; #po 0.05, ##po 0.01, and ###p o0.001 vs hyperoxia (Bonferroni post hoc test after one-way ANOVA).

with induction of the transcription factor p21, which in the end signals quiescence in neuronal stem cells [47,48]. Our investigations, moreover, demonstrate that hyperoxia affects differentiation of proliferating cells into mature neurons. The numbers of nestin/Ki67-, DCX/Ki67-, and NeuN/Ki67-colabeled and neuronal marker monolabeled cells were significantly decreased, suggesting that hyperoxia reduces the number of early mitotic and intermediate neuronal progenitors and their transition into mature neurons. Nestin is mainly expressed in neural progenitor cells and seems to be restricted to areas of regeneration in adult tissues [49]. Controversially, Kaindl et al. [46] observed an increase in nestin protein levels after hyperoxia. However, a loss of neural stem cells may certainly lead to a reduced expression of genes for neural stem cell markers [50]. Furthermore, we were able to demonstrate a reduction in immature mitotic DCX-positive cells and mature NeuN-positive cells, and also in DCX- and calretinin-protein levels,

after acute exposure to oxygen. This adds to results by Kaindl et al. [46] displaying a diminished protein expression level of DCX in P7 rat pups after 12 h hyperoxia. Because DCX is a microtubulestabilizing protein expressed in migrating and differentiating progenitor cells during the development of granule cells in the hippocampus [51,52], a loss of DCX levels after hyperoxia may impair neuronal cell migration [53,54] and/or cell differentiation, hence, causing the observed delay in NeuN and calretinin expression. Specific expression patterns of proneural and neural factors such as Pax6, SOX2, Prox1, Tbr1, and Tbr2 have been shown to regulate and define postnatal neurogenesis [36,55–57]. In our study of the immature brain, all these transcription factors were significantly downregulated after 24 and/or 48 h hyperoxia. Pax6 is expressed in nestin-positive cells [58,59] and plays an important role in the regulation of cell proliferation and neuronal cell determination [37,60]. A member of the Sox (SRY-related HMG box) transcription factor family, SOX2, a key regulator of neuronal stem cells, is highly expressed in both SVZ and SGZ neural stem cells but not in their neuronal progeny [61,62]. SOX2 gene products bind to numerous genomic targets, including its own promoter, which is characteristic of the cell-regulatory circuitry for selfrenewing stem cells [61,63]. Tbr2 is a critical regulator of granule cell fate and indispensable for the majority of neurogenesis throughout DG development. Its expression is required for the production of intermediate neural progenitors, and loss of Tbr2 profoundly impacts the NSC pool. Tbr2 binds to SOX2 directly, suggesting that Tbr2 may influence the progression to intermediate neurons by interacting with other key transcription factors [64,65]. The homeobox gene Prox1, a transcription factor expressed downstream of Tbr2 in the dentate lineage, is expressed in DG throughout all postnatal stages of development [66,67]. In the absence of Prox1, mutant granule cells express some neuronal markers but fail to differentiate and undergo apoptosis [68]. Englund et al. [37] stressed that during the sequential expression of Pax6, Tbr2, and Tbr1, each transcription factor regulates discrete steps in projected neuron differentiation, and a loss of Tbr1 causes defects in layer-specific differentiation [69]. An interesting result in our study is the drastic decrease in Tbr2 with caffeine under normoxic and hyperoxic exposures. Critical extrinsic and intrinsic factors, e.g., neurotrophins and transcription factors, in the SGZ influence the survival, dendritic arborization, and synaptic plasticity and integration of newborn neurons [55,70–74]. The specific roles of Tbr2 in the SGZ are currently unknown. Dysregulated neurogenesis is also associated with disorders such as Alzheimer disease [33,75] and is also accompanied by cognitive and motor deficits [76]. Neurogenesis consists of a balance between neuronal progenitor cell proliferation, survival, and migration and their differentiation to mature neurons [33,77]. Importantly, a change in oxygen tension seems to be one of the most crucial environmental cues for regulation of proliferation and differentiation of NSC [78]. Our data on hyperoxia in the immature brain complement these insights by indicating that high oxygen in the immature brain can impair genesis and maturation of neurons. Neurodegeneration and oxidative DNA damage Yis et al. [79] reported that Wistar rats exposed from birth until their fifth day of life to an oxygen concentration of 80% had a significant loss in neurons of the DG compared to normoxic animals. In the present study, P6 Wistar rats were kept for a period of 24 or 48 h in 80% oxygen, and there were no significant differences in the total numbers of DAPI-positive cells found in the DG. A short-term exposure to oxygen thus seems not to be sufficient to significantly affect the number of total cells. However,

S. Endesfelder et al. / Free Radical Biology and Medicine 67 (2014) 221–234

229

Fig. 7. Caffeine prevents hyperoxia-induced downregulation of neuronal transcription factors. Altered mRNA levels of (A) Pax6, (B) SOX2, (C) Tbr2, (D) Prox1, and (E) Tbr1 as measured by real-time PCR in P7 and P8 total rat brain extracts after 24 and 48 h of hyperoxia, respectively (black bars), in comparison to control litters (white bars). Transcription factor expression was also affected by systemic caffeine pretreatment (dark gray bars). Caffeine administration under normoxic conditions resulted primarily in a strong downregulation of Tbr2 (light gray bars). Error bars represent SEM, n¼ 6/group. np o 0.05, nnp o 0.01, and nnnp o 0.001 vs normoxia; #po 0.05, ##p o 0.01, and ### p o 0.001 vs hyperoxia (Bonferroni post hoc test after one-way ANOVA).

