Vol. 65, No. 12
JOURNAL OF VIROLOGY, Dec. 1991, p. 6478-6485
0022-538X/91/126478-08$02.00/0 Copyright ©) 1991, American Society for Microbiology
Carboxyl-Terminal Determinants of Abelson Protein Important for Lymphoma Induction KALINDI PARMAR,1 ROBERT C. HUEBNER,2t AND NAOMI ROSENBERGl.2* Departments of Pathology' and Molecular Biology and Microbiology,2 Tufts University School of Medicine, 136 Harrison Avenue, Boston, Massachusetts 02111 Received 24 June 1991/Accepted 11 September 1991 The carboxyl-terminal region of the Abelson protein is not absolutely required for Abelson virus transformation. However, Abelson virus strains encoding proteins missing portions of this region have a reduced ability to transform lymphoid cells in vitro and in vivo. One such strain, called P9OA, is unique in that P9OA-injected mice almost always develop tumors containing highly oncogenic variants that encode new forms of Abelson protein. In this work, we have examined the mechanism by which these variants are generated and used the variants to identify carboxyl-terminal protein sequences important for the induction of Abelson disease. Analysis of mice injected with helper-free P9OA virus stocks demonstrates that the variants are generated during viral replication in vivo, probably as a consequence of error-prone reverse transcription. The sequence of the P9OA viral genome reveals that a 19-base deletion is responsible for synthesis of the truncated Abelson protein. As a consequence of this mutation, 167 carboxyl-terminal amino acids normally found in the wild-type protein have been replaced by 33 amino acids derived from an alternative reading frame. Site-directed mutants show that the combination of the deletion and the P9OA carboxyl terminus is required for the generation of variants. Thus, the particular structure of the P9OA protein, not the specific residues lost or gained, alters the transforming potential of the Abelson protein. Finally, the sequence of the variants encoding smaller Abelson proteins reveals that as few as 452 v-abl-encoded amino acids are required for rapid induction of Abelson disease.
(1, 22). However, most Ab-MLV mutants that fail to express the complete carboxyl terminus of Abelson protein display reduced lethality in 3T3 cells (7, 44, 49) and are highly compromised in their ability to induce lymphomas and transform pre-B cells (23, 24, 30, 43). In addition, genetically engineered mice that express a c-abl protein lacking the carboxyl-terminal region fail to thrive (5a, 36). These data suggest that the carboxyl termini of both the normal and activated forms of abl proteins play an important role in protein function. In contrast to most mutants encoding Abelson proteins that lack a complete carboxyl terminus, we have previously reported a series of highly tumorigenic carboxyl-terminal truncation mutants (19). These viruses arose in mice injected with the Ab-MLV P90A strain, a carboxyl-terminal truncation mutant derived from the P120 wild-type strain (31). In this report, we have identified the sequences that render the P9OA strain weakly oncogenic and used the variants to map carboxyl-terminal sequences that are important for high levels of tumor induction by Ab-MLV. These studies demonstrate that P9OA variants are generated in vivo during virus replication and that as few as 452 v-abl residues are required for efficient lymphoma induction.
