IL-22 is induced by S100/calgranulin and impairs cholesterol efflux in macrophages by downregulating ABCG1 Bijoy Chellan,* Ling Yan,* Timothy J. Sontag,† Catherine A. Reardon,† and Marion A. Hofmann Bowman1,* Departments of Medicine* and Pathology,† University of Chicago, Chicago, IL

Supplementary key words cholesterol transporters • S100A12 • receptor for advanced glycation endproducts • peritoneal macrophages • interleukin-22

Interleukin (IL)-22 is a member of the IL-10 cytokine family secreted primarily by Th17 and Th22 subsets of T lymphocytes. Th22 cells produce IL-22 in response to IL-6 and TNF␣, and IL-22 is important for the modulation of This work was supported by National Institutes of Health Grant HL114821. The authors declare no conflicts of interest. Manuscript received 18 September 2013 and in revised form 22 December 2013. Published, JLR Papers in Press, December 23, 2013 DOI 10.1194/jlr.M044305

tissue responses during inflammation (1, 2). The bestcharacterized IL-22 target cells include keratinocytes, hepatocytes, and colonic epithelia cells. IL-22 is known to be protective in the gastrointestinal tract in inflammatory bowel disease, and upregulates synthesis of many antimicrobial peptides including defensins and S100-family proteins (3, 4). In contrast, IL-22 mediates skin inflammation with increased migration and hyperplasia of keratinocytes in psoriasis (4–6), and inflammation in collagen-induced arthritis (7). Moreover, IL-22 serum levels are associated with disease activity of psoriasis and rheumatoid arthritis (8, 9). There is emerging evidence that the systemic inflammation and metabolic abnormalities present in patients with rheumatoid arthritis or psoriasis are associated with an increased risk of coronary artery disease (10), although the role of IL-22 in vascular inflammation and atherosclerosis has not been studied. Atherosclerosis is mediated by chronic inflammatory processes of vascular cells in response to a variety of injury modes. S100/calgranulins, which include S100A8 (also known as MRP8 or calgranulin A), S100A9 (MRP14 or calgranulin B), and S100A12 [calgranulin C or Extracellular newly identified RAGE-binding protein (EN-RAGE)], are highly expressed in atherosclerotic remodeled vessels, particularly in cells of cholesterol-rich plaques (11). A potential role for S100/calgranulins in mediating “plaque instability” is suggested by multiple findings: 1) that S100A12 is expressed in macrophages and smooth muscle cells in coronary artery plaques of patients with sudden cardiac death (12); 2) that increased S100A9 mRNA levels are present in platelets of patients with ST-elevation myocardial infarction (13); and 3) that serum concentrations of S100/calgranulin are positively associated with cardiovascular morbidity after myocardial infarction (14).

Abbreviations: FPLC, fast protein liquid chromatography; hBAC/ S100, human bacterial artificial chromosome containing S100 genes; hS100A12, human S100A12; IL, interleukin; LXR, liver X receptor; RAGE, receptor for advanced glycation endproducts; rS100A12, recombinant S100A12; rIL-22, recombinant interleukin-22. 1 To whom correspondence should be addressed. e-mail: [email protected]

Copyright © 2014 by the American Society for Biochemistry and Molecular Biology, Inc. This article is available online at http://www.jlr.org

Journal of Lipid Research Volume 55, 2014

443

Downloaded from www.jlr.org at UNIV OF SYDNEY (CAUL), on August 27, 2014

Abstract S100A8/9 and S100A12 are emerging biomarkers for disease activity of autoimmune and cardiovascular diseases. We demonstrated previously that S100A12 accelerates atherosclerosis accompanied by large cholesterol deposits in atherosclerotic lesions of apoE-null mice. The objective of this study was to ascertain whether S100/calgranulin influences cholesterol homeostasis in macrophages. Peritoneal macrophages from transgenic mice expressing human S100A8/9 and S100A12 in myeloid cells [human bacterial artificial chromosome (hBAC)/S100] have increased 3 lipid content and reduced ABCG1 expression and [ H]cholesterol efflux compared with WT littermates. This was associated with a 6-fold increase in plasma interleukin (IL)-22 and increased IL-22 mRNA in splenic T cells. These findings are mediated by the receptor for advanced glycation endproducts (RAGE), because hBAC/S100 mice lacking RAGE had normal IL-22 expression and normal cholesterol efflux. In vitro, recombinant IL-22 reduced ABCG1 expres3 sion and [ H]cholesterol efflux in THP-1 macrophages, while recombinant S100A12 had no effect on ABCG1 expression. In conclusion, S100/calgranulin has no direct effect on cholesterol efflux in macrophages, but rather promotes the secretion of IL-22, which then directly reduces cholesterol efflux in macrophages by decreasing the expression of ABCG1.—Chellan, B., L. Yan, T. J. Sontag, C. A. Reardon, and M. A. Hofmann Bowman. IL-22 is induced by S100/calgranulin and impairs cholesterol efflux in macrophages by downregulating ABCG1. J. Lipid Res. 2014. 55: 443–454.

METHODS Mice Transgenic mice were generated by utilizing a bacterial artificial chromosome containing 60 kb of human DNA of the S100 gene cluster containing only the genes for human S100A8, S100A9, and S100A12, and regulatory DNA (hBAC/S100). Briefly, hS100/calgranulin protein is expressed in myeloid cells, and S100A12 is released into the serum of hBAC/S100 transgenic mice, but was not detected in myeloid cells and serum of nontransgenic WT littermates. hBAC/S100 mice deficient in RAGE ⫺/⫺ mice) were generated by breeding with (hBAC/S100/RAGE homozygote RAGE-KO mice (received as gift from Dr. Ann Marie Schmidt, New York University, NY). All mice were generated in the C57BL6/J genetic background and the following mice were used for all experiments: WT and hBAC/S100 littermates; hBAC/ ⫺/⫺ and WT/RAGE⫺/⫺ littermates. Mice were housed S100/RAGE at all times in a specific-pathogen-free barrier facility and maintained on normal rodent chow with free access to food and water. All procedures were carried out with the approval of the Institutional Animal Care and Use Committee of the University of Chicago and were in compliance with the Guide for the Care and Use of Laboratory Animals. Tissue and blood were harvested after euthanasia with CO2 followed by cervical dislocation.

444

Journal of Lipid Research Volume 55, 2014

Lipid and lipoprotein analysis Mice were fasted for 8 h before blood was obtained for measurement of plasma cholesterol and triglycerides using a Roche (Indianapolis, IN) enzymatic assay. Plasma (150–250 ␮l) was fractionated on tandem Superose 6 fast protein liquid chromatography (FPLC) columns in 200 mmol/l sodium phosphate (pH 7.4), 50 mmol/l NaCl, 0.03% EDTA, and 0.02% sodium azide; and 400 ␮l fractions were collected. The amount of cholesterol in the even-numbered fractions was determined.

