Multiple genome modifications by the CRISPR/Cas9 system in zebrafish Satoshi Ota1,2†, Yu Hisano1†, Yoshiya Ikawa3 and Atsuo Kawahara1,2* 1
Laboratory for Cardiovascular Molecular Dynamics, RIKEN Quantitative Biology Center (QBiC), Furuedai 6-2-3, Suita, Osaka 565-0874, Japan 2 Laboratory for Developmental Biology, Center for Medical Education and Sciences, Graduate School of Medical Science, University of Yamanashi, Shimogatou 1110, Chuo, Yamanashi 409-3898, Japan 3 Department of Chemistry, Graduate School of Science and Engineering, University of Toyama, Gofuku 3190, Toyama 930-8555, Japan
The type II clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) system, which is an adaptive immune system of bacteria, has become a powerful tool for genome editing in various model organisms. Here, we demonstrate multiple genome modifications mediated by CRISPR/Cas9 in zebrafish (Danio rerio). Multiple genes including golden/gol and tyrosinase/tyr, which are involved in pigment formation, and s1pr2 and spns2, which are involved in cardiac development, were disrupted with insertion and/or deletion (indel) mutations introduced by the co-injection of multiple guide RNAs (gRNAs) and the nuclease Cas9 mRNA. We simultaneously observed two distinct phenotypes, such as, the two hearts phenotype and the hypopigmentation of skin melanophores and the retinal pigment epithelium, in the injected F0 embryos. Additionally, we detected the targeted deletion and inversion genes as a 7.1-kb fragment between the two distinct spns2 targeted sites together with indel mutations. Conversely, chromosomal translocations among five target loci were not detected. Therefore, we confirmed that the CRISPR/Cas9-induced indel mutations and a locus-specific deletion were heritable in F1 embryos. To screen founders, we improved heteroduplex mobility assay (HMA) for simultaneously detecting indel mutations in different target loci. The results suggest that the multi-locus HMA is a powerful tool for identification of multiple genome modifications mediated by the CRISPR/Cas9 system.
Introduction An unprecedented amount of genome information is now available for various types of model organisms including plants and animals. At the same time, however, biological and developmental functions associated with the individual genes located in these genomes are not always well understood. The development of artificial site-specific nucleases such as zinc-finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) has enabled the investigation of loss-of-function phenotypes for genes of interest (Urnov et al. 2010; Bogdanove & Voytas 2011). Both Communicated by: Shigekazu Nagata *Correspondence: [email protected] † These authors contributed equally to this work.
ZFNs and TALENs are composed of a DNA-binding domain (zinc-finger domain or TALE domain) and the FokI nuclease catalytic domain. Double strand breaks (DSBs) induced by ZFNs or TALENs at the targeted genomic locus can be repaired by nonhomologous end-joining (NHEJ) or homologous recombination (HR) (Hisano et al. 2013). NHEJ-mediated repair often introduces insertion and/or deletion (indel) mutations into the site of the DSBs, resulting in frameshift mutations that disrupt gene function. Conversely, HR in the presence of a donor template results in precise genome modification by gene replacement. Overall, both ZFNs and TALENs are proven and powerful tools for genome editing. Recently, the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) system has emerged as a new genome editing
DOI: 10.1111/gtc.12154 © 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd
Genes to Cells (2014)
1
S Ota et al.
technology (Jinek et al. 2012). The CRISPR/Cas system is an adaptive immune system found in bacteria and archaea, and it protects those organisms’ genomes against invading viruses and plasmids (Wiedenheft et al. 2012). Several groups have demonstrated that type II CRISPR/Cas, CRISPR/Cas9, is especially useful for targeted genome modifications in mammalian cells (Cong et al. 2013; Mali et al. 2013) and various model organisms including zebrafish (Hwang et al. 2013), mouse (Li et al. 2013a), and rat (Li et al. 2013a,b). In this system, targeted genome sequences located adjacent to a protospacer adjacent motif (PAM) sequence (NGG) are recognized by guide RNA (gRNA)-containing complimentary sequences to the target site and are cleaved by a complex consisting of gRNA and the nuclease Cas9. Subsequent indel mutations induced by the nuclease Cas9 contribute to gene disruption. In fact, single gene disruption induced by CRISPR/Cas9 in zebrafish was already reported by several groups (Chang et al. 2013; Hruscha et al. 2013; Hwang et al. 2013; Jao et al. 2013; Sung et al. 2014). One characteristic feature of the CRISPR/Cas9 system is that it consists of two components, small molecule gRNA and the nuclease Cas9 (Jinek et al. 2012). In contrast, ZFN and TALEN are relatively large fusion proteins consisting of a DNA-binding domain and the FokI nuclease catalytic domain (Urnov et al. 2010; Bogdanove & Voytas 2011). This distinct feature makes CRISPR/Cas9 suitable for multiple genome modifications, because it is very easy to inject multiple gRNAs with the nuclease Cas9 in various types of embryos. Indeed, Jao et al. (2013) observed multiple genes disruption in F0 zebrafish embryos injected by multiple gRNAs with Cas9, but they did not determine the translocation among multiple target loci and the germ-line transmission of multiple genes disruption in F1 embryos. Xiao et al. (2013) have recently reported that the targeted deletions (0.6–1.5 kb) were detected in F0 zebrafish embryos injected by two gRNAs with Cas9, but they did not examine its germ-line transmission in F1 embryos. Whether various genome modification events, including targeted deletions, inversions and translocations, are heritable, however, remains unclear. When performing multiple genome modifications by CRISPR/Cas9, indel mutations should be detected at multiple targeted genomic loci simultaneously. Although several methods, such as the CelI assay (Miller et al. 2007) and high-resolution melt analysis (HRMA; Dahlem et al. 2012), have been 2
Genes to Cells (2014)
developed to detect indel mutations at a single locus, they are not suitable for the detection of multiple genome modifications at the same time. We previously demonstrated that the heteroduplex mobility assay (HMA) is suitable for detecting site-specific nuclease-mediated genome modifications (Ota et al. 2013). In the present study, we improved HMA as a multi-locus HMA that can detect multiple genome modifications and estimate the germ-line transmission rate of potential founders.