Abelson murine leukemia virus (Ab-MLV) is a highly oncogenic retrovirus with a broad transformation spectrum that includes several fibroblast cell lines and cells belonging to most hematopoietic lineages (reviewed in reference 32). In vivo, the virus usually induces pre-B lymphomas, but other tumors have been observed (32). The virus encodes a single protein called the Abelson protein (27, 48), and transformation is mediated by the protein tyrosine kinase (PTK) activity of this molecule (5, 13, 22, 28, 39, 47). The Abelson protein contains amino-terminal sequences specified by a portion of the Moloney murine leukemia virus (Mo-MLV)derived gag gene and carboxyl-terminal sequences encoded by v-abl (32). The portion of the protein required for PTK activity directly follows the gag-derived sequences and is highly related to that of other cytoplasmic PTKs (10). However, unlike all other members of the PTK family, abl-derived proteins contain an additional 631 amino acids, usually referred to as the carboxyl-terminal region, that are unrelated to those found in other known proteins (11, 15, 26, 38). The function of the carboxyl terminus of abl-derived proteins is poorly understood. The region is the least conserved among c-abl proteins (11, 15, 26, 38), but it does contain sites of phosphorylation (21), two of which are modified by protein kinase C (20). A putative nuclear localization signal has also been noted in this region (41), but this sequence is absent in many transforming strains of AbMLV. Indeed, the functional importance of any of these sites has been difficult to pinpoint, and the region is not absolutely required for PTK activity (42) or transformation
MATERIALS AND METHODS Cell culture and viruses. Normal and Ab-MLV-transformed NIH 3T3 cells were grown in Dulbecco's modified Eagle's medium supplemented to contain 10% newborn calf serum (Sigma). This medium, further supplemented with 15 Vig of hypoxanthine per ml-250 jig of xanthine per ml-25 ,g of mycophenolic acid per ml-200 ,ug of hygromycin-B per ml, was used to grow the GP+envAM12 packaging cell line (18). Transformed lymphoid cells were grown in RPMI 1640 supplemented to contain 10% fetal calf serum (Hyclone) and
* Corresponding author. t Present address: Connaught Laboratories, Swiftwater, PA
18370. 6478
ABELSON PROTEIN DETERMINANTS
VOL. 65, 1991
50 ,uM 2-mercaptoethanol. Tumor cells were cultured from the bone marrow of diseased animals as described previously (19). Some Ab-MLV stocks were prepared from clonally derived transformed NIH 3T3 virus nonproducer cells that had been superinfected with Mo-MLV as described previously (19). In other cases, virus was harvested from NIH 3T3 cells transfected (3, 45) with plasmids containing Ab-MLV sequences and either p8.2 (37) or pNCA (16), plasmids containing infectious clones of Mo-MLV. Virus was harvested from transformed cells 6 to 10 days after transfection. The titer of focus-forming virus was determined by the NIH 3T3 transformation assay (35), and the titer of Mo-MLV was determined by the S+L-assay (2). The Abelson proteins produced by the cells were labelled with [y-32P]ATP (46) and analyzed by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis as described previously (30). The helper-free GP/P9OA stock was prepared by transfecting GP+envAml2 cells (18) with an infectious molecular clone of P9OA. The cells were trypsinized 12 h later, mixed with an RPMI 1640-based medium supplemented to contain 10% newborn calf serum and 0.3% agar (Difco), and seeded in 60-mm-diameter plates containing a prehardened layer of RPMI 1640-based medium containing 10% newborn calf serum and 0.6% agar. The cultures were fed weekly with fresh medium for 1 month. Two colonies were obtained from a total of approximately 106 cells distributed among 15 plates, and one of these, designated GP/P9OA, was characterized further. Immunoprecipitation of labelled cell extracts revealed that the cells synthesized a P90 Abelson protein, and infection of NIH 3T3 cells with culture fluid from these cells demonstrated the presence of high titers of transforming virus. The absence of replication-competent virus in the GP/P9OA stocks was confirmed by the absence of plaques in the S+L- assay (2), the inability to transfer Ab-MLV from NIH 3T3 cells transformed with GP/P9OA stocks, and the failure to detect reverse transcriptase activity in the culture fluid from these latter cells (data not shown). The GP/P9OAMo-MLV stock was prepared from NIH 3T3 cells transformed