Isolation and culture of primary peritoneal macrophages Resident peritoneal macrophages were collected by washing the peritoneal cavity two times with cold PBS supplemented with 2% BSA, and the lavage fluid was filtered through a 70 ␮m cell strainer and washed by centrifugation (700 g, 4°C, 10 min) three times. The cell pellet was plated at 1 × 106 cells per well in 12-well tissue culture dishes with culture medium comprised of RPMI 1640 supplemented with 2 mM L-glutamine, 10% fetal bovine serum (FBS) (Sigma), and 1% antibiotic-antimycotic (Gibco). Macrophages adhered to the dishes in 2 h and all nonadhering cells were removed prior to the experiments. Human plasma LDL (density 1.02–1.063 g/ml) was isolated by preparative ultracentrifugation and acetylated using standard methodology. Acetylated LDL (at 25 ␮g/ml) was added to the culture medium for 24 h for cholesterol-loading of cells, followed by washing three times with PBS and incubation with RPMI containing mouse serum at 1% final concentration for 24 h prior to analysis. For Oil Red O staining, peritoneal macrophages were cultured on glass slides and staining was performed according to standard procedures. Briefly, 0.35 g of Oil Red O (Sigma) was dissolved in 100 ml of isopropanol and stirred overnight at room temperature. Prior to use, the solution was filtered followed by dilution with water (volume 6:4) and filtered again twice immediately before applying to cells. Adherent peritoneal macrophages were rinsed with PBS and fixed in 10% formalin at room temperature for 1 h followed by rinsing with water. The cells were then incubated in 60% isopropanol for 5 min at room temperature and drained off. After complete drying of the cells, staining with Oil Red O for 10 min at room temperature was performed. The Oil Red O was then removed and the cells were immediately rinsed with water four times. Cells were coverslipped with mounting medium and the images were acquired with a light microscope at 600× magnification.

Isolation and culture of primary bone marrow-derived macrophages Bone marrow-derived macrophages were cultured as described previously (28). Briefly, femurs were dissected aseptically and bone marrow cells were flushed with DMEM supplemented with 2% FBS and 1% heparin using a 26 gauge needle. The cells were then filtered through a cell strainer, washed three times and col6 lected by centrifugation at 600 g. Cells (4 × 10 ) were plated on a 100 mm tissue culture dish and cultured in 30% L929-conditioned medium in complete DMEM (supplemented with 10% FBS and 1% antibiotic-antimycotic). The cell culture medium was replaced after 4 days. Cultured cells were analyzed 7 days after isolation. The cells were more than 95% F4/80-positive macrophages as assessed by fluorescence activated cell sorting (FACS).

T cells T cells were isolated from the mouse spleen using the magnetic Pan T cell isolation kit II (Miltenyi Biotech) according to manufacturer’s instructions.

THP-1 cells Human monocytic THP-1 cells (ATCC) were cultured in RPMI 1640 supplemented with 10% FBS (Invitrogen) and 1% antibioticantimycotic. Cells were plated at 1 × 106 cells/well in 6-well tissue

Downloaded from www.jlr.org at UNIV OF SYDNEY (CAUL), on August 27, 2014

Furthermore, S100/calgranulins are powerful biomarkers for chronic inflammatory diseases, including rheumatoid and psoriatic arthritis, inflammatory bowel disease, systemic lupus erythematosus, and others (15–17). S100 proteins belong to the family of calcium-binding EF-hand proteins, which regulate a number of cellular functions including calcium homeostasis, cell growth and maturation, dynamic regulation of the cytoskeleton, and immune responses (18). Besides their intracellular functions, these proteins are secreted and bind to cell surface receptors. Our laboratory and others have shown that S100A12 binds and activates the receptor for advanced glycation endproducts (RAGE) (19–22). We recently showed that expression of human S100A12 in the vasculature accelerates atherosclerosis in transgenic mice, with plaques having morphologic characteristics that are commonly associated with unstable plaques in patients with coronary artery disease, i.e., large necrotic cores with crystallized cholesterol deposits (23). Cholesterol crystallization is an after-effect of free cholesterol accumulation within the plaques (24, 25). In macrophages, cholesterol accumulation is regulated by cholesterol uptake via CD36, LOX1, and other receptors, and via cholesterol efflux regulated by the cholesterol transporter proteins ABCA1 and ABCG1 (26, 27). Because of the association of plaque-expressed S100/calgranulin with cholesterol deposition and plaque rupture, we hypothesize that S100/calgranulin directly or indirectly influences macrophage cholesterol homeostasis. To test this hypothesis, we exploited the fact that S100A12 is not present in mice and analyzed cholesterol transport in peritoneal macrophages from transgenic mice expressing human S100/calgranulin via a bacterial artificial chromosome (hBAC/S100).

culture dishes and treated for 24 h with phorbol 12-myristate 13-acetate (PMA) (Fischer Scientific) at 20 ng/ml to trigger differentiation into macrophages (29). THP-1 macrophages were treated with recombinant S100A12, S100A9 (R&D Systems), or IL-22 (BioLegend). For cholesterol efflux studies, cells were treated with IL-22 in the presence or absence of the liver X receptor (LXR)-agonist TO-901317 (Sigma) during loading with [3H] cholesterol/acetylated LDL as indicated below.

Cholesterol efflux assay

Total protein was isolated from cells after isolation of RNA. The protein fraction from the TRIzol extract was acetone-precipitated and washed three times with 0.3 M guanidine hydrochloride in a 1:1 mixture of 95% ethanol and 2.5% glycerol, and finally with ethanol containing 2.5% glycerol (v/v). The washed pellet was then air-dried, dissolved in 1% SDS, and subjected to SDS-PAGE and Western blotting using standard techniques. ABCA1, ABCG1, and CD36 were detected using anti-ABCA1, -ABCG1, and -CD36 IgG (Novus Biologicals), respectively. ApoA-I was detected using rabbit anti-mouse apoA-I antiserum.

ELISA Mouse plasma IL-22, IL-17, and IL-10 were measured by ELISA using kits from E Biosciences.

Colorimetry Total cholesterol was analyzed using a cholesterol quantification kit (Sigma) and triglycerides were analyzed using a triglyceride quantification kit (Cell Biolabs).

Statistical analysis At least 10 mice per group were analyzed, and all experiments were performed in triplicate. Results are presented as mean ± SD. Statistical differences were analyzed using an independent sample t-test, and one-way ANOVA was used for mean comparison between two or multiple groups, respectively. Two-tailed probability values of P < 0.01 were considered statistically significant for each test to ensure an overall study significance level of P < 0.05.