Results Multiple genome modifications by the CRISPR/ Cas9 system at five distinct genomic loci
To examine multiple CRISPR/Cas9-mediated genome modifications including targeted deletions, we chose four genes, golden/gol, tyrosinase/tyr, s1pr2 and spns2, because disruptions of these genes induce obvious morphological phenotypes. golden/gol encodes a putative cation exchanger that is required for the formation of melanosome (Lamason et al. 2005), while tyrosinase/tyr encodes a copper-containing enzyme that catalyzes the production of melanin from tyrosine by oxidation (Page-McCaw et al. 2004). Thus, the disruption of the gol or tyr locus leads to the hypopigmentation of skin melanophores and the retinal pigment epithelium (RPE). Conversely, s1pr2, which encodes a receptor of sphingosine-1-phosphate (S1P), and spns2, which encodes the S1P transporter, regulate the migration of cardiac progenitor cells and both s1pr2 and spns2 mutants exhibit the two hearts phenotype (cardia bifida) (Kupperman et al. 2000; Kawahara et al. 2009). We designed gRNAs against the above four genes as shown (Fig. S1 and Table S1 in Supporting Information). In the case of spns2, we prepared gRNAs for both spns2 exon 5 and exon 6 to investigate whether CRISPR/Cas9 induces targeted deletion and inversion in addition to indel mutations at multiple genomic loci. A mixture of gol-, s1pr2-, spns2-ex5-, spns2-ex6- and tyr-gRNA (five gRNAs) with Cas9 mRNA was injected into one- to two-cell stage embryos derived from Tg(cmlc2:EGFP) expressing enhanced green fluorescent protein (EGFP) in cardiomyocytes. F0 embryos (#1 and #2) injected with the 5 gRNAs plus Cas9 mRNA exhibited two hearts phenotype identical to the s1pr2 and spns2 mutants at 1 day postfertilization (dpf; Fig. 1A–C; 67%, n = 49). Subsequently, embryos #1 and #2 showed hypopigmentation of skin melanophores and the retinal pigment epithelium at 2 dpf (Fig. 1D–F). We observed
© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd
CRISPR/-mediated multiple gene disruptions
(A)
(B)
(C)
(D)
(E)
(F)
Figure 1 Multiple genome modifications by the CRISPR/ Cas9 system. (A, D) An uninjected control embryo derived from Tg(cmlc2:EGFP), which expresses EGFP in developing cardiac cells. (B, C, E, F) Tg(cmlc2:EGFP) derived embryos co-injected with 5 gRNAs (gol-, s1pr2-, spns2-ex5-, spns2-ex6and tyr-gRNA) plus Cas9 mRNA are shown. (A–C) Embryos injected with 5 gRNAs plus Cas9 mRNA showed the two hearts phenotype (cardia bifida) at 1 day postfertilization (dpf; B and C), whereas an uninjected embryo had one normal heart (A). (D–F) Injection of the 5 gRNAs with Cas9 mRNA decreased the number of pigment cells in the retinal epithelium (arrowheads) at 2 dpf (E and F), while an uninjected embryo had normal retinal pigment epithelial cells (D). #1 and #2 indicate different embryos. The embryos in (D), (E) and (F) correspond to the embryos in (A), (B) and (C), respectively. (A–C) Ventral view with anterior at the top. (D–F) Lateral view with anterior to the left and dorsal at the top.
that most embryos injected with the 5 gRNAs plus Cas9 mRNA exhibited hypopigmentation (severe, 58%; mild, 38%, n = 46; Fig. S2 in Supporting Information). Thus, embryos #1 and #2 simultaneously exhibited two distinct expected phenotypes, cardia bifida and hypopigmentation. We observed no obvious abnormal phenotypes when the 5 gRNAs without Cas9 were injected into the embryos (n = 71; Fig. S3 in Supporting Information), indicating that the nuclease Cas9 is indispensable for multiple genome modifications. To examine whether the five targeted loci contain indel mutations, we amplified the individual target genomic sites (100–150 bp) from genomic DNA from multiple individuals by PCR using locus-specific primers. The PCR amplicons were electrophoresed on 15% polyacrylamide gels; we previously reported as HMA (Ota et al. 2013). When multiple indel mutations induced by CRISPR/Cas9 occur in somatic cells, multiple heteroduplex bands (or smears) of slow migration in addition to homoduplexes should be observed. Indeed, we found that all PCR
amplicons for the five different loci exhibited multiple slow-migrating heteroduplexes (Fig. 2), suggesting that various indel mutations frequently occurred on these target sites in somatic cells. Random sequencing analysis using the PCR amplicons showed that the five genomic target sites contained various types of indel mutations at high mutation rates (gol, spns-2exon 5 and tyr; 79%–100%; s1pr2 and spns2-exon 6; 36%–41%; Fig. S4 in Supporting Information). We searched potential off-target sites against 5 gRNAs sequences using Cas-OFFinder (Bae et al. 2014). Candidate off-target sites are amplified from genomic DNA by PCR using the locus-specific primers, and the production of heteroduplex was determined by HMA. We found no obvious heteroduplex bands in individual off-target sites (Fig. S5 in Supporting Information), suggesting that the off-target effect is marginal in 5 gRNAs/Cas9-injected embryos. These results indicate that our CRISPR/Cas9 system efficiently and simultaneously introduces indel mutations into multiple loci without severe off-target effect. Targeted deletions and inversions were induced at the spns2 locus by the CRISPR/Cas9 system
Because we observed frequent indel mutations at the spns2-exon 5 and spns2-exon 6 target sites in the 5 gRNAs/Cas9-injected embryos, we examined whether targeted deletions and inversions at the spns2 locus (LG5) occurred in somatic cells. The distance between the two spns2 gRNA targets was approximately 7.1 kb
Figure 2 Heteroduplex mobility assay at five individual target sites. The five gRNA target loci were independently amplified by PCR using an uninjected embryo or 5 gRNAs/Cas9injected embryos (#1 and #2). Individual PCR products were separated on a 15% polyacrylamide gel. F0 embryos #1 and #2 both exhibited multiple heteroduplex bands (white lines) in addition to the expected homoduplex bands (asterisks).
© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd
Genes to Cells (2014)
3
S Ota et al.
and contained an intron (Fig. 3A). Four distinct locusspecific primers in the spns2 gene were used (Fig. 3B). If an expected targeted deletion occurs in the spns2 locus, short fragments (approximately 150 bp) should be amplified by using the spns2-e5S and spns2-e6AS primers. Conversely, if an expected targeted inversion occurs in the spns2 locus, then inversion junctions such
as those seen in Fig. 3B should be amplified as PCR amplicons using a combination of the spns2-e5S and spns2-e6S primers or the spns2-e5AS and spns2-e6AS primers. Simultaneously, we investigated whether two spns2 target loci are translocated to three other gRNA target sites (chromosomal translocation to s1pr2 in LG3, tyr in LG15 or gol in LG18). The expected
(A)
(B)
(C)
(D)
Figure 3 Targeted deletion and inversion were detected within the spns2 locus. (A) The structure of the spns2 gene (LG5), which contained the spns2-ex5 and spns2-ex6 targets. The distance between the two targets is 7.1 kb. (B) Schematic diagrams of the targeted deletion and inversion. The expected junctions of the targeted deletion and inversion are highlighted with four different colors. The locations of four primers (e5S, e5AS, e6S and e6AS) are indicated as thin arrows. (C, D) PCR products from genomic DNAs of uninjected- or 5-gRNAs/Cas9-mRNA-injected embryos were separated on 2% agarose gels. The primers used are shown above the gels. The targeted deletion was detected by the primers spns2-e5S and spns2-e6AS (C, lane 2; D, lane 2). The targeted inversion was detected by the primers spns2-e5S and spns2-e6S (C, lane 4) and by the primers spns2-e5AS and spns2e6AS (D, lane 4). The expected chromosomal translocations between the spns2 locus (LG5) and other loci (s1pr2 in LG3, tyrosinase in LG15 and golden in LG18) were not detected.
4
Genes to Cells (2014)
© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd
CRISPR/-mediated multiple gene disruptions
targeted deletions and inversions at the spns2 locus were detected and confirmed by sequencing analysis (Fig. 3C,D and Fig. S6 in Supporting Information). In contrast, the expected chromosomal translocations were not detected (Fig. 3C,D and Fig. S7 in Supporting Information). We furthermore examined whether the 7.1-kb fragment derived from the spns2 locus was inserted into other gRNA target sites on LG3, LG15 and LG18 but found that it was not (Fig. S8 in Supporting Information). Thus, the 7.1-kb fragment in the spns2 gene was excised by spns2-ex5- and spns2ex6-gRNA together with the nuclease Cas9, and in some cases, it was predominantly reintegrated in the opposite orientation into the spns2 locus but not into the other gRNA target sites located on different chromosomes. Multiple genome modifications induced by the CRISPR/Cas9 system are heritable
To investigate whether the multiple genome modifications induced by CRISPR/Cas9 are transmitted to the germ-line, we crossed potential F0 founders derived from the 5 gRNAs/Cas9-injected embryos to wild type. Based on our established HMA for a single target site (Ota et al. 2013), we improved HMA as a multi-locus HMA to achieve a highly efficient founder screen for multiple target sites. Because small indel deletions are predominant in genome editing, we designed the locus-specific primers of different sizes (50, 100 and 200 bp). We separately amplified the individual target sites by PCR, and the PCR products were mixed with three loci (s1pr2, 250 bp; tyr, 104 bp; gol 59 bp) or two loci (spns2-ex5, 153 bp; spns2-ex6, 64 bp) and electrophoresed on a 15% polyacrylamide gel. As shown in Fig. 4A,B, we could detect heteroduplex bands of up to three loci in the same lane. For example, F1 embryos #3 and #8 both of which were derived from the F0 founder female 3 have wild-type and mutant alleles in the s1pr2, tyr and gol loci (Fig. 4B). Overall, the HMA profiles of the progeny are dependent on the F0 founders (e.g., the F0 founder male 2 carries at least two types of mutations for tyr, gol and spns2-ex5), suggesting the generation of distinct indel mutations (Fig. 4A). We confirmed that another F0 founder, female 6, carries a mutation in spns2-ex6 (Fig. 4C). Thus, multiple genome modifications were effectively induced by multiple gRNAs/Cas9 injections into zebrafish and inherited by the progeny. Additionally, these data show that the multi-locus HMA is very useful for detecting multiple genome modifications.
The results of the multi-locus HMA furthermore suggested that F0 founder male 2 carries tyr, gol and spns2-ex5 mutations and that F0 founder female 3 carries s1pr2, tyr, gol and spns2-ex5 mutations, raising the possibility that crossing these two F0 founders should produce biallelic mutations for tyr, gol and spns2-ex5 and result in two distinct phenotypes. The severe mosaic stripe patterns in the skin of F0 founder male 2 and female 3 suggest that they indeed have stable biallelic mutations in the gol and/or tyr genes (Fig. 5A–C). Four different F1 embryos (#1– #4) derived from the crossing of F0 founder male 2 and female 3 (Fig. 5D–K) were investigated. F1 embryo #1 showed no obvious abnormal phenotype (Fig. 5D,E); F1 embryos #2 and #3 exhibited the cardia bifida phenotype with normal pigmentation in the skin (Fig. 5F–I); and F1 embryo #4 presented both the cardia bifida and hypopigmentation phenotypes (Fig. 5J,K). Sequencing analysis confirmed the genotypes of the individuals: F1 embryo #1 had at least one WT allele for all target loci; F1 embryo #2 had a WT allele and a 2-bp deletion allele for the spns2-ex5 locus as well as a WT allele and a 4-bp deletion allele for the spns2-ex6 locus; F1 embryo #3 had two frameshift mutation alleles for the spns2-ex5 locus; F1 embryo #4 had two frameshift mutation alleles for the spns2-ex5 locus and the gol locus (Fig. 5L). Because F1 embryo #2 exhibited the cardia bifida phenotype, one spns2 allele of this embryo should have the 2 bp deletion, and the other spns2 allele should have the 4 bp deletion. The cardia bifida and/ or hypopigmentation phenotypes in the F1 embryos #3 and #4 were consistent with the genotypes of these embryos. Finally, we examined whether the targeted deletion and inversion of the spns2 locus are transmitted into the germ-line. We screened the progeny of the 11 potential F0 founder fish and found that F0 founder female 8 transmitted a 7.1-kb deletion of the spns2 locus to F1 embryos with a transmission rate of 18.8% (12/64), but we could not detect the inversion (0/64; Fig. S9 in Supporting Information). Sequence analysis confirmed that the F0 founder fish transmitted only one pattern of deleted alleles. Consistent with above observation, it was reported that 3 in 19 F0 founders produced the targeted deletion induced by two TALEN sets for the target gene, while the inversion was detected from only one F0 founder (Xiao et al. 2013). We furthermore examined the possibility of translocation between spns2 locus and other loci. We could not any translocation
© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd
Genes to Cells (2014)
5
S Ota et al. (A)
(B)
(C)
Figure 4 Multi-locus heteroduplex mobility assay for the detection of multiple genome modifications. (A, B) F0 founders male 2 (A) and female 3 (B) were out-crossed with wild-type zebrafish. Subsequently, 5 target loci were independently amplified from the genomic DNA of eight individual embryos. Mixtures of PCR amplicons (s1pr2, tyr and gol or spns2-ex5 and spns2-ex6) were applied to single lanes and separated on 15% polyacrylamide gels. All target loci except for the spns2-ex6 locus had heteroduplex DNAs (circles). (C) A summary of the founder screening. Individual potential F0 founders possessed three or four indel mutations at the five genomic target sites.
in F1 embryos derived from five F0 founders (Fig. S10 in Supporting Information). We emphasize that the chromosomal deletions as well as multiple indel mutations induced by CRISPR/Cas9 were heritable in zebrafish.