with GP/P9OA and subsequently infected with MoMLV. Tumorigenicity testing. Viruses were injected via the intraperitoneal route into neonatal BALB/c mice from our colony at Tufts Medical School. Each animal received 0.1 ml of virus stock supplemented to contain 8 p.g of Polybrene per ml just prior to injection. Including Polybrene in the inoculum shortens the latent period for tumor development with the P9OA virus stock but does not influence the generation of variants; Polybrene does not shorten the latent period observed for wild-type virus (19a). The animals were monitored at regular intervals for tumor development and sacrificed when signs of disease such as lymphadenopathy, cranial tumor, hind limb paralysis, or other signs of ill health were evident. Gross pathological observations were recorded at autopsy. Cloning of Ab-MLVs. The naturally occurring Ab-MLV strains P120, P9OA, P80, P85A, P85B, P85C, P85D, P118, and P120* have been described previously (19, 31). DNA clones representing the genomes of the P9OA, P80, and P85A strains of Ab-MLV were prepared from unintegrated viral DNA that was isolated from NIH 3T3 cells at 22 h postinfection (12, 37). For P9OA, the circular DNA was digested with HindIll and cloned into XCh27 (29); for P80 and P85A, the circular DNA was digested with BamHI and cloned into XL47.1 (17). Phage carrying Ab-MLV sequences were identified by hybridization with the v-abl probe, pAB3sub3 (6),
D
B
Ss
i
Ss
A S
B
6479
A B D
II
K\
pP9OA
2851TGGCTAAGCTCAAGCCTGCCCCG
pP9OT-
2851 TGGCTAAGCTCAAGCCTGCCCCG
.CAGGAAAAGCA 2903
CAGGAAAAGCA 2903
A T
pP9ODE- 2851 TGGCTAAGCTCAAGCCTGCCCCGCCGCCTCCTCCTGCCTG,3CAGGAAAAGCA 2903 A
FIG. 1. Ab-MLV plasmids. The structure of the Ab-MLV plasmid pP9OA is shown. The sequence of pP9OA, pP9OT-, and pP9ODE- in the region of the site-directed mutations is also illustrated. Thin lines represent pBR322 sequences; open boxes represent the LTR and other Mo-MLV-derived sequences; stippled boxes represent Ab-MLV-derived sequences. The boxes in the pP9OA and pP9OT- sequences represent the 19-base deletion in strain P9OA. A T was substituted for the C indicated by the arrow by site-directed mutagenesis to construct P9OT-; the A indicated by the box was deleted to construct P9ODE-. Abbreviations: D,
HindIlI; Ss, SstI; B, BglII; A, ApaI, S, Sall.
and the permuted viral genomes were subcloned into appropriately digested pBR322 to yield pP9OA, pP80, and pP85A, respectively. Construction of Ab-MLV mutants. To construct the P9OTand P9ODE- strains, site-directed mutagenesis was performed by using M13mpl9 as described previously (4, 5, 14, 50). For P9OT-, the 1.0-kb BglII-SalI fragment (bases 2020 to 3071) from pP9OA was used as a mutagenesis substrate; for the P9ODE- strain, the 0.68-kb SstI-SaIl fragment (bases 2391 to 3071) from pUC120 (5) was used. Phage containing the desired mutation were identified initially by plaque hybridization with the oligonucleotide containing the desired base changes (50) and subsequently sequenced by the chain termination method (34) using the Sequenase kit (U.S. Biochemicals) as recommended by the manufacturer. The P9OT- strain was constructed by replacing the 0.56-kb SstI-ApaI fragment (bases 2391 to 2949) of pP9OA (Fig. 1) with the corresponding fragment containing the mutation (Fig. 1). The P9ODE- strain was constructed by replacing the 0.68-kb SstI-SalI fragment of pP9OA (bases 2391 to 3071) with the corresponding fragment containing the mutation (Fig. 1). Sequence analysis. The sequence of the P9OA strain was determined by using multiple oligonucleotide primers derived from the consensus sequence of the P120 wild-type strain (26) using the chain termination method (34). Between bases 2612 and 3050, the sequence was determined on both strands; in most of the other regions, the sequence was determined for one strand only. The sequences of the P80 and P85A strains were determined from base 2612 to 3071, using the same approach. The P80 strain was also analyzed between bases 1891 and 2160, 3071 and 3450, and 4501 and 5137. The portion of the genome encoding the Abelson protein carboxyl termini of the P85B, P85C, P85D, P120*, and P118 strains was analyzed by using a polymerase chain reaction (PCR) approach (33) in which bases 2440 to 3286 were amplified from clonally derived NIH 3T3-transformed nonproducer cells transformed by these viruses. For this, 1.0 to 5.0 ,ug of DNA and 1 ,uM of the oligonucleotides 5'CCCGAATTCTTGCTGAAATCCACCAAGCC and 5'-CCC
6480
PARMAR ET AL.