RESULTS

Quantitative real-time RT-PCR RNA was isolated from cells using TRIzol reagent (Invitrogen). First-strand cDNA was generated from 4 ␮g RNA using Superscript III (Invitrogen) and random primers (Invitrogen). Subsequently, the cDNA was diluted 1:10 and 2 ␮l cDNA was subjected to quantitative real-time PCR using SYBR Green with an iQ5 cycler (BioRAD) with specific primers. All PCR amplifications were carried out in triplicate. The primers were designed on the primer bank of the Massachusetts General Hospital library and sequences are listed in Table 1. The ⌬CT value was used to describe the difference between the hBAC/S100 and WT normalized to the housekeeping gene HPRT. Relative mRNA expression was estimated as 2exp(⌬CT target gene ⫺ ⌬CT housekeeping gene). There was no significant difference in absolute CT values for the amplification of HPRT among the different experimental groups (CT ranging from 19.59 to 20.52 cycles), indicating that RNA quality and abundance of this housekeeping gene was not affected by the experimental design. TABLE 1. Gene

Human CD36 Human ABCA1 Human ABCG1 Human IL-22 Human HPRT Mouse CD36 Mouse ABCA1 Mouse ABCG1 Mouse HPRT Mouse IL-22

Peritoneal macrophages from hBAC/S100 mice have increased cholesterol uptake and reduced cholesterol efflux We previously found accelerated atherosclerosis with significant cholesterol crystal deposits in the apoE-deficient mice with transgenic expression of human (h)S100A12 in vascular smooth muscle (23). To determine whether S100/calgranulin influences macrophage cholesterol homeostasis, we utilized a humanized transgenic mouse model with transgenic expression of hS100A12 and hS100A8/9 in cells of myeloid origin including macrophages. Under normal chow diet, we found no difference in plasma cholesterol and triglyceride levels between hBAC/S100 and age-matched WT-littermate controls (Fig. 1A). Moreover, there was no difference in the cholesterol content of the

Primer sequences

Forward Primer

Reverse Primer

GGTGGCCAATTCAGAAGAAGA ACACCTGCAGTTCATCAGTGGAGT TGTTCGACCAGCTTTACGTCCTGA GAGCGCTGCTATCTGATGAA CCTGGCGTCGTGATTAGTGATGAT GGAGTGCTGGATTAGTGGTTAG AGCATGTGGAGTTCTTTGCCCT TCTGCGAATCACCTCGCACATT AAGCCTAAGATGAGCGCAAG ATCGTCAACCGCACCTTTAT

CTACTGGGATGATGGTGTTTCC ATAATGACCAGTGTGGCAGGGACA TTGTGGTAGGTTGGGCAGTTCAGA GCACCACCTCCTGCATATAA AGCAAGACGTTCAGTCCTGTCCAT GCTGTGAGCAGACGTATAGAAG TTCGTTTGTTGCCGCCACTGTA AGGGCAGCAAACATGAGGAACA AGATGGCCACAGGACTAGAA GACTCCTCGGAACAGTTTCTC

IL-22 impairs cholesterol efflux in macrophages

445

Downloaded from www.jlr.org at UNIV OF SYDNEY (CAUL), on August 27, 2014

The macrophage cholesterol efflux assay was performed as described previously (30). Briefly, differentiated THP-1 cells and resident peritoneal macrophages were cultured overnight in complete RPMI (supplemented with 2 mM L-glutamine, 10% FBS, and 1% antibiotic-antimycotic), followed by washing with PBS and incubation for 24 h in RPMI cell culture medium supplemented with 1% FBS, 25 ␮g/ml acetylated LDL, and 3 ␮Ci/ ml [3H]cholesterol. After washing the cells with PBS, mouse serum at different final concentrations (0–5%) or mouse apolipoprotein A-I (apoA-I) (Sigma) were applied in FBS-free RPMI for 4 h. Cell-free medium was collected and lipids were extracted using a 1:1:8 ratio of medium:ice-cold isopropanol:hexane, and the top layer was collected and dried. The cells were washed twice with PBS and the cellular lipids were extracted three times using 500 ␮l per well of 3:2 hexane:isopropanol. Cell proteins were solubilized with 0.1 N NaOH and protein was measured using a Pierce Micro BCA protein kit. Extraction solvents were dried and reconstituted in Econofluor (Perkin- Elmer) and [3H]cholesterol was measured by scintillation counting. Cholesterol efflux was expressed as a percentage of counts in the medium compared with the total counts (cells plus medium) normalized to total cell protein.

Western blotting

lipoprotein particles separated by FPLC with hBAC/ S100 plasma showing a lipid profile similar to WT plasma (Fig. 1B). Consistent with comparable HDL cholesterol levels, apo A-I levels were not different between the two groups of mice as shown by immunoblotting (Fig. 1C). However, newly isolated peritoneal macrophages from hBAC/S100 showed slightly more intracellular lipid content upon staining with Oil Red O compared with control cells (Fig. 1Da, b). Importantly, when peritoneal macrophages were incubated with acetylated LDL for 24 h, hBAC/S100 peritoneal macrophages had significantly 446

Journal of Lipid Research Volume 55, 2014

higher lipid content than macrophages from WT mice as shown in Fig. 1Dc, d, and quantified in Fig. 1E. We then added 1% WT mouse serum to the acetylated LDL loaded cells for 24 h, anticipating that the mouse serum HDL would promote efflux of cholesterol from the macrophages. hBAC/S100 macrophages showed minimal reduction of Oil Red O staining or cholesterol content upon incubation with mouse serum, while WT macrophages had significantly reduced lipid content (Fig. 1De, f; quantified in Fig. 1E). These observations indicate that hBAC/ S100 peritoneal macrophages accumulate more lipids

Downloaded from www.jlr.org at UNIV OF SYDNEY (CAUL), on August 27, 2014

Fig. 1. Myeloid-derived S100/calgranulin promotes lipid accumulation in peritoneal macrophages of hBAC/S100 mice. A: Fasting total plasma cholesterol and triglycerides in WT and hBAC/S100 littermate mice. B: Cholesterol content in plasma fractions after separation by FPLC. C: ApoA-I concentration in 5 ␮l plasma were immunoblotted for apoA-I expression and quantified by densitometry. D: Peritoneal macrophages were stained for lipids with Oil Red O immediately after harvesting (a, b), after culture for 24 h with acetylated LDL (c, d), and after removing acetylated LDL followed by culture for 24 h with 1% mouse serum (e, f). E: Cholesterol content in peritoneal mac3 rophages from experiments shown in (D). F: [ H]cholesterol counts in peritoneal macrophages (normalized to cell protein) after incuba3 tion with [ H]cholesterol (± acetylated LDL) for 24 h. G: Cholesterol efflux from peritoneal macrophages was calculated as percentage of 3 [ H]cholesterol effluxed (counts in media) per total labeled cholesterol (counts in the cells and media) and normalized to total cell protein. Data are represented as mean ± SD.

S100/calgranulin-mediated reduction of cholesterol efflux in vivo is dependent on RAGE, but requires other systemic mediators To investigate underlying mechanisms leading to increased cholesterol accumulation and reduced efflux of free cholesterol in hBAC/S100 peritoneal macrophages, we measured mRNA of scavenger receptors LOX1, SRA, and CD36, and cholesterol transporters ABCA1 and ABCG1 in hBAC/S100 and WT peritoneal macrophages. CD36 mRNA was increased 3-fold, and ABCG1 mRNA was reduced by 80% in hBAC/S100 compared with WT macrophages (Fig. 2A). There was no difference in the mRNA for ABCA1, LOX1, and SRA (LOX1 and SRA data not shown). ABCG1 protein was significantly reduced in hBAC/S100 peritoneal macrophages compared with WT, while ABCA1 protein was expressed at equally low levels in both groups (Fig. 2B). CD36 protein expression was not different in hBAC/S100 peritoneal macrophages despite the higher level of CD36 mRNA in the cells (Fig. 2B). To examine whether reduced ABCG1 expression occurs in other cells/tissue, we examined bone marrow-derived macrophages and liver tissue. As shown in Fig. 2A, B, mRNA and protein levels of ABCG1, ABCA1, and CD36 were not different in bone marrow-derived macrophages between hBAC/S100 and WT controls. Similarly, there was no difference in ABCA1 and ABCG1 mRNA or protein levels in liver tissue (Fig. 2G, H). This later observation is in agreement with the finding of normal plasma cholesterol levels, lipoprotein profile, and plasma apoA-I levels in hBAC/S100 mice (Fig. 1A–C). Taken together, these data suggest that S100/calgranulin alters expression of ABCG1 in a tissue-specific context.