in our acute hyperoxic injury model, there was a twofold increase in apoptotic cell death after 24 and 48 h, mainly in the cortex and DGM, which corresponds to previous findings in this model [22]. In the immature brain, oxidative stress exerted by high oxygen concentrations leads to neural cell death [22,26,80]. In our study, increases in TUNEL-positive cells by hyperoxia were detectable in various regions of the brain including cortex and the deep gray matter, but not in cells of the DG. This corresponds to results of the experiments by Taglialatela et al. documenting increased oxidative stress in neurons of the DG without induction of apoptosis [81]. In other studies, much longer exposure to time and higher levels of hyperoxia (i.e., 100% O2) were finally effective at inducing apoptosis in DG cells, too [79]. However, our results point toward decrease in proliferation and delay of maturation as mechanisms for DG injury in response to hyperoxia rather than apoptotic cell death. In our experiments, hyperoxia was accompanied by a fourfold and threefold increased rate of 8-oxodG-positive cells of the DG at 24 and 48 h hyperoxia, respectively. 8-oxodG formation is commonly used as a marker of oxidative stress-derived DNA damage and is influenced by local antioxidant capacity and DNA repair

enzyme activity [82]. Solberg et al. [83] found a dose-dependent oxidative stress marker detection after exposure to 40, 60, and 100% oxygen. Caffeine We examined the protective effects of a single low-dose caffeine administration on postnatal hippocampal neurogenesis and neurodegeneration in the hyperoxia injury model. Treatment with caffeine at the beginning of hyperoxia blocked the downregulation of neuronal marker expression and reduced neuronal cell death and DNA-damage caused by hyperoxia. The observed beneficial effects could be based on the antioxidant properties being ascribed to both caffeine and its metabolites [84] and/or the competition between caffeine and adenosine at A1 and A2A receptors [85,86]. The pharmacological effects of caffeine are well described [87,88], including complex behavioral and biochemical effects in the brain that are likely to influence neurogenesis [89,90]. However, the mechanisms by which it acts on cell proliferation, differentiation, and specifically cell death are less clear [91–96]. Caffeine is a nonspecific adenosine receptor antagonist [95,97], and modulation of cell proliferation by caffeine has been

230

S. Endesfelder et al. / Free Radical Biology and Medicine 67 (2014) 221–234

Fig. 8. Oxidative stress in the cortex and the hippocampus of hyperoxia-exposed rats. Exposure of rat pups to hyperoxia increased fluorescent labeling of the oxidative stress marker 8-oxodG in the cortex (A) to P7 and (B) to P8 and in the hippocampus (C) to P7 and (D) to P8. Caffeine prevented this increase in both brain regions (A–D). 8-oxodGlabeled cells are shown in the (A, B) retrosplenial cortex and (C, D) dentate gyrus of rat pups treated with normal saline under (1) normoxia, (2) normoxia with caffeine, (3) hyperoxia, and (4) hyperoxia with caffeine 24 (A, C) and 48 h (B, D) after oxygen and/or drug administration. All micrographs were taken at identical magnification. Scale bars, 40 (A, B) and 100 mm (C, D).

described for various cell types. Activation of the adenosine A2A receptor, antagonistic against the dopamine D2 receptor, leads to enhanced neurogenesis [98], and the antiproliferative effects of caffeine may be due to antagonizing A2A receptor functions. Oral administration of caffeine has been observed to reduce tumor growth [99], and several p53-dependent or -independent mechanisms of modulation of proliferation by caffeine have been discussed [100,101]. Caffeine acts in nonphysiological concentrations as a phosphodiesterase inhibitor through the second messenger cAMP. Activation of the cAMP cascade by administration of rolipram, a cAMP esterase inhibitor, has been shown to induce cell proliferation in adult rodent hippocampus and result in mature cells that express neuronal markers [102]. The mechanism by which caffeine is able to prevent cell cycle arrest and apoptosis remains unclear. Recent cDNA microarray work suggests that caffeine changes the expression profiles of multiple genes that regulate these processes [103]. The brain in particular is vulnerable to damage caused by oxidative stress

because neurons contain only low levels of endogenous antioxidant enzymes [21,22,26]. Kumral et al. [104] demonstrated that aminophylline significantly diminished the number of apoptotic cells in the hippocampus after hypoxic/ischemic insult. Caffeinated coffee has been shown to inhibit hydrogen peroxide-induced apoptotic neuronal death. This protection occurred through the inhibition of downregulation of the antiapoptotic and obstruction of the proapoptotic cleavage of caspase-3 and pro-PARP in primary cortical neurons [105]. There are several limitations of this study pointing to areas of future investigations. First, caffeine was given only once to the animals, whereas preterm infants often receive caffeine for several weeks [4]. Second, short-term hyperoxia was examined and preterm infants are often exposed to a longer period of supraphysiological oxygen concentrations [106]; and third, the focus of our work was neuronal development and maturation, whereas studies of glial cells were not included and they certainly represent an interesting cellular target for future studies on caffeine in the

S. Endesfelder et al. / Free Radical Biology and Medicine 67 (2014) 221–234

immature brain. Further details of caffeine-induced effects such as adenosine-receptor-system expression and antiapoptotic and antiinflammatory effects remain to be elucidated.

231

To summarize, preterm infants undergo prolonged intensive care with exposure to various noxious stimuli. During the late second and third trimester of gestation, crucial periods of human brain development occur. Not only preterm birth itself but also clinical interventions in preterm infants may affect brain development. It has been shown that high oxygen exposure in the neonatal period is associated with impaired brain development, resulting in cognitive and neurological deficits. Changes in hippocampal development may be relevant because the hippocampus is involved in the control of some behavioral and cognitive functions, including memory and spatial learning [107,108], and remains vulnerable to adverse effects during the early postnatal period [109]. However, the full adverse effects of hyperoxia on the immature hippocampus and their relationship to cognitive and motor performances are not clear. As shown in clinical studies [2,3], caffeine seems to have protective effects on neurological outcome of preterm infants and our studies suggest that caffeine acts via antioxidant mechanisms.