J. VIROL.
TABLE 1. Tumor induction by P9OA-related virus strains Virusa
P90A GP/P9OA
2 4 GP/P90A-Mo-MLV 5 P9OT2 P9ODE4
No. of tumors Latent period induced/total (days) no. of tumors Range Mean
Titerb x 105 x 106 x
105
x 105 x 106
21/25 2/21 12/15 17/17 14/18
23-73 62-90 35-56
30-65 23-73
36 76 45 43 36
A
B 0
No.
variants/ no. testedc
9/11 0/2 8/8 0/14 0/10
a Neonatal BALB/c mice were injected with 0.1 ml of filtered virus supplemented with 8 ,ug of Polybrene just prior to injection. b The Ab-MLV titer in the stocks was determined by using the NIH 3T3 focus assay (35). c The number of tumors expressing Abelson proteins distinct in size from those produced by the viruses injected into the mice is compared with the total number of tumors tested.
GAATTCGCCTCAGTACTGTCCAGAAC were used. Amplification was carried out in PCR buffer (50 mM KCl, 1.5 mM MgCl2, 10 mM Tris HCI [pH 8.3], 0.001% gelatin) to which was added 200 t1M (each) dCTP, dATP, dGTP, and dTTP and 1 to 2 U of TaqI polymerase (Perkin-Elmer Cetus). The mixture was amplified for 35 cycles of 1 min at 94°C, 2 min at 55°C, and 2 min at 72°C. After the final cycle, the reaction was held at 72°C for 5 min to allow reannealing of the products and then cooled to 4°C. The PCR product was cloned into M13mpl9 by using the EcoRI linkers on the 5' ends of the amplification primers. Clones containing the appropriate inserts were sequenced by using the Sequenase kit. A total of three to four clones from two independent amplification reactions were analyzed to control for sequence errors introduced by PCR. No discrepancies were noted among all of the clones tested. RESULTS Viral replication facilitates the generation of variants from the weakly oncogenic P9OA strain. Ab-MLV P9OA is uniquely unstable in vivo in that most tumors arising in mice injected with this virus contain new Ab-MLV variants (19). However, in the in vitro bone marrow transformation assay, the virus appears stable (19). One possible explanation for these data is that multiple rounds of virus replication such as might occur in vivo during tumor development are required to generate variants. To test this idea, the helper virus-free GP/P9OA stock was injected into neonatal BALB/c mice. To ensure that the P9OA in the helper-free stock was similar to the original P9OA strain, a second stock called GP/P9OA-MoMLV, prepared from GP/P9OA-transformed NIH 3T3 cells infected with Mo-MLV, was also tested. As expected, 12 of the 15 animals injected with GP/P9OA-Mo-MLV developed tumors between 35 and 56 days postinjection (Table 1); all eight tumors analyzed, including the representatives shown (Fig. 2A), expressed Abelson proteins that were either larger or smaller in size than that of P9OA. In contrast, only 2 of 21 animals injected with the helper-free GP/P9OA virus stock developed disease after an extended latent period (Table 1). In addition, both of these tumors synthesized a P90 protein that comigrated with the protein expressed by the GP/P9OAtransformed packaging cell line (Fig. 2B). These data demonstrate that replication of the Ab-MLV P90A strain facilitates generation of the variants. Furthermore, because helper-free stocks of wild-type Ab-MLV induce tumors
m- a-
c
T i T2
0
JOURNAL OF VIROLOGY, Dec. 1991, p. 6478-6485