To gain more insight into underlying molecular signaling cascades of S100/calgranulins, we utilized mice lacking RAGE, the receptor for S100/calgranulin, and tested the hypothesis of whether RAGE is required to mediate the pathologic effects of S100/calgranulin on cholesterol homeostasis in peritoneal macrophages. hBAC/S100 mice were bred with homozygote RAGE-KO mice, and perito⫺/⫺ and WT/ neal macrophages from hBAC/S100/RAGE ⫺/⫺ littermate mice were analyzed for mRNA expresRAGE sion. As shown in Fig. 2C, D, mRNA and protein levels for ABCA1, ABCG1, and CD36 were similar in the two groups of mice, demonstrating that the altered expression of CD36 and ABCG1 seen in hBAC/S100 macrophages depends on intact RAGE signaling. This was further confirmed by Oil Red O staining of peritoneal macrophages. We found no difference in intracellular lipid accumulation in freshly isolated peritoneal macrophages in response to acetylated LDL, and after incubation of acetylated LDLloaded cells with mouse serum (Fig. 2E; quantified in Fig. 2F). Taken together, these observations demonstrate that S100/calgranulin-mediated increase in cholesterol uptake and reduction of cholesterol efflux in peritoneal macrophages in vivo are dependent on intact RAGE signaling. We next probed whether S100/calgranulin directly modifies cholesterol flux in macrophages. WT mouse peritoneal macrophages and human THP-1 macrophages, previously shown to respond to recombinant S100A12 with increased chemotaxis and migration (31, 32), were employed. As shown in Fig. 3A, recombinant S100A12 protein (2.5 ␮g/ml for 24 h) did not alter mRNA for ABCA1, ABCG1, or CD36 in peritoneal or THP-1 macrophages. Similar results were obtained after incubation with rS100A9 (data not shown). Taken together, our data show that S100/calgranulin transgenic mice have enhanced uptake and reduced efflux of cholesterol in peritoneal macrophages, but this is not mediated by a direct effect of S100A12 on macrophages. Further, this suggests that S100/calgranulin may promote some systemic intermediary products in vivo in a RAGE-dependent manner that influence macrophage cholesterol homeostasis. S100/calgranulin upregulates IL-22 in a RAGE-dependent manner Both S100/calgranulin and IL-22 are concomitantly increased systemically in several chronic inflammatory diseases, including inflammatory bowel disease and rheumatoid and psoriatic arthritis, and serve as biomarkers of disease activity. While it is established that IL-22 upregulates S100/ calgranulin in epithelial cells (3, 4, 33), it is not known whether S100/calgranulin induces IL-22. Surprisingly, plasma IL-22 was increased 6-fold in hBAC/S100 mice compared with age-matched WT controls, and was undetectable (below the sensitivity limit of the assay) in hBAC/ S100 mice deficient in RAGE (Fig. 4A). Because T cells are the primary source of IL-22, we next examined IL-22 mRNA in splenic T cells (Fig. 4B). In mice with intact RAGE signaling, we found significantly elevated IL-22 mRNA expression in hBAC/S100 splenic T cells compared IL-22 impairs cholesterol efflux in macrophages

447

Downloaded from www.jlr.org at UNIV OF SYDNEY (CAUL), on August 27, 2014

than control macrophages, and have a lower tendency to efflux cholesterol to acceptors. To further quantify cholesterol uptake and efflux in peritoneal macrophages from hBAC/S100 and WT con3 trols, we performed a cellular efflux assay with [ H]choles3 terol. As shown in Fig. 1F, cellular uptake of free [ H] cholesterol by diffusion was similar between macrophages from hBAC/S100 and WT mice, while receptor-mediated uptake of acetylated LDL/[3H]cholesterol was significantly increased in hBAC/S100 cells compared with WT cells (Fig. 1F). To measure efflux, mouse serum at different final concentrations of 0–5% was added to the cell culture media. As shown in Fig. 1G, cholesterol efflux from cholesterol-loaded peritoneal macrophages in the presence of 0% mouse serum was similar between hBAC/S100 and WT cells. Importantly, addition of 0.5 or 1% mouse serum significantly increased the efflux of cholesterol from WT cells, while it had minimal effect on efflux from hBAC/S100 macrophages. At higher concentrations of 2.5 and 5% mouse serum, cholesterol efflux from hBAC/S100 macrophages and WT cells plateaued and were similar. These data demonstrate the inherent capacity for hBAC/ S100 peritoneal macrophages to have increased cholesterol uptake together with decreased cholesterol efflux activity.

Downloaded from www.jlr.org at UNIV OF SYDNEY (CAUL), on August 27, 2014

Fig. 2. Myeloid-derived S100/calgranulin-induced lipid accumulation in peritoneal macrophages of hBAC/S100 is regulated by RAGE. A: Peritoneal and bone marrow (BM)-derived macrophage mRNA was analyzed by quantitative real-time RT-PCR for ABCA1, ABCG1, and CD36 in WT and hBAC/S100 cells. B: Protein extracts from WT and hBAC/S100 peritoneal (25 ␮g) and bone marrow-derived macrophages (100 ␮g) were immunoblotted for mouse ABCA1, ABCG1, and CD36 and quantified by densitometry. C, D: ABCA1, ABCG1, and CD36 mRNA expression (C) and protein expression (D) in peritoneal macrophages harvested from RAGE-deficient WT and hBAC/S100 mice. E: Peritoneal macrophages from RAGE-deficient hBAC/S100 and age-matched control mice (RAGE-deficient WT) were stained for lipids with Oil Red O immediately after harvesting (a, b), after culture for 24 h with acetylated LDL (c, d), and after removing acetylated LDL followed by culture for 24 h with 1% mouse serum (e, f). F: Cholesterol content in peritoneal macrophages from experiments shown in (E). G, H: ABCA1 and ABCG1 mRNA expression (G) and protein expression (H) in liver tissue from WT and hBAC/S100 mice.