Discussion In the present study, we demonstrated simultaneous multiple genome modifications by the CRISPR/Cas9 system in zebrafish. We chose four genes, s1pr2, spns2, 6
Genes to Cells (2014)
gol and tyr, as CRISPR/Cas9 targets because their mutant phenotypes are obvious (Kupperman et al. 2000; Page-McCaw et al. 2004; Lamason et al. 2005; Kawahara et al. 2009). We simultaneously observed two distinct phenotypes, cardia bifida and hypopigmentation, in the 5 gRNAs/Cas9-injected embryos, indicating that the CRISPR/Cas9 system is very useful for the generation of multiple mutations, as previously reported (Jao et al. 2013). In addition, we demonstrated that CRISPR/Cas9-mediated targeted deletions and inversions occurred together with indel
© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd
CRISPR/-mediated multiple gene disruptions
(A)
(B)
(D)
(E)
(F)
(G)
(H)
(I)
(J)
(K)
(C)
(L)
Figure 5 CRISPR/Cas9-mediated indel mutations are heritable. (A–C) Four-month-old WT zebrafish (A), F0 founder male 2 (B), and F0 founder female 3 (C). The F0 founders had mosaic stripe patterns in their skin (areas within white broken rectangles). (D–K) The embryos obtained from the in-crossing of the F0 founders male 2 and female 3. (D, E) F1 embryo #1 showed no developmental abnormality. (F–I) F1 embryos #2 and #3 showed cardia bifida at 1 dpf. (J, K) F1 embryo #4 exhibited cardia bifida at 1 dpf and hypopigmentation of skin melanophores and the retinal pigment epithelium at 2 dpf. (L) Genotypes of the individual F1 embryos. (A–C) Lateral view with anterior to the right and dorsal at the top. (D, F, H, J) Ventral view with anterior at the top. (E, G, I, K) Lateral view with anterior to the left and dorsal at the top.
mutations in the 5 gRNAs/Cas9-injected embryos. Importantly, these multiple modifications included a large deletion that was heritable. To our knowledge, this is the first report to show the germ-line transmission of the simultaneous multiple targeted genes disruption and the targeted chromosomal deletion in
zebrafish, when multiple gRNAs are injected with the Cas9 mRNA into zebrafish embryos. By examining the F1 progeny derived from the potential F0 founders, we showed that the multiple mutant alleles were independently inherited by the progeny. We also examined whether chromosomal translocations between the spns2 locus (LG5) and other target loci (s1pr2 in LG3, tyr in LG15 and gol in LG18) were induced by CRISPR/Cas9. In the 5 gRNAs/ Cas9-injected embryos, PCR amplification using the locus-specific primers failed to reveal such chromosomal translocations. Cho et al., however, did find CRISPR/Cas9-mediated chromosomal translocations between on-target and off-target loci (Cho et al. 2014). However, their study investigated mammalian cells, while ours used live zebrafish embryos; unknown mechanisms may protect vertebrates from such translocations during early development. Additionally, the chromosomal locations of the targets may affect the efficacy of the chromosomal translocations. Indeed, the spns2 locus is located near the center of the chromosome, while the other genes (gol, s1pr2 and tyr) are located near the ends. The previously reported chromosomal translocations were detected in two target loci located near the chromosome ends (Cho et al. 2014), raising the possibility that short chromosomal fragments move more easily to other chromosomes. This speculation is consistent with our finding that chromosomal translocations among the gol, s1pr2 and tyr loci did not occur along with the multiple genome modifications (Fig. S7 in Supporting Information). Precise genome modifications are difficult to generate with the TALEN-mediated gene knock-in technology (Bedell et al. 2012; Zu et al. 2013). Therefore, it is very important to understand how donor fragments are integrated into the targeted genomic locus. We observed that a 7.1-kb fragment in the spns2 locus was excised from the chromosome by CRISPR/Cas9 and reintegrated in the opposite orientation at the same locus. At the same time, we did not detect the integration of this fragment into other target loci (gol, s1pr2 and tyr) located in other chromosomes, suggesting the importance of the distance between the fragment and the target locus during chromosomal integration. Our findings suggest that artificial access by the donor DNA to the target locus might improve the effectiveness of targeted gene knock-in technology. We previously demonstrated that HMA is very useful for detecting small indel mutations induced by artificial nucleases and for identifying possible founders that possess useful mutant alleles (Ota et al. 2013). In
© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd
Genes to Cells (2014)
7
S Ota et al.
the present study, we improved HMA as multi-locus HMA to simultaneously analyze different target loci. Because the CRISPR/Cas9 system is suitable for multiple genome modifications, our multi-locus HMA provides a powerful tool for the detection of simultaneous genome modifications in genome editing.
Experimental procedures Guide RNA vector and Cas9 plasmid To construct a pCS2P-gRNA vector containing the T7 promoter, the sequence of the gRNA scaffold was amplified from the pDR274 vector (Hwang et al. 2013) by PCR using the primers T7-gRNA-EcoRI (50 -GGAATTCTAATAC GACTCACTATAGGAGACGCTGCAGCCCGGGGGATC CCGTCTCGTTTTAGAGCTAGAAATAG-30 ) and gRNASmaI (50 -TCCCCCGGGAAAAAAAGCACCGACTCGGTG C-30 ). After EcoRI and SmaI digestion, the resultant fragments were inserted into the EcoRI and SnaBI-cleaved pCS2P vector. To construct an individual gRNA vector encoding gRNAs with customized targeting sequences, appropriately designed and annealed oligonucleotides were inserted into the BsmBI-cleaved pCS2P-gRNA vector. The sequences of the genomic target sites and oligonucleotides are listed in Table S1. The pCS2-hSpCas9 plasmid was kindly provided by Dr. Kinoshita (Kyoto University).