0022-538X/91/126478-08$02.00/0 Copyright ©) 1991, American Society for Microbiology
Carboxyl-Terminal Determinants of Abelson Protein Important for Lymphoma Induction KALINDI PARMAR,1 ROBERT C. HUEBNER,2t AND NAOMI ROSENBERGl.2* Departments of Pathology' and Molecular Biology and Microbiology,2 Tufts University School of Medicine, 136 Harrison Avenue, Boston, Massachusetts 02111 Received 24 June 1991/Accepted 11 September 1991 The carboxyl-terminal region of the Abelson protein is not absolutely required for Abelson virus transformation. However, Abelson virus strains encoding proteins missing portions of this region have a reduced ability to transform lymphoid cells in vitro and in vivo. One such strain, called P9OA, is unique in that P9OA-injected mice almost always develop tumors containing highly oncogenic variants that encode new forms of Abelson protein. In this work, we have examined the mechanism by which these variants are generated and used the variants to identify carboxyl-terminal protein sequences important for the induction of Abelson disease. Analysis of mice injected with helper-free P9OA virus stocks demonstrates that the variants are generated during viral replication in vivo, probably as a consequence of error-prone reverse transcription. The sequence of the P9OA viral genome reveals that a 19-base deletion is responsible for synthesis of the truncated Abelson protein. As a consequence of this mutation, 167 carboxyl-terminal amino acids normally found in the wild-type protein have been replaced by 33 amino acids derived from an alternative reading frame. Site-directed mutants show that the combination of the deletion and the P9OA carboxyl terminus is required for the generation of variants. Thus, the particular structure of the P9OA protein, not the specific residues lost or gained, alters the transforming potential of the Abelson protein. Finally, the sequence of the variants encoding smaller Abelson proteins reveals that as few as 452 v-abl-encoded amino acids are required for rapid induction of Abelson disease.
(1, 22). However, most Ab-MLV mutants that fail to express the complete carboxyl terminus of Abelson protein display reduced lethality in 3T3 cells (7, 44, 49) and are highly compromised in their ability to induce lymphomas and transform pre-B cells (23, 24, 30, 43). In addition, genetically engineered mice that express a c-abl protein lacking the carboxyl-terminal region fail to thrive (5a, 36). These data suggest that the carboxyl termini of both the normal and activated forms of abl proteins play an important role in protein function. In contrast to most mutants encoding Abelson proteins that lack a complete carboxyl terminus, we have previously reported a series of highly tumorigenic carboxyl-terminal truncation mutants (19). These viruses arose in mice injected with the Ab-MLV P90A strain, a carboxyl-terminal truncation mutant derived from the P120 wild-type strain (31). In this report, we have identified the sequences that render the P9OA strain weakly oncogenic and used the variants to map carboxyl-terminal sequences that are important for high levels of tumor induction by Ab-MLV. These studies demonstrate that P9OA variants are generated in vivo during virus replication and that as few as 452 v-abl residues are required for efficient lymphoma induction.