Conclusion

Fig. 9. Oxidative stress in cortex and DG caused by hyperoxia is prevented by caffeine. Quantitation of (A) 8-oxodG þ cells in postnatal cortices (retrosplenial cortices, frontal cortices, parietal cortices) and (B) cells in the postnatal dentate gyrus (GCL, PL) in the rat cortex (retrosplenial cortices, frontal cortices, parietal cortices) and dentate gyrus (GCL, PL) showed that relative to the control (normoxia, white bars), hyperoxia at 24 and 48 h significantly increased these cell counts (black bars). These levels were significantly decreased through systemic caffeine pretreatment (dark gray bars). Interestingly, in control rats without hyperoxic insult, caffeine also resulted in decreases of 8-oxodG þ cells (light gray bars). Data are expressed relative to the normoxia-exposed control group (control 100%, white bars), and the 100% value is (A) 0.544 and 0.728 8-oxodG þ cells mm  2 and (B) 0.665 and 1.573 8-oxodG þ cells mm  2 for 24- and 48-h groups, respectively. Error bars represent SEM, n¼ 4/group. np o 0.05, nnpo 0.01, and nnnpo 0.001 vs normoxia; ###p o 0.001 vs hyperoxia (Bonferroni post hoc test after one-way ANOVA).

The core novel finding presented in this work is that caffeine prevents neuronal damage caused by oxygen toxicity in the immature brain. Exposure to high oxygen in the developmental brain of 6-dayold rat pups resulted in increased levels of oxidative stressinduced DNA damage as measured by increased levels of 8-oxodG. Expression of neuronal markers and the proliferation capacity of neural precursor cells were significantly reduced by hyperoxia. Neuronal transcription factors crucial for neurogenesis and neuronal development were downregulated by hyperoxia. Strikingly, application of a single dose of caffeine before high oxygen exposure attenuated or abolished all of these toxic effects. Currently, both adverse and protective effects are described [5,104,110–112]. However, caffeine also led to negative effects in control animals, and the potential side effects should be further considered in studies on protection of the immature brain using caffeine. Remarkably, caffeine protected neuronal cells in the hippocampus at various stages of development. We demonstrated that postnatal caffeine treatment diminished hyperoxic brain insult. Therefore, cumulative changes in cellular oxidative stress targets might be an important issue for antioxidative capacity, especially during postnatal neurogenesis and for understanding the mechanism of caffeine. Although this hypothesis remains to be addressed, the

Fig. 10. Caffeine changes physiological neuronal apoptosis in the DG. Quantitation of TUNEL þ cells in the rat brain cortex (retrosplenial cortices, frontal cortices, parietal cortices), deep gray matter (thalamus, hypothalamus), and dentate gyrus (GCL, PL) showed that relative to the control (normoxia, white bars), hyperoxia at 24 and 48 h significantly increased these cell counts in cortex and DGM (black bars). These levels were significantly decreased through systemic caffeine pretreatment (dark gray bars). Interestingly, hyperoxia did not enhance apoptosis in the DG. However, caffeine administration resulted in decreases in TUNEL þ cells in both control (light gray bars) and hyperoxia rats (dark gray bars). Data are expressed as total number of cells. Error bars represent SEM, n¼ 4/group. np o 0.05, nnp o0.01, and nnnp o0.001 vs normoxia; ### p o 0.001 vs hyperoxia (Bonferroni post hoc test after one-way ANOVA).

232

S. Endesfelder et al. / Free Radical Biology and Medicine 67 (2014) 221–234

sum of these results nonetheless raises important questions regarding the potential consequences of neonatal caffeine administration. Based on these data of the hyperoxia model, caffeine as a drug seems to be a promising agent for neuroprotective strategies in preterm infants.

Acknowledgments We thank Marissa Blanco (Vanderbilt University, Nashville, TN, USA) and Giang Tong (German Heart Institute, Berlin, Germany) for proofreading the manuscript. U.W. is a Fellow of the Promotionsstipendium Charité University Medical Center, Germany. We gratefully thank Evelyn Strauss for excellent technical assistance.

[24]

[25]

[26]

[27] [28]

[29]