Preparation of gRNA and Cas9 mRNA Template DNAs of the gRNAs were prepared by PCR amplification using the following primers gRNA-F (50 -GAATTCT AATACGACTCAC-30 ) and gRNA-R (50 -AAAAGCACC GACTCGG-30 ). The PCR products were purified using the MinElute Gel Extraction kit (QIAGEN, Venlo, The Netherlands) after agarose gel electrophoresis. gRNAs were transcribed using the MAXIscript T7 kit (Life Technologies, Carlsbad, CA, USA) and purified by phenol–chloroform extraction and EtOH precipitation. We selected a sequence of the form 50 -GGN18NGG-30 in the zebrafish genome as a CRISPR/Cas9 target (Table S1 in Supporting Information). Because previous studies showed that gRNAs that contain 1–2 nucleotide mismatches with their genomic target sequences at the 50 end are functional, we also introduced a mismatch nucleotide into the s1pr2 and tyr target sites to contain a GG dinucleotide at the 50 end for transcription by T7 RNA polymerase. For Cas9 mRNA, pCS2hSpCas9 was linearized with NotI digestion. Cas9 mRNA was transcribed using the mMESSAGE mMACHINE SP6 kit (Life Technologies) and purified using the RNeasy Mini Kit (QIAGEN).
Microinjection We established a stable Tg(cmlc2:EGFP) line by injection of pTol-cmlc2 promoter-EGFP plasmid with Tol2 RNA. Five
8
Genes to Cells (2014)
gRNAs (gol-, s1pr2-, spns2-ex5-, spns2-ex6- and tyr-gRNA; 25 pg each) and Cas9 mRNA (250 pg) were co-injected into 1-2 cell stage zebrafish embryos derived from Tg(cmlc2:EGFP) fish.
Preparation of genomic DNA Uninjected or 5 gRNAs/Cas9-mRNA-injected embryos were incubated in 50 ll of lysis buffer (10 mM Tris-HCl [pH 8.0], 1 mM EDTA, 0.3% Tween-20 and 0.3% NP40 containing 200 lg/ml proteinase K) at 55 °C for 3 h. Then, the solution was incubated at 100 °C for 10 min to inactivate proteinase K.
Heteroduplex mobility assay (HMA) and multi-locus HMA Genomic DNAs were prepared from uninjected embryos and 5 gRNAs/Cas9 mRNA-injected embryos at 2 days postfertilization (dpf). DNA fragments (100–150 bp) containing individual gRNA target sites were amplified by PCR with TaKaRa Ex Taq (TaKaRa, Otsu, Japan) using the locus-specific primers listed in Table S2. The PCR conditions were as follows: 30 cycles of 98 °C for 10 s, 55 °C for 30 s and 72 ° C for 30 s. The resulting PCR products were electrophoresed on a 15% polyacrylamide gel. To estimate the mutation rate for the individual gRNA target sites, PCR products were subcloned into the pGEM-T Easy vector (Promega, Madison, WI, USA). After the plasmid DNAs were prepared from individual colonies, random sequencing was carried out. For multi-locus HMA, we designed the locus-specific primers that produce different sized PCR products. Individual PCR product sizes were the following: 59 bp for gol, 104 bp for tyr, 250 bp for s1pr2, 153 bp for spns2-ex5 and 64 bp for spns2-ex6. The PCR products of gol, tyr and s1pr2 were mixed at a ratio of 6:3:1 and applied in a single lane. The PCR products of spns2-ex5 and spns2-ex6 were mixed at a ratio of 4 : 5 and applied in a single lane.
Detection of targeted deletion and inversion Targeted deletion and inversion between the spns2-exon5 and spns2-exon6 loci were analyzed by the PCR amplification of the spns2 target sites using the locus-specific primers listed in Table S2. The PCR conditions were as follows: 94 °C for 2 min, and 35 cycles of 98 °C for 10 s and 68 °C for 30 s. The resulting PCR products were electrophoresed on a 2% agarose gel. To detect the targeted deletion, the forward primer of the spns2-exon 5 target and the reverse primer of the spns2-exon 6 target were used. To detect the targeted inversion, the forward primer of the spns2-exon 5 target and the forward primer of the spns2-exon 6 target or the reverse primer of the spns2-exon 5 target and the reverse primer of the spns2exon 6 target were used. The PCR products were subcloned into the pGEM-T Easy vector. After plasmid DNAs were pre-
© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd
CRISPR/-mediated multiple gene disruptions pared from individual colonies, random sequencing was carried out. To detect chromosomal translocations, the locus-specific primers located on other target genes on different chromosomes were used.
Acknowledgements We would like to thank R. Fukuoka, M. Komeno, M. Hayashi and S. Ohara for zebrafish maintenance, P. Karagiannis for valuable comments, and F. Zhang and M. Kinoshita for pCS2hSpCas9. S. Ota was supported by the Research Fellow of Japan Society for the Promotion Science. This work was supported by the Program for Next Generation World-Leading Researchers (NEXT Program), the Japan Society for the Promotion of Science and Takeda Science Foundation.
References Bae, S., Park, J. & Kim, J.S. (2014) Cas-OFFinder: a fast and versatile algorithm that searches for potential off-target sites of Cas9 RNA-guided endoncleases. Bioinformatics Doi:10. 1093/bioinformatics/btu048. Bedell, V.M., Wang, Y., Campbell, J.M., et al. (2012) In vivo genome editing using a high-efficiency TALEN system. Nature 491, 114–118. Bogdanove, A.J. & Voytas, D.F. (2011) TAL effectors: customizable proteins for DNA targeting. Science 333, 1843– 1846. Chang, N., Sun, C., Gao, L., Zhu, D., Xu, X., Zhu, X., Xiong, J.W. & Xi, J.J. (2013) Genome editing with RNAguided Cas9 nuclease in Zebrafish embryos. Cell Res. 23, 465–472. Cho, S.W., Kim, S., Kim, Y., Kweon, J., Kim, H.S., Bae, S. & Kim, J.S. (2014) Analysis of off-target effects of CRISPR/Cas-derived RNA-guided endonucleases and nickases. Genome Res. 24, 132–141. Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X., Jiang, W., Marraffini, L.A. & Zhang, F. (2013) Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819–823. Dahlem, T.J., Hoshijima, K., Jurynec, M.J., Gunther, D., Starker, C.G., Locke, A.S., Weis, A.M., Voytas, D.F. & Grunwald, D.J. (2012) Simple methods for generating and detecting locus-specific mutations induced with TALENs in the zebrafish genome. PLoS Genet. 8, e1002861. Hisano, Y., Ota, S. & Kawahara, A. (2013) Genome editing using artificial site-specific nucleases in zebrafish. Dev. Growth Differ. 56, 26–33. Hruscha, A., Krawits, P., Rechenberg, A., Heinrich, V., Hecht, J., Haass, C. & Schmid, B. (2013) Efficient CRISPR/Cas9 genome editing with low off-target effects in zebrafish. Development 140, 4982–4987. Hwang, W.Y., Fu, Y., Reyon, D., Maeder, M.L., Tsai, S.Q., Sander, J.D., Peterson, R.T., Yeh, J.R. & Joung, J.K. (2013) Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat. Biotechnol. 31, 227–229.