Abelson murine leukemia virus (Ab-MLV) is a highly oncogenic retrovirus with a broad transformation spectrum that includes several fibroblast cell lines and cells belonging to most hematopoietic lineages (reviewed in reference 32). In vivo, the virus usually induces pre-B lymphomas, but other tumors have been observed (32). The virus encodes a single protein called the Abelson protein (27, 48), and transformation is mediated by the protein tyrosine kinase (PTK) activity of this molecule (5, 13, 22, 28, 39, 47). The Abelson protein contains amino-terminal sequences specified by a portion of the Moloney murine leukemia virus (Mo-MLV)derived gag gene and carboxyl-terminal sequences encoded by v-abl (32). The portion of the protein required for PTK activity directly follows the gag-derived sequences and is highly related to that of other cytoplasmic PTKs (10). However, unlike all other members of the PTK family, abl-derived proteins contain an additional 631 amino acids, usually referred to as the carboxyl-terminal region, that are unrelated to those found in other known proteins (11, 15, 26, 38). The function of the carboxyl terminus of abl-derived proteins is poorly understood. The region is the least conserved among c-abl proteins (11, 15, 26, 38), but it does contain sites of phosphorylation (21), two of which are modified by protein kinase C (20). A putative nuclear localization signal has also been noted in this region (41), but this sequence is absent in many transforming strains of AbMLV. Indeed, the functional importance of any of these sites has been difficult to pinpoint, and the region is not absolutely required for PTK activity (42) or transformation
MATERIALS AND METHODS Cell culture and viruses. Normal and Ab-MLV-transformed NIH 3T3 cells were grown in Dulbecco's modified Eagle's medium supplemented to contain 10% newborn calf serum (Sigma). This medium, further supplemented with 15 Vig of hypoxanthine per ml-250 jig of xanthine per ml-25 ,g of mycophenolic acid per ml-200 ,ug of hygromycin-B per ml, was used to grow the GP+envAM12 packaging cell line (18). Transformed lymphoid cells were grown in RPMI 1640 supplemented to contain 10% fetal calf serum (Hyclone) and
* Corresponding author. t Present address: Connaught Laboratories, Swiftwater, PA
18370. 6478
ABELSON PROTEIN DETERMINANTS
VOL. 65, 1991
50 ,uM 2-mercaptoethanol. Tumor cells were cultured from the bone marrow of diseased animals as described previously (19). Some Ab-MLV stocks were prepared from clonally derived transformed NIH 3T3 virus nonproducer cells that had been superinfected with Mo-MLV as described previously (19). In other cases, virus was harvested from NIH 3T3 cells transfected (3, 45) with plasmids containing Ab-MLV sequences and either p8.2 (37) or pNCA (16), plasmids containing infectious clones of Mo-MLV. Virus was harvested from transformed cells 6 to 10 days after transfection. The titer of focus-forming virus was determined by the NIH 3T3 transformation assay (35), and the titer of Mo-MLV was determined by the S+L-assay (2). The Abelson proteins produced by the cells were labelled with [y-32P]ATP (46) and analyzed by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis as described previously (30). The helper-free GP/P9OA stock was prepared by transfecting GP+envAml2 cells (18) with an infectious molecular clone of P9OA. The cells were trypsinized 12 h later, mixed with an RPMI 1640-based medium supplemented to contain 10% newborn calf serum and 0.3% agar (Difco), and seeded in 60-mm-diameter plates containing a prehardened layer of RPMI 1640-based medium containing 10% newborn calf serum and 0.6% agar. The cultures were fed weekly with fresh medium for 1 month. Two colonies were obtained from a total of approximately 106 cells distributed among 15 plates, and one of these, designated GP/P9OA, was characterized further. Immunoprecipitation of labelled cell extracts revealed that the cells synthesized a P90 Abelson protein, and infection of NIH 3T3 cells with culture fluid from these cells demonstrated the presence of high titers of transforming virus. The absence of replication-competent virus in the GP/P9OA stocks was confirmed by the absence of plaques in the S+L- assay (2), the inability to transfer Ab-MLV from NIH 3T3 cells transformed with GP/P9OA stocks, and the failure to detect reverse transcriptase activity in the culture fluid from these latter cells (data not shown). The GP/P9OAMo-MLV stock was prepared from NIH 3T3 cells transformed