References [30] [1] Clark, R. H.; Bloom, B. T.; Spitzer, A. R.; Gerstmann, D. R. Reported medication use in the neonatal intensive care unit: data from a large national data set. Pediatrics 117:1979–1987; 2006. [2] Schmidt, B.; Roberts, R. S.; Davis, P.; Doyle, L. W.; Barrington, K. J.; Ohlsson, A.; Solimano, A.; Tin, W. Caffeine therapy for apnea of prematurity. N. Engl. J. Med. 354:2112–2121; 2006. [3] Schmidt, B.; Roberts, R. S.; Davis, P.; Doyle, L. W.; Barrington, K. J.; Ohlsson, A.; Solimano, A.; Tin, W. Long-term effects of caffeine therapy for apnea of prematurity. N. Engl. J. Med. 357:1893–1902; 2007. [4] Davis, P. G.; Schmidt, B.; Roberts, R. S.; Doyle, L. W.; Asztalos, E.; Haslam, R.; Sinha, S.; Tin, W. Caffeine for Apnea of Prematurity trial: benefits may vary in subgroups. J. Pediatr. 156:382–387; 2010. [5] Rivkees, S. A.; Wendler, C. C. Adverse and protective influences of adenosine on the newborn and embryo: implications for preterm white matter injury and embryo protection. Pediatr. Res 69:271–278; 2011. [6] Supcun, S.; Kutz, P.; Pielemeier, W.; Roll, C. Caffeine increases cerebral cortical activity in preterm infants. J. Pediatr. 156:490–491; 2010. [7] Kalda, A.; Yu, L.; Oztas, E.; Chen, J. F. Novel neuroprotection by caffeine and adenosine A(2 A) receptor antagonists in animal models of Parkinson's disease. J. Neurol. Sci. 248:9–15; 2006. [8] Aronowski, J.; Strong, R.; Shirzadi, A.; Grotta, J. C. Ethanol plus caffeine (caffeinol) for treatment of ischemic stroke: preclinical experience. Stroke 34:1246–1251; 2003. [9] Belayev, L.; Khoutorova, L.; Zhang, Y.; Belayev, A.; Zhao, W.; Busto, R.; Ginsberg, M. D. Caffeinol confers cortical but not subcortical neuroprotection after transient focal cerebral ischemia in rats. Brain Res. 1008:278–283; 2004. [10] Dall'Igna, O. P.; Fett, P.; Gomes, M. W.; Souza, D. O.; Cunha, R. A.; Lara, D. R. Caffeine and adenosine A(2a) receptor antagonists prevent β-amyloid (25-35)-induced cognitive deficits in mice. Exp. Neurol. 203:241–245; 2007. [11] Bitterman, N.; Schaal, S. Caffeine attenuates CNS oxygen toxicity in rats. Brain Res. 696:250–253; 1995. [12] Back, S. A.; Craig, A.; Luo, N. L.; Ren, J.; Akundi, R. S.; Ribeiro, I.; Rivkees, S. A. Protective effects of caffeine on chronic hypoxia-induced perinatal white matter injury. Ann. Neurol. 60:696–705; 2006. [13] Andrews, K.; Fitzgerald, M. Biological barriers to paediatric pain management. Clin. J. Pain 13:138–143; 1997. [14] Dobbing, J.; Sands, J. Comparative aspects of the brain growth spurt. Early Hum. Dev. 3:79–83; 1979. [15] Castillo, A.; Sola, A.; Baquero, H.; Neira, F.; Alvis, R.; Deulofeut, R.; Critz, A. Pulse oxygen saturation levels and arterial oxygen tension values in newborns receiving oxygen therapy in the neonatal intensive care unit: is 85% to 93% an acceptable range? Pediatrics 121:882–889; 2008. [16] Davis, J. M.; Auten, R. L. Maturation of the antioxidant system and the effects on preterm birth. Semin. Fetal Neonatal Med. 15:191–195; 2010. [17] Collins, M. P.; Lorenz, J. M.; Jetton, J. R.; Paneth, N. Hypocapnia and other ventilation-related risk factors for cerebral palsy in low birth weight infants. Pediatr. Res. 50:712–719; 2001. [18] Deulofeut, R.; Dudell, G.; Sola, A. Treatment-by-gender effect when aiming to avoid hyperoxia in preterm infants in the NICU. Acta Paediatr 96:990–994; 2007. [19] Saugstad, O. D. Hyperoxia in the term newborn: more evidence is still needed for optimal oxygen therapy. Acta Paediatr 101:34–38; 2012. [20] Saugstad, O. D.; Sejersted, Y.; Solberg, R.; Wollen, E. J.; Bjoras, M. Oxygenation of the newborn: a molecular approach. Neonatology 101:315–325; 2012. [21] Dzietko, M.; Boos, V.; Sifringer, M.; Polley, O.; Gerstner, B.; Genz, K.; Endesfelder, S.; Borner, C.; Jacotot, E.; Chauvier, D.; Obladen, M.; Buhrer, C.; Felderhoff-Mueser, U. A critical role for Fas/CD-95 dependent signaling pathways in the pathogenesis of hyperoxia-induced brain injury. Ann. Neurol. 64:664–673; 2008. [22] Felderhoff-Mueser, U.; Bittigau, P.; Sifringer, M.; Jarosz, B.; Korobowicz, E.; Mahler, L.; Piening, T.; Moysich, A.; Grune, T.; Thor, F.; Heumann, R.; Buhrer, C.; Ikonomidou, C. Oxygen causes cell death in the developing brain. Neurobiol. Dis. 17:273–282; 2004. [23] Gerstner, B.; DeSilva, T. M.; Genz, K.; Armstrong, A.; Brehmer, F.; Neve, R. L.; Felderhoff-Mueser, U.; Volpe, J. J.; Rosenberg, P. A. Hyperoxia causes

[31] [32] [33] [34]

[35] [36]

[37]

[38] [39] [40] [41]

[42]

[43]

[44]

[45]

[46]

[47] [48]

[49]

[50]

[51]

[52]