448

Journal of Lipid Research Volume 55, 2014

RAGE (31 ± 6 ng/ml vs. 43 ± 7 ng/ml, P = 0.25). In contrast to the increased IL-22, other members of the IL-10 cytokine family were not different between hBAC/S100 and WT mice. IL-10 mRNA in peritoneal macrophages, IL-17 mRNA in T cells (Fig. 4F), and plasma concentration for IL-17 and IL-10 (Fig. 4G, H) were not significantly different between hBACS/100 and WT mice, although the plasma IL-10 level was slightly, but not significantly, reduced. Taken together, our data suggest that S100/calgranulin induces IL-22 secretion in vivo, and this is dependent on intact RAGE signaling in splenic T cells.

with WT cells. This difference was not observed in T cells from hBAC/S100 mice lacking RAGE. Surprisingly, even WT RAGE⫺/⫺ T cells had significantly reduced IL-22 mRNA compared with WT T cells with intact RAGE. The number of T cells per spleen was not different between the four groups (data not shown). Similarly, IL-22 mRNA was increased in bone marrow-derived macrophages harvested from hBAC/S100 mice (Fig. 4C). Taken together, these data demonstrate that S100/calgranulin induces IL-22 secretion in a RAGE-dependent manner. We next examined whether recombinant S100A12 protein is sufficient to directly stimulate IL-22 production in cultured macrophages. We observed a 3.5-fold increase in IL-22 mRNA in THP-1 macrophages in response to recombinant (r)S100A12 compared with control-treated cells (Fig. 4D). In contrast, rS100A9 did not increase IL-22 mRNA (data not shown). We measured the level of other cytokines in the plasma of hBAC/S100 mice because S100A12A was previously shown to induce IL-6, TNF␣, and other cytokines (19, 31, 34). IL-6 was increased 2-fold in hS100/calgranulin transgenic mice, while TNF␣ and IL-1␤ levels were similar to WT mice (Fig. 4E and data not shown). Moreover, IL-6 was only slightly, and not significantly, reduced in hBAC/S100 RAGE⫺/⫺ compared with hBAC/S100 mice with intact

IL-22 impairs cholesterol efflux in macrophages

449

Downloaded from www.jlr.org at UNIV OF SYDNEY (CAUL), on August 27, 2014

Fig. 3. Recombinant S100A12 protein does not affect expression of cholesterol transport proteins in macrophages. A, B: ABCA1, ABCG1, and CD36 mRNA (A) and protein (B) of WT peritoneal macrophages and THP-1 cells treated with recombinant S100A12 or BSA (2.5 ␮g/ml, R&D Systems). Data are represented as mean ± SD.

Recombinant IL-22 downregulates ABCG1 and impairs cholesterol efflux in THP-1 macrophages We next analyzed whether IL-22 regulates macrophage ABCA1, ABCG1, or CD36 expression. We found that at high doses recombinant (r)IL-22 downregulates ABCG1 mRNA in human THP-1 macrophages (Fig. 5A), while there was a nonsignificant trend toward reducing ABCA1 mRNA levels. Reduction in ABCG1 mRNA and protein was seen at 1, 6, and 24 h after treatment with 100 ng/ml rIL-22 compared with BSA-vehicle-treated controls (Fig. 5B, C). In contrast, IL-22 had no effect on CD36 mRNA (Fig. 5D). CD36 activity is induced by oxidized LDL and other ligands and is an important determinant of cholesterol uptake and net cholesterol content (35), while the activity of the cholesterol transporters ABCA1 and ABCG1 in macrophages is largely regulated by cholesterol derivatives (oxysterols) activating the nuclear transcription factor LXR (36). Our finding that IL-22 reduces ABCG1 without any effect on CD36 mRNA suggests that IL-22 may specifically regulate pathways linked to LXR. This view is supported by recent findings demonstrating that LXR activation regulates Th17 cell differentiation and autoimmunity (37). To determine whether IL-22 modulates cellular free cholesterol efflux, we analyzed the impact of IL-22 on cholesterol efflux from THP-1 macrophages to mouse serum. As expected, THP-1 macrophages incubated with IL-22 showed reduced efflux of [3H]labeled cholesterol (Fig. 5E) when incubated with 0.5 or 1% mouse serum, but this effect was abolished at higher concentrations of cholesterol acceptor (2.5 and 5% mouse serum). This suggests that the detrimental effects of IL-22 on cholesterol efflux to mouse serum are more pronounced in the setting of low levels of acceptor, which is mostly HDL in mouse serum. In contrast, when cholesterol-labeled THP-1 cells were treated with apoA-I as the cholesterol acceptor in place of mouse serum, there was no difference in cholesterol efflux between IL-22 and control treated THP-1 cells (Fig. 5E). Moreover, IL-22 had no effect on the uptake of [3H]labeled cholesterol (Fig. 5F). These findings suggest that IL-22 impairs ABCG1/HDL-mediated, but not ABCA1/apoA-I-mediated, cholesterol efflux in THP-1 macrophages, likely via downregulating the expression of ABCG1. We next queried whether upregulation of endogenous ABCG1 would attenuate the detrimental effects of IL-22 on cholesterol efflux. THP-1 cells were treated with 10 ␮M

Downloaded from www.jlr.org at UNIV OF SYDNEY (CAUL), on August 27, 2014

Fig. 4. IL-22 is upregulated in hBAC/S100 mice in a RAGE-dependent manner. A: Plasma concentration of IL-22 in WT and hBAC/S100 ⫺/⫺ and hBAC/S100/RAGE⫺/⫺ mice as determined by ELISA. B: qRT-PCR of IL-22 mRNA in primary T cells harmice and in WT/RAGE +/+ ⫺/⫺ vested from either RAGE-intact (RAGE ) or RAGE-deficient (RAGE ) spleens from WT or hBAC/S100 mice. C: qRT-PCR of IL-22 mRNA in bone marrow (BM)-derived macrophages from WT and hBAC/S100 mice with intact RAGE. D: qRT-PCR of IL-22 mRNA in THP-1 macrophages treated with recombinant S100A12 or BSA (2.5 ␮g/ml, R&D Systems). E: Plasma concentration of IL-6. F: qRT-PCR of IL-17 mRNA in splenic T cells and of IL-10 mRNA in peritoneal macrophages. G, H: IL-17 (G) and IL-10 (H) in WT and hBAC/S100 mice as determined by ELISA. Data are represented as mean ± SD.

450

Journal of Lipid Research Volume 55, 2014

Downloaded from www.jlr.org at UNIV OF SYDNEY (CAUL), on August 27, 2014

Fig. 5. rIL-22 downregulates ABCG1 and impairs cholesterol efflux in THP-1 macrophages. A: qRT-PCR of ABCA1 and ABCG1 expression in THP-1 macrophages incubated with increasing concentrations of recombinant human IL-22 for 24 h. B: qRT-PCR of ABCA1 and ABCG1 expression in THP-1 macrophages incubated with 100 ng/ml recombinant human IL-22 for 1, 6, and 24 h compared with control cells treated with BSA. C: Total protein lysate (25 ␮g) of THP-1 macrophages was immunoblotted for human ABCA1 and ABCG1 after treatment with rIL22 as indicated and quantified by densitometry. D: qRT PCR for CD36 in THP-1 macrophages incubated with 100 ng/ml recombinant human IL-22 for 1 and 24 h compared with control cells. E: Cholesterol efflux by THP-1 macrophages incubated with either recombinant human IL-22 or control BSA (100 ng/ml for 24 h) in the presence of either increasing concentrations of mouse serum or 3 human apoA-I for 4 h. Efflux was calculated as percentage of [ H]cholesterol effluxed (counts in media) per total labeled cholesterol

IL-22 impairs cholesterol efflux in macrophages

451

TO-901317 (an LXR agonist), which significantly upregulated ABCA1 (ⵑ3-fold) and ABCG1 (ⵑ3.5-fold) mRNA in THP-1 cells (Fig. 5G). Importantly, IL-22 did not reduce cholesterol efflux in THP-1 cells pretreated with LXR agonist (Fig. 5H). This suggests that endogenous upregulation of ABCG1 and ABCA1 attenuates the detrimental effect of IL-22 on cholesterol efflux in macrophages.