with GP/P9OA and subsequently infected with MoMLV. Tumorigenicity testing. Viruses were injected via the intraperitoneal route into neonatal BALB/c mice from our colony at Tufts Medical School. Each animal received 0.1 ml of virus stock supplemented to contain 8 p.g of Polybrene per ml just prior to injection. Including Polybrene in the inoculum shortens the latent period for tumor development with the P9OA virus stock but does not influence the generation of variants; Polybrene does not shorten the latent period observed for wild-type virus (19a). The animals were monitored at regular intervals for tumor development and sacrificed when signs of disease such as lymphadenopathy, cranial tumor, hind limb paralysis, or other signs of ill health were evident. Gross pathological observations were recorded at autopsy. Cloning of Ab-MLVs. The naturally occurring Ab-MLV strains P120, P9OA, P80, P85A, P85B, P85C, P85D, P118, and P120* have been described previously (19, 31). DNA clones representing the genomes of the P9OA, P80, and P85A strains of Ab-MLV were prepared from unintegrated viral DNA that was isolated from NIH 3T3 cells at 22 h postinfection (12, 37). For P9OA, the circular DNA was digested with HindIll and cloned into XCh27 (29); for P80 and P85A, the circular DNA was digested with BamHI and cloned into XL47.1 (17). Phage carrying Ab-MLV sequences were identified by hybridization with the v-abl probe, pAB3sub3 (6),
D
B
Ss
i
Ss
A S
B
6479
A B D
II
K\
pP9OA
2851TGGCTAAGCTCAAGCCTGCCCCG
pP9OT-
2851 TGGCTAAGCTCAAGCCTGCCCCG
.CAGGAAAAGCA 2903
CAGGAAAAGCA 2903
A T
pP9ODE- 2851 TGGCTAAGCTCAAGCCTGCCCCGCCGCCTCCTCCTGCCTG,3CAGGAAAAGCA 2903 A
FIG. 1. Ab-MLV plasmids. The structure of the Ab-MLV plasmid pP9OA is shown. The sequence of pP9OA, pP9OT-, and pP9ODE- in the region of the site-directed mutations is also illustrated. Thin lines represent pBR322 sequences; open boxes represent the LTR and other Mo-MLV-derived sequences; stippled boxes represent Ab-MLV-derived sequences. The boxes in the pP9OA and pP9OT- sequences represent the 19-base deletion in strain P9OA. A T was substituted for the C indicated by the arrow by site-directed mutagenesis to construct P9OT-; the A indicated by the box was deleted to construct P9ODE-. Abbreviations: D,
HindIlI; Ss, SstI; B, BglII; A, ApaI, S, Sall.
and the permuted viral genomes were subcloned into appropriately digested pBR322 to yield pP9OA, pP80, and pP85A, respectively. Construction of Ab-MLV mutants. To construct the P9OTand P9ODE- strains, site-directed mutagenesis was performed by using M13mpl9 as described previously (4, 5, 14, 50). For P9OT-, the 1.0-kb BglII-SalI fragment (bases 2020 to 3071) from pP9OA was used as a mutagenesis substrate; for the P9ODE- strain, the 0.68-kb SstI-SaIl fragment (bases 2391 to 3071) from pUC120 (5) was used. Phage containing the desired mutation were identified initially by plaque hybridization with the oligonucleotide containing the desired base changes (50) and subsequently sequenced by the chain termination method (34) using the Sequenase kit (U.S. Biochemicals) as recommended by the manufacturer. The P9OT- strain was constructed by replacing the 0.56-kb SstI-ApaI fragment (bases 2391 to 2949) of pP9OA (Fig. 1) with the corresponding fragment containing the mutation (Fig. 1). The P9ODE- strain was constructed by replacing the 0.68-kb SstI-SalI fragment of pP9OA (bases 2391 to 3071) with the corresponding fragment containing the mutation (Fig. 1). Sequence analysis. The sequence of the P9OA strain was determined by using multiple oligonucleotide primers derived from the consensus sequence of the P120 wild-type strain (26) using the chain termination method (34). Between bases 2612 and 3050, the sequence was determined on both strands; in most of the other regions, the sequence was determined for one strand only. The sequences of the P80 and P85A strains were determined from base 2612 to 3071, using the same approach. The P80 strain was also analyzed between bases 1891 and 2160, 3071 and 3450, and 4501 and 5137. The portion of the genome encoding the Abelson protein carboxyl termini of the P85B, P85C, P85D, P120*, and P118 strains was analyzed by using a polymerase chain reaction (PCR) approach (33) in which bases 2440 to 3286 were amplified from clonally derived NIH 3T3-transformed nonproducer cells transformed by these viruses. For this, 1.0 to 5.0 ,ug of DNA and 1 ,uM of the oligonucleotides 5'CCCGAATTCTTGCTGAAATCCACCAAGCC and 5'-CCC
6480
PARMAR ET AL.