maturation-dependent cell death in the developing white matter. J. Neurosci. 28:1236–1245; 2008. Schmitz, T.; Ritter, J.; Mueller, S.; Felderhoff-Mueser, U.; Chew, L. J.; Gallo, V. Cellular changes underlying hyperoxia-induced delay of white matter development. J. Neurosci. 31:4327–4344; 2011. Gerstner, B.; Buhrer, C.; Rheinlander, C.; Polley, O.; Schuller, A.; Berns, M.; Obladen, M.; Felderhoff-Mueser, U. Maturation-dependent oligodendrocyte apoptosis caused by hyperoxia. J. Neurosci. Res. 84:306–315; 2006. Bendix, I.; Weichelt, U.; Strasser, K.; Serdar, M.; Endesfelder, S.; von Haefen, C.; Heumann, R.; Ehrkamp, A.; Felderhoff-Mueser, U.; Sifringer, M. Hyperoxia changes the balance of the thioredoxin/peroxiredoxin system in the neonatal rat brain. Brain Res. 1484:68–75; 2012. Ikonomidou, C.; Kaindl, A. M. Neuronal death and oxidative stress in the developing brain. Antioxid. Redox Signaling 14:1535–1550; 2011. Kaindl, A. M.; Sifringer, M.; Koppelstaetter, A.; Genz, K.; Loeber, R.; Boerner, C.; Stuwe, J.; Klose, J.; Felderhoff-Mueser, U. Erythropoietin protects the developing brain from hyperoxia-induced cell death and proteome changes. Ann. Neurol. 64:523–534; 2008. Esposito, M. S.; Piatti, V. C.; Laplagne, D. A.; Morgenstern, N. A.; Ferrari, C. C.; Pitossi, F. J.; Schinder, A. F. Neuronal differentiation in the adult hippocampus recapitulates embryonic development. J. Neurosci. 25:10074–10086; 2005. Laplagne, D. A.; Esposito, M. S.; Piatti, V. C.; Morgenstern, N. A.; Zhao, C.; van Praag, H.; Gage, F. H.; Schinder, A. F. Functional convergence of neurons generated in the developing and adult hippocampus. PLoS Biol. 4:e409; 2006. Lledo, P. M.; Alonso, M.; Grubb, M. S. Adult neurogenesis and functional plasticity in neuronal circuits. Nat. Rev. Neurosci. 7:179–193; 2006. Ninkovic, J.; Gotz, M. Signaling in adult neurogenesis: from stem cell niche to neuronal networks. Curr. Opin. Neurobiol. 17:338–344; 2007. Zhao, C.; Deng, W.; Gage, F. H. Mechanisms and functional implications of adult neurogenesis. Cell 132:645–660; 2008. Deng, W.; Aimone, J. B.; Gage, F. H. New neurons and new memories: how does adult hippocampal neurogenesis affect learning and memory? Nat. Rev. Neurosci. 11:339–350; 2010. Aimone, J. B.; Wiles, J.; Gage, F. H. Computational influence of adult neurogenesis on memory encoding. Neuron 61:187–202; 2009. Kempermann, G.; Jessberger, S.; Steiner, B.; Kronenberg, G. Milestones of neuronal development in the adult hippocampus. Trends Neurosci. 27:447–452; 2004. Englund, C.; Fink, A.; Lau, C.; Pham, D.; Daza, R. A.; Bulfone, A.; Kowalczyk, T.; Hevner, R. F. Pax6, Tbr2, and Tbr1 are expressed sequentially by radial glia, intermediate progenitor cells, and postmitotic neurons in developing neocortex. J. Neurosci. 25:247–251; 2005. Hodge, R. D.; Hevner, R. F. Expression and actions of transcription factors in adult hippocampal neurogenesis. Dev. Neurobiol. 71:680–689; 2011. Livak, K. J.; Schmittgen, T. D. Analysis of relative gene expression data using realtime quantitative PCR and the 2( ΔΔC(T)) method. Methods 25:402–408; 2001. Klein, J. A.; Ackerman, S. L. Oxidative stress, cell cycle, and neurodegeneration. J. Clin. Invest. 111:785–793; 2003. Balu, D. T.; Lucki, I. Adult hippocampal neurogenesis: regulation, functional implications, and contribution to disease pathology. Neurosci. Biobehav. Rev. 33:232–252; 2009. Molna´r, Z.; Szele, F. G.; Vercelli, A. Forebrain neurogenic compartments and cortical neurogenesis: comparative aspects. In: Bonfati, L., editor. Postnatal and Adult Neurogenesis. Kerala: Research Signpost; 2009. p. 193–213. Tanimura, A.; Liu, J.; Namba, T.; Seki, T.; Matsubara, Y.; Itoh, M.; Suzuki, T.; Arai, H. Prenatal phencyclidine exposure alters hippocampal cell proliferation in offspring rats. Synapse 63:729–736; 2009. Olariu, A.; Cleaver, K. M.; Cameron, H. A. Decreased neurogenesis in aged rats results from loss of granule cell precursors without lengthening of the cell cycle. J. Comp. Neurol 501:659–667; 2007. Shetty, G. A.; Hattiangady, B.; Shetty, A. K. Neural stem cell and neurogenesis related gene expression profiles in the young and aged dentate gyrus. Age (Dordr.) 35:2165–2176; 2013. Kaindl, A. M.; Sifringer, M.; Zabel, C.; Nebrich, G.; Wacker, M. A.; Felderhoff-Mueser, U.; Endesfelder, S.; von der Hagen, M.; Stefovska, V.; Klose, J.; Ikonomidou, C. Acute and long-term proteome changes induced by oxidative stress in the developing brain. Cell Death Differ. 13:1097–1109; 2006. Burhans, W. C.; Heintz, N. H. The cell cycle is a redox cycle: linking phasespecific targets to cell fate. Free Radic. Biol. Med. 47:1282–1293; 2009. Nayak, G.; Cooper, G. M. p53 is a major component of the transcriptional and apoptotic program regulated by PI 3-kinase/Akt/GSK3 signaling. Cell Death Dis. 3:e400; 2012. Wiese, C.; Rolletschek, A.; Kania, G.; Blyszczuk, P.; Tarasov, K. V.; Tarasova, Y.; Wersto, R. P.; Boheler, K. R.; Wobus, A. M. Nestin expression—a property of multi-lineage progenitor cells? Cell. Mol. Life Sci. 61:2510–2522; 2004. Ahlenius, H.; Visan, V.; Kokaia, M.; Lindvall, O.; Kokaia, Z. Neural stem and progenitor cells retain their potential for proliferation and differentiation into functional neurons despite lower number in aged brain. J. Neurosci 29:4408–4419; 2009. Couillard-Despres, S.; Winner, B.; Schaubeck, S.; Aigner, R.; Vroemen, M.; Weidner, N.; Bogdahn, U.; Winkler, J.; Kuhn, H. G.; Aigner, L. Doublecortin expression levels in adult brain reflect neurogenesis. Eur. J. Neurosci. 21:1–14; 2005. Dijkmans, T. F.; van Hooijdonk, L. W.; Fitzsimons, C. P.; Vreugdenhil, E. The doublecortin gene family and disorders of neuronal structure. Cent. Nerv. Syst. Agents Med. Chem 10:32–46; 2010.