DISCUSSION

(counts in the cells and media) normalized to total cell protein. F: [3H]cholesterol counts in THP-1 macrophages after incubation with 3 [ H]cholesterol with and without IL-22. G: qRT-PCR of ABCA1 and ABCG1 expression in THP-1 macrophages incubated with 10 ␮M TO3 901317 (LXR agonist) or control BSA for 24 h. H: Cholesterol efflux by THP-1 macrophages treated as indicated for 24 h followed by [ H] 3 cholesterol. Efflux was calculated as percentage of [ H]cholesterol effluxed (counts in media) per total labeled cholesterol (counts in the cells and media) normalized to total cell protein. Data are represented as mean ± SD.

452

Journal of Lipid Research Volume 55, 2014

Downloaded from www.jlr.org at UNIV OF SYDNEY (CAUL), on August 27, 2014

Our studies demonstrate that S100/calgranulin transgenic mice have increased IL-22 expression and the novel finding that increased IL-22 levels are associated with increased lipid content and reduced cholesterol efflux in macrophages. Furthermore, in vitro, we demonstrate that IL-22 reduces expression of ABCG1. The ability of S100/ calgranulin to induce IL-22 in hBAC/S100 transgenic mice depends on intact signaling of RAGE, because mice lacking RAGE had reduced IL-22 mRNA in splenic T cells and undetectable levels of IL-22 in the plasma. Our data suggest that S100/calgranulin and IL-22 are important regulators of cholesterol homeostasis. In early atherosclerotic lesions, macrophage cholesterol is mainly in the form of cholesteryl esters stored as cytoplasmic lipid droplets with very little free cholesterol. The hydrolysis of these cytoplasmic cholesteryl esters and the subsequent removal of the resulting free cholesterol are dependent on the net influx of cholesterol to the cellular pool and the efflux of cholesterol from the cells to acceptors such as apoA-I or HDL (38, 39). Reduced hydrolytic capability of the liposomes or reduced cholesterol efflux out of the cells via reduced cholesterol transporter activity leads to accumulation of free cholesterol within the foam cells (24). As early lesions develop to advanced lesions, free cholesterol crystals form (40–42), and these have been suggested to contribute to plaque rupture and subsequent thrombosis (43, 44). We previously reported accelerated atherosclerosis with large cholesterol crystal deposits in apoE-deficient mice with transgenic expression of S100A12 in the vasculature under control of the SM22 promoter (23), suggesting a possible role of S100A12 as a promoter of cellular cholesterol accumulation via increased scavenger receptor activity and/or impaired cholesterol transporter activity in the macrophages. Utilizing hBAC/S100 mice that express human S100A8/9 and S100A12 in a manner similar to the expression pattern found in humans and without the limitations of using a tissue-specific promoter, we studied the impact of myeloid-derived S100/calgranulins on cholesterol homeostasis in macrophages. The reduced ABCG1 and increased CD36 mRNA levels in hBAC/S100 peritoneal macrophages suggests an environment conducive for

lipid accumulation, which was confirmed upon Oil Red O staining, enhanced uptake of lipid, and by reduced cholesterol efflux capacity. These characteristics indicate that S100/calgranulin may have a role in foam cell formation. To our surprise, we found no change in cholesterol transporter activity in hBAC/S100 bone marrow-derived macrophages despite expression of S100A12 throughout the 7 days of cell culture required for macrophage differentiation in vitro (data not shown). This, and the lack of an effect of rS100A12 on ABCA1/ABCG1 mRNA in THP-1 cells, suggests that S100A12 may be indirectly responsible for the downregulation of ABCG1, possibly by promoting a “pro-inflammatory milieu” in hBAC/S100 mice. A proinflammatory role of S100A12 with increased IL-6 production is well established, and we and others have shown that S100A12 activates RAGE (19, 21) and Toll-like receptor 4 (45). However, this is the first report demonstrating an important role for S100/calgranulin in mediating secretion of IL-22, and our in vivo data show that this is regulated by RAGE. A link between IL-22 and S100/calgranulin is suggested by the fact that both cytokines are increased concomitantly in inflamed tissue of certain autoimmune diseases including psoriasis, rheumatoid arthritis, and inflammatory bowel disease, as reported by many investigators. For example, it has been reported that cultured keratinocytes display increased S100/calgranulin mRNA in response to IL-22 or IL-17 (33). In addition, our findings presented here demonstrate that S100/calgranulin, in a RAGE-dependent manner, regulates IL-22 production in T cells in vivo. Although RAGE is mostly known as a receptor expressed in vascular endothelium, smooth muscle cells, and macrophages promoting vascular inflammation (46), there is growing evidence that RAGE is involved in T cell differentiation (47). An elegant study by Akirav et al. (48) demonstrated that human T cells lacking RAGE failed to upregulate IL-17 in response to stimulatory signals, while the levels of other cytokines including IFN␥, TNF␣, and IL-2 were not different between RAGE+ and RAGE– human T cells. IL-22 was not reported in this study, but our current findings of abolished IL-22 secretion in RAGE⫺/⫺ mice suggest strongly that RAGE is critically important for baseline IL-22 secretion, as well as in response to S100/ calgranulin. To our knowledge, an association of elevated IL-22 with decreased ABCG1 expression and reduced cholesterol efflux has not been reported. Although there are possibly other metabolic factors that may account for our findings in hBAC/S100 mice, we propose that IL-22, at least in part, mediates altered cholesterol transport in macrophages. This is supported by the in vitro experiments demonstrating that rIL-22 downregulates ABCG1 expression in THP-1 macrophages and is functionally validated by reduced

The authors thank Dr. Michael Broman for comments on the manuscript.

REFERENCES 1. Zenewicz, L. A., and R. A. Flavell. 2011. Recent advances in IL-22 biology. Int. Immunol. 23: 159–163. 2. Pan, H. F., X. P. Li, S. G. Zheng, and D. Q. Ye. 2013. Emerging role of interleukin-22 in autoimmune diseases. Cytokine Growth Factor Rev. 24: 51–57. 3. Kolls, J. K., P. B. McCray, and Y. R. Chan. 2008. Cytokine-mediated regulation of antimicrobial proteins. Nat. Rev. Immunol. 8: 829–835. 4. Wolk, K., E. Witte, E. Wallace, W. D. Döcke, S. Kunz, K. Asadullah, H. D. Volk, W. Sterry, and R. Sabat. 2006. IL-22 regulates the expression of genes responsible for antimicrobial defense, cellular differentiation, and mobility in keratinocytes: a potential role in psoriasis. Eur. J. Immunol. 36: 1309–1323. 5. Boniface, K., E. Guignouard, N. Pedretti, M. Garcia, A. Delwail, F. X. Bernard, F. Nau, G. Guillet, G. Dagregorio, H. Yssel, et al. 2007. A role for T cell-derived interleukin 22 in psoriatic skin inflammation. Clin. Exp. Immunol. 150: 407–415. 6. Wolk, K., H. S. Haugen, W. Xu, E. Witte, K. Waggie, M. Anderson, E. Vom Baur, K. Witte, K. Warszawska, S. Philipp, et al. 2009. IL-22 and IL-20 are key mediators of the epidermal alterations in psoriasis while IL-17 and IFN-gamma are not. J. Mol. Med. (Berl.). 87: 523–536. 7. Geboes, L., L. Dumoutier, H. Kelchtermans, E. Schurgers, T. Mitera, J. C. Renauld, and P. Matthys. 2009. Proinflammatory role of the Th17 cytokine interleukin-22 in collagen-induced arthritis in C57BL/6 mice. Arthritis Rheum. 60: 390–395. 8. Meephansan, J., K. Ruchusatsawat, W. Sindhupak, P. S. Thorner, and J. Wongpiyabovorn. 2011. Effect of methotrexate on serum levels of IL-22 in patients with psoriasis. Eur. J. Dermatol. 21: 501–504. 9. da Rocha, L. F., Jr., A. L. Duarte, A. T. Dantas, H. A. Mariz, R. Pitta Ida, S. L. Galdino, and M. G. Pitta. 2012. Increased serum interleukin 22 in patients with rheumatoid arthritis and correlation with disease activity. J. Rheumatol. 39: 1320–1325. 10. Friedewald, V. E., J. C. Cather, J. M. Gelfand, K. B. Gordon, G. H. Gibbons, S. M. Grundy, M. T. Jarratt, J. G. Krueger, P. M. Ridker, N. Stone, et al. 2008. AJC editor’s consensus: psoriasis and coronary artery disease. Am. J. Cardiol. 102: 1631–1643.