J. VIROL.
TABLE 1. Tumor induction by P9OA-related virus strains Virusa
P90A GP/P9OA
2 4 GP/P90A-Mo-MLV 5 P9OT2 P9ODE4
No. of tumors Latent period induced/total (days) no. of tumors Range Mean
Titerb x 105 x 106 x
105
x 105 x 106
21/25 2/21 12/15 17/17 14/18
23-73 62-90 35-56
30-65 23-73
36 76 45 43 36
A
B 0
No.
variants/ no. testedc
9/11 0/2 8/8 0/14 0/10
a Neonatal BALB/c mice were injected with 0.1 ml of filtered virus supplemented with 8 ,ug of Polybrene just prior to injection. b The Ab-MLV titer in the stocks was determined by using the NIH 3T3 focus assay (35). c The number of tumors expressing Abelson proteins distinct in size from those produced by the viruses injected into the mice is compared with the total number of tumors tested.
GAATTCGCCTCAGTACTGTCCAGAAC were used. Amplification was carried out in PCR buffer (50 mM KCl, 1.5 mM MgCl2, 10 mM Tris HCI [pH 8.3], 0.001% gelatin) to which was added 200 t1M (each) dCTP, dATP, dGTP, and dTTP and 1 to 2 U of TaqI polymerase (Perkin-Elmer Cetus). The mixture was amplified for 35 cycles of 1 min at 94°C, 2 min at 55°C, and 2 min at 72°C. After the final cycle, the reaction was held at 72°C for 5 min to allow reannealing of the products and then cooled to 4°C. The PCR product was cloned into M13mpl9 by using the EcoRI linkers on the 5' ends of the amplification primers. Clones containing the appropriate inserts were sequenced by using the Sequenase kit. A total of three to four clones from two independent amplification reactions were analyzed to control for sequence errors introduced by PCR. No discrepancies were noted among all of the clones tested. RESULTS Viral replication facilitates the generation of variants from the weakly oncogenic P9OA strain. Ab-MLV P9OA is uniquely unstable in vivo in that most tumors arising in mice injected with this virus contain new Ab-MLV variants (19). However, in the in vitro bone marrow transformation assay, the virus appears stable (19). One possible explanation for these data is that multiple rounds of virus replication such as might occur in vivo during tumor development are required to generate variants. To test this idea, the helper virus-free GP/P9OA stock was injected into neonatal BALB/c mice. To ensure that the P9OA in the helper-free stock was similar to the original P9OA strain, a second stock called GP/P9OA-MoMLV, prepared from GP/P9OA-transformed NIH 3T3 cells infected with Mo-MLV, was also tested. As expected, 12 of the 15 animals injected with GP/P9OA-Mo-MLV developed tumors between 35 and 56 days postinjection (Table 1); all eight tumors analyzed, including the representatives shown (Fig. 2A), expressed Abelson proteins that were either larger or smaller in size than that of P9OA. In contrast, only 2 of 21 animals injected with the helper-free GP/P9OA virus stock developed disease after an extended latent period (Table 1). In addition, both of these tumors synthesized a P90 protein that comigrated with the protein expressed by the GP/P9OAtransformed packaging cell line (Fig. 2B). These data demonstrate that replication of the Ab-MLV P90A strain facilitates generation of the variants. Furthermore, because helper-free stocks of wild-type Ab-MLV induce tumors
m- a-
c
T i T2
0