Jao, L.E., Wente, S.R. & Chen, W. (2013) Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc. Natl Acad. Sci. USA. 110, 13904–13909. Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J.A. & Charpentier, E. (2012) A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816–821. Kawahara, A., Nishi, T., Hisano, Y., Fukui, H., Yamaguchi, A. & Mochizuki, N. (2009) The sphingolipid transporter spns2 functions in migration of zebrafish myocardial precursors. Science 323, 524–527. Kupperman, E., An, S., Osborne, N., Waldron, S. & Stainier, D.Y. (2000) A sphingosine-1-phosphate receptor regulates cell migration during vertebrate heart development. Nature 406, 192–195. Lamason, R.L., Mohideen, M.A., Mest, J.R., et al. (2005) SLC24A5, a putative cation exchanger, affects pigmentation in zebrafish and humans. Science 310, 1782–1786. Li, D., Qiu, Z., Shao, Y., Chen, Y., Guan, Y., Liu, M., Li, Y., Gao, N., Wang, L., Lu, X., Zhao, Y. & Liu, M. (2013a) Heritable gene targeting in the mouse and rat using a CRISPR-Cas system. Nat. Biotechnol. 31, 681–683. Li, W., Teng, F., Li, T. & Zhou, Q. (2013b) Simultaneous generation and germline transmission of multiple gene mutations in rat using CRISPR-Cas systems. Nat. Biotechnol. 31, 684–686. Mali, P., Yang, L., Esvelt, K.M., Aach, J., Guell, M., DiCarlo, J.E., Norville, J.E. & Church, G.M. (2013) RNA-guided human genome engineering via Cas9. Science 339, 823–826. Miller, J.C., Holmes, M.C., Wang, J., Guschin, D.Y., Lee, Y.L., Rupniewski, I., Beausejour, C.M., Waite, A.J., Wang, N.S., Kim, K.A., Gregory, P.D., Pabo, C.O. & Rebar, E.J. (2007) An improved zinc-finger nuclease architecture for highly specific genome editing. Nat. Biotechnol. 25, 778–785. Ota, S., Hisano, Y., Muraki, M., Hoshijima, K., Dahlem, T.J., Grunwald, D.J., Okada, Y. & Kawahara, A. (2013) Efficient identification of TALEN-mediated genome modifications using heteroduplex mobility assays. Genes Cells 18, 450–458. Page-McCaw, P.S., Chung, S.C., Muto, A., Roeser, T., Staub, W., Finger-Baier, K.C., Korenbrot, J.I. & Baier, H. (2004) Retinal network adaptation to bright light requires tyrosinase. Nat. Neurosci. 7, 1329–1336. Sung, Y.H., Kim, J.M., Kim, H.T., Lee, J., Jeon, J., Jin, Y., Choi, J.H., Ban, Y.H., Ha, S.J., Kim, C.H., Lee, H.W. & Kim, J.S. (2014) Highly efficient gene knockout in mice and zebrafish with RNA-guided endonucleases. Genome Res. 24, 125–131. Urnov, F.D., Rebar, E.J., Holmes, M.C., Zhang, H.S. & Gregory, P.D. (2010) Genome editing with engineered zinc finger nucleases. Nat. Rev. Genet. 11, 636–646. Wiedenheft, B., Sternberg, S.H. & Doudna, J.A. (2012) RNA-guided genetic silencing systems in bacteria and archaea. Nature 482, 331–338. Xiao, A., Wang, Z., Hu, Y., Wu, Y., Luo, Z., Yang, Z., Zu, Y., Li, W., Huang, P., Tong, X., Zhu, Z., Lin, S. &
© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd
Genes to Cells (2014)
9
S Ota et al. Zhang, B. (2013) Chromosomal deletions and inversions mediated by TALENs and CRISPR/Cas in zebrafish. Nucleic Acids Res. 41, e141. Zu, Y., Tong, X., Wang, Z., Liu, D., Pan, R., Li, Z., Hu, Y., Luo, Z., Huang, P., Wu, Q., Zhu, Z., Zhang, B. & Lin, S. (2013) TALEN-mediated precise genome modification by homologous recombination in zebrafish. Nat. Methods 10, 329–331.
Figure S5 Off-target analysis of multiple gRNAs/Cas9induced mutations.
Received: 18 February 2014 Accepted: 26 March 2014
Figure S8 The 7.1-kb fragment between the two distinct spns2 gRNA target sites in the spns2 locus was reintegrated in the opposite orientation into the spns2 locus (inversion, lane 2).
Supporting Information Additional Supporting Information may be found in the online version of this article at the publisher’s web site:
Figure S7 Examination of chromosomal translocations among the s1pr2 (LG3), tyr (LG15) and gol (LG18) loci.
Figure S9 The targeted 7.1-kb deletion of the spns2 locus was transmitted into the germ-lines.
Figure S2 Multiple genome modifications by the CRISPR/ Cas9 system.
Figure S10 The chromosomal translocations between the spns2 (LG5) and other loci (s1pr2 in LG3, tyrosinase in LG15 and golden in LG18) were not detected in F1 embryos derived from the F0 founders (female 8, male 6, male 8, male 9 and male 11).
Figure S3 Injection of five gRNAs without Cas9 caused no morphological effect.
Table S1 Sequences of genomic target sites and oligonucleotides used for constructing gRNA vectors
Figure S4 Sequences of the 5-gRNAs/Cas9-induced indel mutations in the golden, s1pr2, spns2-exon 5, spns2-exon 6 and tyrosinase target sites.
Table S2 PCR primers used in this study
Figure S1 DNA sequence of the guide RNA vector pCS2PgRNA.