S. Endesfelder et al. / Free Radical Biology and Medicine 67 (2014) 221–234

[53] Friocourt, G.; Liu, J. S.; Antypa, M.; Rakic, S.; Walsh, C. A.; Parnavelas, J. G. Both doublecortin and doublecortin-like kinase play a role in cortical interneuron migration. J. Neurosci. 27:3875–3883; 2007. [54] Kappeler, C.; Saillour, Y.; Baudoin, J. P.; Tuy, F. P.; Alvarez, C.; Houbron, C.; Gaspar, P.; Hamard, G.; Chelly, J.; Metin, C.; Francis, F. Branching and nucleokinesis defects in migrating interneurons derived from doublecortin knockout mice. Hum. Mol. Genet 15:1387–1400; 2006. [55] Hsieh, J. Orchestrating transcriptional control of adult neurogenesis. Genes Dev. 26:1010–1021; 2012. [56] Roybon, L.; Hjalt, T.; Stott, S.; Guillemot, F.; Li, J. Y.; Brundin, P. Neurogenin2 directs granule neuroblast production and amplification while NeuroD1 specifies neuronal fate during hippocampal neurogenesis. PLoS One 4: e4779; 2009. [57] von Bohlen und Halbach, O. Immunohistological markers for staging neurogenesis in adult hippocampus. Cell Tissue Res 329:409–420; 2007. [58] Nacher, J.; Varea, E.; Blasco-Ibanez, J. M.; Castillo-Gomez, E.; Crespo, C.; Martinez-Guijarro, F. J.; McEwen, B. S. Expression of the transcription factor Pax 6 in the adult rat dentate gyrus. J. Neurosci. Res. 81:753–761; 2005. [59] Osumi, N.; Shinohara, H.; Numayama-Tsuruta, K.; Maekawa, M. Pax6 transcription factor contributes to both embryonic and adult neurogenesis as a multifunctional regulator. Stem Cells 26:1663–1672; 2008. [60] Heins, N.; Malatesta, P.; Cecconi, F.; Nakafuku, M.; Tucker, K. L.; Hack, M. A.; Chapouton, P.; Barde, Y. A.; Gotz, M. Glial cells generate neurons: the role of the transcription factor Pax6. Nat. Neurosci. 5:308–315; 2002. [61] Episkopou, V. SOX2 functions in adult neural stem cells. Trends Neurosci. 28:219–221; 2005. [62] Suh, H.; Consiglio, A.; Ray, J.; Sawai, T.; D'Amour, K. A.; Gage, F. H. In vivo fate analysis reveals the multipotent and self-renewal capacities of Sox2 þ neural stem cells in the adult hippocampus. Cell Stem Cell 1:515–528; 2007. [63] Jaenisch, R.; Young, R. Stem cells, the molecular circuitry of pluripotency and nuclear reprogramming. Cell 132:567–582; 2008. [64] Hodge, R. D.; Nelson, B. R.; Kahoud, R. J.; Yang, R.; Mussar, K. E.; Reiner, S. L.; Hevner, R. F. Tbr2 is essential for hippocampal lineage progression from neural stem cells to intermediate progenitors and neurons. J. Neurosci. 32:6275–6287; 2012. [65] Lavado, A.; Lagutin, O. V.; Chow, L. M.; Baker, S. J.; Oliver, G. Prox1 is required for granule cell maturation and intermediate progenitor maintenance during brain neurogenesis. PLoS Biol. 8; 2010. [66] Galeeva, A.; Treuter, E.; Tomarev, S.; Pelto-Huikko, M. A prospero-related homeobox gene Prox-1 is expressed during postnatal brain development as well as in the adult rodent brain. Neuroscience 146:604–616; 2007. [67] Lavado, A.; Oliver, G. Prox1 expression patterns in the developing and adult murine brain. Dev. Dyn. 236:518–524; 2007. [68] Liu, M.; Pleasure, S. J.; Collins, A. E.; Noebels, J. L.; Naya, F. J.; Tsai, M. J.; Lowenstein, D. H. Loss of BETA2/NeuroD leads to malformation of the dentate gyrus and epilepsy. Proc. Natl. Acad. Sci. USA 97:865–870; 2000. [69] Hevner, R. F.; Shi, L.; Justice, N.; Hsueh, Y.; Sheng, M.; Smiga, S.; Bulfone, A.; Goffinet, A. M.; Campagnoni, A. T.; Rubenstein, J. L. Tbr1 regulates differentiation of the preplate and layer 6. Neuron 29:353–366; 2001. [70] Ihrie, R. A.; Alvarez-Buylla, A. Lake-front property: a unique germinal niche by the lateral ventricles of the adult brain. Neuron 70:674–686; 2011. [71] Jones, K. S.; Connor, B. Intrinsic regulation of adult subventricular zone neural progenitor cells and the effect of brain injury. Am. J. Stem Cells 1:48–58; 2012. [72] Ming, G. L.; Song, H. Adult neurogenesis in the mammalian brain: significant answers and significant questions. Neuron 70:687–702; 2011. [73] Mu, Y.; Lee, S. W.; Gage, F. H. Signaling in adult neurogenesis. Curr. Opin. Neurobiol. 20:416–423; 2010. [74] van Praag, H.; Christie, B. R.; Sejnowski, T. J.; Gage, F. H. Running enhances neurogenesis, learning, and long-term potentiation in mice. Proc. Natl. Acad. Sci. USA 96:13427–13431; 1999. [75] Clelland, C. D.; Choi, M.; Romberg, C.; Clemenson Jr G. D.; Fragniere, A.; Tyers, P.; Jessberger, S.; Saksida, L. M.; Barker, R. A.; Gage, F. H.; Bussey, T. J. A functional role for adult hippocampal neurogenesis in spatial pattern separation. Science 325:210–213; 2009. [76] Crews, L.; Adame, A.; Patrick, C.; Delaney, A.; Pham, E.; Rockenstein, E.; Hansen, L.; Masliah, E. Increased BMP6 levels in the brains of Alzheimer's disease patients and APP transgenic mice are accompanied by impaired neurogenesis. J. Neurosci. 30:12252–12262; 2010. [77] Gould, E. How widespread is adult neurogenesis in mammals? Nat. Rev. Neurosci. 8:481–488; 2007. [78] Panchision, D. M. The role of oxygen in regulating neural stem cells in development and disease. J. Cell. Physiol 220:562–568; 2009. [79] Yis, U.; Kurul, S. H.; Kumral, A.; Cilaker, S.; Tugyan, K.; Genc, S.; Yilmaz, O. Hyperoxic exposure leads to cell death in the developing brain. Brain Dev. 30:556–562; 2008. [80] Sifringer, M.; Bendix, I.; Borner, C.; Endesfelder, S.; von Haefen, C.; Kalb, A.; Holifanjaniaina, S.; Prager, S.; Schlager, G. W.; Keller, M.; Jacotot, E.; Felderhoff-Mueser, U. Prevention of neonatal oxygen-induced brain damage by reduction of intrinsic apoptosis. Cell Death Dis. 3:e250; 2012. [81] Taglialatela, G.; Perez-Polo, J. R.; Rassin, D. K. Induction of apoptosis in the CNS during development by the combination of hyperoxia and inhibition of glutathione synthesis. Free Radic. Biol. Med 25:936–942; 1998. [82] Cooke, M. S.; Olinski, R.; Loft, S. European Standards Committee on Urinary Lesion, A. Measurement and meaning of oxidatively modified DNA lesions in urine. Cancer Epidemiol. Biomarkers Prev 17:3–14; 2008.