11. Bobryshev, Y. V., V. R. Babaev, S. Iwasa, R. S. Lord, and T. Watanabe. 1999. Atherosclerotic lesions of apolipoprotein E deficient mice contain cells expressing S100 protein. Atherosclerosis. 143: 451–454. 12. Burke, A. P., F. D. Kolodgie, A. Zieske, D. R. Fowler, D. K. Weber, P. J. Varghese, A. Farb, and R. Virmani. 2004. Morphologic findings of coronary atherosclerotic plaques in diabetics: a postmortem study. Arterioscler. Thromb. Vasc. Biol. 24: 1266–1271. 13. Healy, A. M., M. D. Pickard, A. D. Pradhan, Y. Wang, Z. Chen, K. Croce, M. Sakuma, C. Shi, A. C. Zago, J. Garasic, et al. 2006. Platelet expression profiling and clinical validation of myeloid-related protein-14 as a novel determinant of cardiovascular events. Circulation. 113: 2278–2284. 14. Morrow, D. A., Y. Wang, K. Croce, M. Sakuma, M. S. Sabatine, H. Gao, A. D. Pradhan, A. M. Healy, J. Buros, C. H. McCabe, et al. 2008. Myeloid-related protein 8/14 and the risk of cardiovascular death or myocardial infarction after an acute coronary syndrome in the Pravastatin or Atorvastatin Evaluation and Infection Therapy: Thrombolysis in Myocardial Infarction (PROVE IT-TIMI 22) trial. Am. Heart J. 155: 49–55. 15. Foell, D., D. Kane, B. Bresnihan, T. Vogl, W. Nacken, C. Sorg, O. Fitzgerald, and J. Roth. 2003. Expression of the pro-inflammatory protein S100A12 (EN-RAGE) in rheumatoid and psoriatic arthritis. Rheumatology (Oxford). 42: 1383–1389. 16. Brinar, M., I. Cleynen, T. Coopmans, G. Van Assche, P. Rutgeerts, and S. Vermeire. 2010. Serum S100A12 as a new marker for inflammatory bowel disease and its relationship with disease activity. Gut. 59: 1728–1729. 17. Baillet, A., C. Trocmé, S. Berthier, M. Arlotto, L. Grange, J. Chenau, S. Quétant, M. Sève, F. Berger, R. Juvin, et al. 2010. Synovial fluid proteomic fingerprint: S100A8, S100A9 and S100A12 proteins discriminate rheumatoid arthritis from other inflammatory joint diseases. Rheumatology (Oxford). 49: 671–682. 18. Averill, M. M., C. Kerkhoff, and K. E. Bornfeldt. 2012. S100A8 and S100A9 in cardiovascular biology and disease. Arterioscler. Thromb. Vasc. Biol. 32: 223–229. 19. Hofmann, M. A., S. Drury, C. Fu, W. Qu, A. Taguchi, Y. Lu, C. Avila, N. Kambham, A. Bierhaus, P. Nawroth, et al. 1999. RAGE mediates a novel proinflammatory axis: a central cell surface receptor for S100/calgranulin polypeptides. Cell. 97: 889–901. 20. Xie, J., D. S. Burz, W. He, I. B. Bronstein, I. Lednev, and A. Shekhtman. 2007. Hexameric calgranulin C (S100A12) binds to the receptor for advanced glycated end products (RAGE) using symmetric hydrophobic target-binding patches. J. Biol. Chem. 282: 4218–4231. 21. Yan, L., P. Bjork, R. Butuc, J. Gawdzik, J. Earley, G. Kim, and M. A. Hofmann Bowman. 2013. Beneficial effects of quinoline-3-carboxamide (ABR-215757) on atherosclerotic plaque morphology in S100A12 transgenic ApoE null mice. Atherosclerosis. 228: 69–79. 22. Srikrishna, G., J. Nayak, B. Weigle, A. Temme, D. Foell, L. Hazelwood, A. Olsson, N. Volkmann, D. Hanein, and H. H. Freeze. 2010. Carboxylated N-glycans on RAGE promote S100A12 binding and signaling. J. Cell. Biochem. 110: 645–659. 23. Hofmann Bowman, M. A., J. Gawdzik, U. Bukhari, A. N. Husain, P. T. Toth, G. Kim, J. Earley, and E. M. McNally. 2011. S100A12 in vascular smooth muscle accelerates vascular calcification in apolipoprotein E-null mice by activating an osteogenic gene regulatory program. Arterioscler. Thromb. Vasc. Biol. 31: 337–344. 24. Tabas, I. 2002. Consequences of cellular cholesterol accumulation: basic concepts and physiological implications. J. Clin. Invest. 110: 905–911. 25. Abela, G. S. 2010. Cholesterol crystals piercing the arterial plaque and intima trigger local and systemic inflammation. J. Clin. Lipidol. 4: 156–164. 26. Kennedy, M. A., G. C. Barrera, K. Nakamura, A. Baldán, P. Tarr, M. C. Fishbein, J. Frank, O. L. Francone, and P. A. Edwards. 2005. ABCG1 has a critical role in mediating cholesterol efflux to HDL and preventing cellular lipid accumulation. Cell Metab. 1: 121–131. 27. Jessup, W., I. C. Gelissen, K. Gaus, and L. Kritharides. 2006. Roles of ATP binding cassette transporters A1 and G1, scavenger receptor BI and membrane lipid domains in cholesterol export from macrophages. Curr. Opin. Lipidol. 17: 247–257. 28. Weischenfeldt, J., and B. Porse. 2008. Bone marrow-derived macrophages (BMM): isolation and applications. CSH Protoc. 2008: doi:10. 1101/pdb.prot5080. 29. Schwende, H., E. Fitzke, P. Ambs, and P. Dieter. 1996. Differences in the state of differentiation of THP-1 cells induced by phorbol ester and 1,25-dihydroxyvitamin D3. J. Leukoc. Biol. 59: 555–561.