10
Figure S6 Sequences of the targeted deletions and inversions at the spns2 locus in the 5 gRNAs plus Cas9-injected embryos.
Genes to Cells (2014)
© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd
Laboratory for Cardiovascular Molecular Dynamics, RIKEN Quantitative Biology Center (QBiC), Furuedai 6-2-3, Suita, Osaka 565-0874, Japan 2 Laboratory for Developmental Biology, Center for Medical Education and Sciences, Graduate School of Medical Science, University of Yamanashi, Shimogatou 1110, Chuo, Yamanashi 409-3898, Japan 3 Department of Chemistry, Graduate School of Science and Engineering, University of Toyama, Gofuku 3190, Toyama 930-8555, Japan
The type II clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) system, which is an adaptive immune system of bacteria, has become a powerful tool for genome editing in various model organisms. Here, we demonstrate multiple genome modifications mediated by CRISPR/Cas9 in zebrafish (Danio rerio). Multiple genes including golden/gol and tyrosinase/tyr, which are involved in pigment formation, and s1pr2 and spns2, which are involved in cardiac development, were disrupted with insertion and/or deletion (indel) mutations introduced by the co-injection of multiple guide RNAs (gRNAs) and the nuclease Cas9 mRNA. We simultaneously observed two distinct phenotypes, such as, the two hearts phenotype and the hypopigmentation of skin melanophores and the retinal pigment epithelium, in the injected F0 embryos. Additionally, we detected the targeted deletion and inversion genes as a 7.1-kb fragment between the two distinct spns2 targeted sites together with indel mutations. Conversely, chromosomal translocations among five target loci were not detected. Therefore, we confirmed that the CRISPR/Cas9-induced indel mutations and a locus-specific deletion were heritable in F1 embryos. To screen founders, we improved heteroduplex mobility assay (HMA) for simultaneously detecting indel mutations in different target loci. The results suggest that the multi-locus HMA is a powerful tool for identification of multiple genome modifications mediated by the CRISPR/Cas9 system.
Introduction An unprecedented amount of genome information is now available for various types of model organisms including plants and animals. At the same time, however, biological and developmental functions associated with the individual genes located in these genomes are not always well understood. The development of artificial site-specific nucleases such as zinc-finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) has enabled the investigation of loss-of-function phenotypes for genes of interest (Urnov et al. 2010; Bogdanove & Voytas 2011). Both Communicated by: Shigekazu Nagata *Correspondence: [email protected] † These authors contributed equally to this work.
ZFNs and TALENs are composed of a DNA-binding domain (zinc-finger domain or TALE domain) and the FokI nuclease catalytic domain. Double strand breaks (DSBs) induced by ZFNs or TALENs at the targeted genomic locus can be repaired by nonhomologous end-joining (NHEJ) or homologous recombination (HR) (Hisano et al. 2013). NHEJ-mediated repair often introduces insertion and/or deletion (indel) mutations into the site of the DSBs, resulting in frameshift mutations that disrupt gene function. Conversely, HR in the presence of a donor template results in precise genome modification by gene replacement. Overall, both ZFNs and TALENs are proven and powerful tools for genome editing. Recently, the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) system has emerged as a new genome editing
DOI: 10.1111/gtc.12154 © 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd
Genes to Cells (2014)
1
S Ota et al.
technology (Jinek et al. 2012). The CRISPR/Cas system is an adaptive immune system found in bacteria and archaea, and it protects those organisms’ genomes against invading viruses and plasmids (Wiedenheft et al. 2012). Several groups have demonstrated that type II CRISPR/Cas, CRISPR/Cas9, is especially useful for targeted genome modifications in mammalian cells (Cong et al. 2013; Mali et al. 2013) and various model organisms including zebrafish (Hwang et al. 2013), mouse (Li et al. 2013a), and rat (Li et al. 2013a,b). In this system, targeted genome sequences located adjacent to a protospacer adjacent motif (PAM) sequence (NGG) are recognized by guide RNA (gRNA)-containing complimentary sequences to the target site and are cleaved by a complex consisting of gRNA and the nuclease Cas9. Subsequent indel mutations induced by the nuclease Cas9 contribute to gene disruption. In fact, single gene disruption induced by CRISPR/Cas9 in zebrafish was already reported by several groups (Chang et al. 2013; Hruscha et al. 2013; Hwang et al. 2013; Jao et al. 2013; Sung et al. 2014). One characteristic feature of the CRISPR/Cas9 system is that it consists of two components, small molecule gRNA and the nuclease Cas9 (Jinek et al. 2012). In contrast, ZFN and TALEN are relatively large fusion proteins consisting of a DNA-binding domain and the FokI nuclease catalytic domain (Urnov et al. 2010; Bogdanove & Voytas 2011). This distinct feature makes CRISPR/Cas9 suitable for multiple genome modifications, because it is very easy to inject multiple gRNAs with the nuclease Cas9 in various types of embryos. Indeed, Jao et al. (2013) observed multiple genes disruption in F0 zebrafish embryos injected by multiple gRNAs with Cas9, but they did not determine the translocation among multiple target loci and the germ-line transmission of multiple genes disruption in F1 embryos. Xiao et al. (2013) have recently reported that the targeted deletions (0.6–1.5 kb) were detected in F0 zebrafish embryos injected by two gRNAs with Cas9, but they did not examine its germ-line transmission in F1 embryos. Whether various genome modification events, including targeted deletions, inversions and translocations, are heritable, however, remains unclear. When performing multiple genome modifications by CRISPR/Cas9, indel mutations should be detected at multiple targeted genomic loci simultaneously. Although several methods, such as the CelI assay (Miller et al. 2007) and high-resolution melt analysis (HRMA; Dahlem et al. 2012), have been 2
Genes to Cells (2014)
developed to detect indel mutations at a single locus, they are not suitable for the detection of multiple genome modifications at the same time. We previously demonstrated that the heteroduplex mobility assay (HMA) is suitable for detecting site-specific nuclease-mediated genome modifications (Ota et al. 2013). In the present study, we improved HMA as a multi-locus HMA that can detect multiple genome modifications and estimate the germ-line transmission rate of potential founders.