233

[83] Solberg, R.; Andresen, J. H.; Escrig, R.; Vento, M.; Saugstad, O. D. Resuscitation of hypoxic newborn piglets with oxygen induces a dose-dependent increase in markers of oxidation. Pediatr. Res. 62:559–563; 2007. [84] Lee, C. Antioxidant ability of caffeine and its metabolites based on the study of oxygen radical absorbing capacity and inhibition of LDL peroxidation. Clin. Chim. Acta 295:141–154; 2000. [85] Fredholm, B. B. Astra Award Lecture: adenosine, adenosine receptors and the actions of caffeine. Pharmacol. Toxicol. 76:93–101; 1995. [86] Prasanthi, J. R.; Dasari, B.; Marwarha, G.; Larson, T.; Chen, X.; Geiger, J. D.; Ghribi, O. Caffeine protects against oxidative stress and Alzheimer's diseaselike pathology in rabbit hippocampus induced by cholesterol-enriched diet. Free Radic. Biol. Med. 49:1212–1220; 2010. [87] Miller, M. J.; Fanaroff, A. A.; Martin, J. R. Respiratory disorders in preterm and term infants. In: Fanaroff, A. A., Martin, R. J., editors. Neonatal–Perinatal Medicine: Diseases of the Fetus and Infant. St. Louis. Mosby; 1996. p. 1040–1065. [88] Roberts, R. J. Methylxanthine therapy: caffeine and theophylline. Drug Therapy in Infants: Pharmacological Principles and Clinical Experience. Philadelphia: Saunders; 1984; 19–137; 1984. [89] Fredholm, B. B.; Battig, K.; Holmen, J.; Nehlig, A.; Zvartau, E. E. Actions of caffeine in the brain with special reference to factors that contribute to its widespread use. Pharmacol. Rev. 51:83–133; 1999. [90] van Praag, H.; Kempermann, G.; Gage, F. H. Running increases cell proliferation and neurogenesis in the adult mouse dentate gyrus. Nat. Neurosci. 2:266–270; 1999. [91] Chavez-Valdez, R.; Wills-Karp, M.; Ahlawat, R.; Cristofalo, E. A.; Nathan, A.; Gauda, E. B. Caffeine modulates TNF-alpha production by cord blood monocytes: the role of adenosine receptors. Pediatr. Res. 65:203–208; 2009. [92] Han, M. E.; Park, K. H.; Baek, S. Y.; Kim, B. S.; Kim, J. B.; Kim, H. J.; Oh, S. O. Inhibitory effects of caffeine on hippocampal neurogenesis and function. Biochem. Biophys. Res. Commun. 356:976–980; 2007. [93] Horrigan, L. A.; Kelly, J. P.; Connor, T. J. Caffeine suppresses TNF-alpha production via activation of the cyclic AMP/protein kinase A pathway. Int. Immunopharmacol. 4:1409–1417; 2004. [94] Kochman, L. J.; Fornal, C. A.; Jacobs, B. L. Suppression of hippocampal cell proliferation by short-term stimulant drug administration in adult rats. Eur. J. Neurosci. 29:2157–2165; 2009. [95] Ohta, A.; Lukashev, D.; Jackson, E. K.; Fredholm, B. B.; Sitkovsky, M. 1,3,7Trimethylxanthine (caffeine) may exacerbate acute inflammatory liver injury by weakening the physiological immunosuppressive mechanism. J. Immunol. 179:7431–7438; 2007. [96] Wentz, C. T.; Magavi, S. S. Caffeine alters proliferation of neuronal precursors in the adult hippocampus. Neuropharmacology 56:994–1000; 2009. [97] Kang, S. H.; Lee, Y. A.; Won, S. J.; Rhee, K. H.; Gwag, B. J. Caffeine-induced neuronal death in neonatal rat brain and cortical cell cultures. Neuroreport 13:1945–1950; 2002. [98] Ohtani, N.; Goto, T.; Waeber, C.; Bhide, P. G. Dopamine modulates cell cycle in the lateral ganglionic eminence. J. Neurosci. 