IL-22 impairs cholesterol efflux in macrophages

453

Downloaded from www.jlr.org at UNIV OF SYDNEY (CAUL), on August 27, 2014

cholesterol efflux. Mehta et al. (49) recently reported on reduced cholesterol efflux capacity of serum from patients with psoriasis. Although the IL-22 level was not reported in this cohort study, our data raises the hypothesis that elevated IL-22 levels often associated with autoimmune diseases, including psoriasis and rheumatoid arthritis, may mediate reduced cholesterol efflux in foam cells. Further investigations probing a potential pro-atherogenic role of IL-22 are warranted, because to our knowledge, there are no reports in the literature providing experimental proof that IL-22 promotes atherosclerosis. In summary, we demonstrate that myeloid-derived S100/calgranulin induces IL-22 secretion from T cells in a RAGE-dependent manner and this is associated with reduced cholesterol efflux in peritoneal macrophages in hBAC/S100 mice. IL-22 is suggested, at least in part, to mediate this effect by reducing ABCG1 expression. IL-22 is a cytokine associated with autoimmune diseases, including psoriasis and rheumatoid arthritis, and our data raise the hypothesis that S100/calgranulin and IL-22 may contribute to the accelerated atherosclerosis and the increased risk for plaque instability in these patients, possibly by reducing the cholesterol efflux capacity of macrophages.

454

Journal of Lipid Research Volume 55, 2014

40. Small, D. M., M. G. Bond, D. Waugh, M. Prack, and J. K. Sawyer. 1984. Physicochemical and histological changes in the arterial wall of nonhuman primates during progression and regression of atherosclerosis. J. Clin. Invest. 73: 1590–1605. 41. Rapp, J. H., W. E. Connor, D. S. Lin, T. Inahara, and J. M. Porter. 1983. Lipids of human atherosclerotic plaques and xanthomas: clues to the mechanism of plaque progression. J. Lipid Res. 24: 1329–1335. 42. Lundberg, B. 1985. Chemical composition and physical state of lipid deposits in atherosclerosis. Atherosclerosis. 56: 93–110. 43. Abela, G. S., and K. Aziz. 2005. Cholesterol crystals cause mechanical damage to biological membranes: a proposed mechanism of plaque rupture and erosion leading to arterial thrombosis. Clin. Cardiol. 28: 413–420. 44. Abela, G. S., K. Aziz, A. Vedre, D. R. Pathak, J. D. Talbott, and J. Dejong. 2009. Effect of cholesterol crystals on plaques and intima in arteries of patients with acute coronary and cerebrovascular syndromes. Am. J. Cardiol. 103: 959–968. 45. Foell, D., H. Wittkowski, C. Kessel, A. Luken, T. Weinhage, G. Varga, T. Vogl, T. Wirth, D. Viemann, P. Bjork, et al. 2013. Proinflammatory S100A12 can activate human monocytes via Toll-like receptor 4. Am. J. Respir. Crit. Care Med. 187: 1324–1334. 46. Yan, S. F., R. Ramasamy, and A. M. Schmidt. 2010. The RAGE axis: a fundamental mechanism signaling danger to the vulnerable vasculature. Circ. Res. 106: 842–853. 47. Chen, Y., E. M. Akirav, W. Chen, O. Henegariu, B. Moser, D. Desai, J. M. Shen, J. C. Webster, R. C. Andrews, A. M. Mjalli, et al. 2008. RAGE ligation affects T cell activation and controls T cell differentiation. J. Immunol. 181: 4272–4278. 48. Akirav, E. M., P. Preston-Hurlburt, J. Garyu, O. Henegariu, R. Clynes, A. M. Schmidt, and K. C. Herold. 2012. RAGE expression in human T cells: a link between environmental factors and adaptive immune responses. PLoS ONE. 7: e34698. 49. Mehta, N. N., R. Li, P. Krishnamoorthy, Y. Yu, W. Farver, A. Rodrigues, A. Raper, M. Wilcox, A. Baer, S. DerOhannesian, et al. 2012. Abnormal lipoprotein particles and cholesterol efflux capacity in patients with psoriasis. Atherosclerosis. 224: 218–221.

Downloaded from www.jlr.org at UNIV OF SYDNEY (CAUL), on August 27, 2014

30. Liu, L., A. E. Bortnick, M. Nickel, P. Dhanasekaran, P. V. Subbaiah, S. Lund-Katz, G. H. Rothblat, and M. C. Phillips. 2003. Effects of apolipoprotein A-I on ATP-binding cassette transporter A1mediated efflux of macrophage phospholipid and cholesterol: formation of nascent high density lipoprotein particles. J. Biol. Chem. 278: 42976–42984. 31. Yang, Z., T. Tao, M. J. Raftery, P. Youssef, N. Di Girolamo, and C. L. Geczy. 2001. Proinflammatory properties of the human S100 protein S100A12. J. Leukoc. Biol. 69: 986–994. 32. Kishimoto, K., S. Kaneko, K. Ohmori, T. Tamura, and K. Hasegawa. 2006. Olopatadine suppresses the migration of THP-1 monocytes induced by S100A12 protein. Mediators Inflamm. 2006: 42726. 33. Guttman-Yassky, E., M. A. Lowes, J. Fuentes-Duculan, L. C. Zaba, I. Cardinale, K. E. Nograles, A. Khatcherian, I. Novitskaya, J. A. Carucci, R. Bergman, et al. 2008. Low expression of the IL-23/Th17 pathway in atopic dermatitis compared to psoriasis. J. Immunol. 181: 7420–7427. 34. Hofmann Bowman, M., J. Wilk, A. Heydemann, G. Kim, J. Rehman, J. A. Lodato, J. Raman, and E. M. McNally. 2010. S100A12 mediates aortic wall remodeling and aortic aneurysm. Circ. Res. 106: 145–154. 35. Han, J., D. P. Hajjar, M. Febbraio, and A. C. Nicholson. 1997. Native and modified low density lipoproteins increase the functional expression of the macrophage class B scavenger receptor, CD36. J. Biol. Chem. 272: 21654–21659. 36. Costet, P., Y. Luo, N. Wang, and A. R. Tall. 2000. Sterol-dependent transactivation of the ABC1 promoter by the liver X receptor/retinoid X receptor. J. Biol. Chem. 275: 28240–28245. 37. Cui, G., X. Qin, L. Wu, Y. Zhang, X. Sheng, Q. Yu, H. Sheng, B. Xi, J. Z. Zhang, and Y. Q. Zang. 2011. Liver X receptor (LXR) mediates negative regulation of mouse and human Th17 differentiation. J. Clin. Invest. 121: 658–670. 38. Brown, M. S., J. L. Goldstein, M. Krieger, Y. K. Ho, and R. G. Anderson. 1979. Reversible accumulation of cholesteryl esters in macrophages incubated with acetylated lipoproteins. J. Cell Biol. 82: 597–613. 39. Ho, Y. K., M. S. Brown, and J. L. Goldstein. 1980. Hydrolysis and excretion of cytoplasmic cholesteryl esters by macrophages: stimulation by high density lipoprotein and other agents. J. Lipid Res. 21: 391–398.