23:2840–2850; 2003. [99] Lou, Y. R.; Lu, Y. P.; Xie, J. G.; Huang, M. T.; Conney, A. H. Effects of oral administration of tea, decaffeinated tea, and caffeine on the formation and growth of tumors in high-risk SKH-1 mice previously treated with ultraviolet B light. Nutr. Cancer 33:146–153; 1999. [100] Hashimoto, T.; He, Z.; Ma, W. Y.; Schmid, P. C.; Bode, A. M.; Yang, C. S.; Dong, Z. Caffeine inhibits cell proliferation by G0/G1 phase arrest in JB6 cells. Cancer Res. 64:3344–3349; 2004. [101] Lu, Y. P.; Lou, Y. R.; Li, X. H.; Xie, J. G.; Brash, D.; Huang, M. T.; Conney, A. H. Stimulatory effect of oral administration of green tea or caffeine on ultraviolet light-induced increases in epidermal wild-type p53, p21(WAF1/CIP1), and apoptotic sunburn cells in SKH-1 mice. Cancer Res. 60:4785–4791; 2000. [102] Nakagawa, S.; Kim, J. E.; Lee, R.; Malberg, J. E.; Chen, J.; Steffen, C.; Zhang, Y. J.; Nestler, E. J.; Duman, R. S. Regulation of neurogenesis in adult mouse hippocampus by cAMP and the cAMP response element-binding protein. J. Neurosci. 22:3673–3682; 2002. [103] Li, Z.; Liu, W.; Mo, B.; Hu, C.; Liu, H.; Qi, H.; Wang, X.; Xu, J. Caffeine overcomes genistein-induced G2/M cell cycle arrest in breast cancer cells. Nutr. Cancer 60:382–388; 2008. [104] Kumral, A.; Yesilirmak, D. C.; Aykan, S.; Genc, S.; Tugyan, K.; Cilaker, S.; Akhisaroglu, M.; Aksu, I.; Sutcuoglu, S.; Yilmaz, O.; Duman, N.; Ozkan, H. Protective effects of methylxanthines on hypoxia-induced apoptotic neurodegeneration and long-term cognitive functions in the developing rat brain. Neonatology 98:128–136; 2010. [105] Kim, J.; Lee, S.; Shim, J.; Kim, H. W.; Kim, J.; Jang, Y. J.; Yang, H.; Park, J.; Choi, S. H.; Yoon, J. H.; Lee, K. W.; Lee, H. J. Caffeinated coffee, decaffeinated coffee, and the phenolic phytochemical chlorogenic acid up-regulate NQO1 expression and prevent H2O2-induced apoptosis in primary cortical neurons. Neurochem. Int. 60:466–474; 2012. [106] Konig, K.; Guy, K. J. Bronchopulmonary dysplasia in preterm infants managed with non-invasive ventilation or surfactant and a brief period of mechanical ventilation: a 6-year cohort study. J Matern Fetal Neonatal Med. 2013. (Aug 7. [Epub ahead of print]). [107] Eyre, M. D.; Richter-Levin, G.; Avital, A.; Stewart, M. G. Morphological changes in hippocampal dentate gyrus synapses following spatial learning in rats are transient. Eur. J. Neurosci. 17:1973–1980; 2003. [108] Lemaire, V.; Koehl, M.; Le Moal, M.; Abrous, D. N. Prenatal stress produces learning deficits associated with an inhibition of neurogenesis in the hippocampus. Proc. Natl. Acad. Sci. USA 97:11032–11037; 2000.

234

S. Endesfelder et al. / Free Radical Biology and Medicine 67 (2014) 221–234

[109] Sze, C. I.; Lin, Y. C.; Lin, Y. J.; Hsieh, T. H.; Kuo, Y. M.; Lin, C. H. The role of glucocorticoid receptors in dexamethasone-induced apoptosis of neuroprogenitor cells in the hippocampus of rat pups. Mediators Inflammation 2013:628094; 2013. [110] Millar, D.; Schmidt, B. Controversies surrounding xanthine therapy. Semin. Neonatol 9:239–244; 2004. [111] Silva, C. G.; Metin, C.; Fazeli, W.; Machado, N. J.; Darmopil, S.; Launay, P. S.; Ghestem, A.; Nesa, M. P.; Bassot, E.; Szabo, E.; Baqi, Y.; Muller, C. E.; Tome, A. R.;

Ivanov, C.; Isbrandt, D.; Zilberter, Y.; Cunha, R. A.; Esclapez, M.; Bernard, C. Adenosine receptor antagonists including caffeine alter fetal brain development in mice. Sci. Transl. Med. 5:197ra104; 2013. [112] Weichelt, U.; Cay, R.; Schmitz, T.; Strauss, E.; Sifringer, M.; Buhrer, C.; Endesfelder, S. Prevention of hyperoxia-mediated pulmonary inflammation in neonatal rats by caffeine. Eur. Respir. J. 41:966–973; 2013.