Results Multiple genome modifications by the CRISPR/ Cas9 system at five distinct genomic loci
To examine multiple CRISPR/Cas9-mediated genome modifications including targeted deletions, we chose four genes, golden/gol, tyrosinase/tyr, s1pr2 and spns2, because disruptions of these genes induce obvious morphological phenotypes. golden/gol encodes a putative cation exchanger that is required for the formation of melanosome (Lamason et al. 2005), while tyrosinase/tyr encodes a copper-containing enzyme that catalyzes the production of melanin from tyrosine by oxidation (Page-McCaw et al. 2004). Thus, the disruption of the gol or tyr locus leads to the hypopigmentation of skin melanophores and the retinal pigment epithelium (RPE). Conversely, s1pr2, which encodes a receptor of sphingosine-1-phosphate (S1P), and spns2, which encodes the S1P transporter, regulate the migration of cardiac progenitor cells and both s1pr2 and spns2 mutants exhibit the two hearts phenotype (cardia bifida) (Kupperman et al. 2000; Kawahara et al. 2009). We designed gRNAs against the above four genes as shown (Fig. S1 and Table S1 in Supporting Information). In the case of spns2, we prepared gRNAs for both spns2 exon 5 and exon 6 to investigate whether CRISPR/Cas9 induces targeted deletion and inversion in addition to indel mutations at multiple genomic loci. A mixture of gol-, s1pr2-, spns2-ex5-, spns2-ex6- and tyr-gRNA (five gRNAs) with Cas9 mRNA was injected into one- to two-cell stage embryos derived from Tg(cmlc2:EGFP) expressing enhanced green fluorescent protein (EGFP) in cardiomyocytes. F0 embryos (#1 and #2) injected with the 5 gRNAs plus Cas9 mRNA exhibited two hearts phenotype identical to the s1pr2 and spns2 mutants at 1 day postfertilization (dpf; Fig. 1A–C; 67%, n = 49). Subsequently, embryos #1 and #2 showed hypopigmentation of skin melanophores and the retinal pigment epithelium at 2 dpf (Fig. 1D–F). We observed
© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd
CRISPR/-mediated multiple gene disruptions
(A)
(B)
(C)
(D)
(E)
(F)
Figure 1 Multiple genome modifications by the CRISPR/ Cas9 system. (A, D) An uninjected control embryo derived from Tg(cmlc2:EGFP), which expresses EGFP in developing cardiac cells. (B, C, E, F) Tg(cmlc2:EGFP) derived embryos co-injected with 5 gRNAs (gol-, s1pr2-, spns2-ex5-, spns2-ex6and tyr-gRNA) plus Cas9 mRNA are shown. (A–C) Embryos injected with 5 gRNAs plus Cas9 mRNA showed the two hearts phenotype (cardia bifida) at 1 day postfertilization (dpf; B and C), whereas an uninjected embryo had one normal heart (A). (D–F) Injection of the 5 gRNAs with Cas9 mRNA decreased the number of pigment cells in the retinal epithelium (arrowheads) at 2 dpf (E and F), while an uninjected embryo had normal retinal pigment epithelial cells (D). #1 and #2 indicate different embryos. The embryos in (D), (E) and (F) correspond to the embryos in (A), (B) and (C), respectively. (A–C) Ventral view with anterior at the top. (D–F) Lateral view with anterior to the left and dorsal at the top.
that most embryos injected with the 5 gRNAs plus Cas9 mRNA exhibited hypopigmentation (severe, 58%; mild, 38%, n = 46; Fig. S2 in Supporting Information). Thus, embryos #1 and #2 simultaneously exhibited two distinct expected phenotypes, cardia bifida and hypopigmentation. We observed no obvious abnormal phenotypes when the 5 gRNAs without Cas9 were injected into the embryos (n = 71; Fig. S3 in Supporting Information), indicating that the nuclease Cas9 is indispensable for multiple genome modifications. To examine whether the five targeted loci contain indel mutations, we amplified the individual target genomic sites (100–150 bp) from genomic DNA from multiple individuals by PCR using locus-specific primers. The PCR amplicons were electrophoresed on 15% polyacrylamide gels; we previously reported as HMA (Ota et al. 2013). When multiple indel mutations induced by CRISPR/Cas9 occur in somatic cells, multiple heteroduplex bands (or smears) of slow migration in addition to homoduplexes should be observed. Indeed, we found that all PCR
amplicons for the five different loci exhibited multiple slow-migrating heteroduplexes (Fig. 2), suggesting that various indel mutations frequently occurred on these target sites in somatic cells. Random sequencing analysis using the PCR amplicons showed that the five genomic target sites contained various types of indel mutations at high mutation rates (gol, spns-2exon 5 and tyr; 79%–100%; s1pr2 and spns2-exon 6; 36%–41%; Fig. S4 in Supporting Information). We searched potential off-target sites against 5 gRNAs sequences using Cas-OFFinder (Bae et al. 2014). Candidate off-target sites are amplified from genomic DNA by PCR using the locus-specific primers, and the production of heteroduplex was determined by HMA. We found no obvious heteroduplex bands in individual off-target sites (Fig. S5 in Supporting Information), suggesting that the off-target effect is marginal in 5 gRNAs/Cas9-injected embryos. These results indicate that our CRISPR/Cas9 system efficiently and simultaneously introduces indel mutations into multiple loci without severe off-target effect. Targeted deletions and inversions were induced at the spns2 locus by the CRISPR/Cas9 system
Because we observed frequent indel mutations at the spns2-exon 5 and spns2-exon 6 target sites in the 5 gRNAs/Cas9-injected embryos, we examined whether targeted deletions and inversions at the spns2 locus (LG5) occurred in somatic cells. The distance between the two spns2 gRNA targets was approximately 7.1 kb
Figure 2 Heteroduplex mobility assay at five individual target sites. The five gRNA target loci were independently amplified by PCR using an uninjected embryo or 5 gRNAs/Cas9injected embryos (#1 and #2). Individual PCR products were separated on a 15% polyacrylamide gel. F0 embryos #1 and #2 both exhibited multiple heteroduplex bands (white lines) in addition to the expected homoduplex bands (asterisks).
© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd
Genes to Cells (2014)
3
S Ota et al.
and contained an intron (Fig. 3A). Four distinct locusspecific primers in the spns2 gene were used (Fig. 3B). If an expected targeted deletion occurs in the spns2 locus, short fragments (approximately 150 bp) should be amplified by using the spns2-e5S and spns2-e6AS primers. Conversely, if an expected targeted inversion occurs in the spns2 locus, then inversion junctions such
as those seen in Fig. 3B should be amplified as PCR amplicons using a combination of the spns2-e5S and spns2-e6S primers or the spns2-e5AS and spns2-e6AS primers. Simultaneously, we investigated whether two spns2 target loci are translocated to three other gRNA target sites (chromosomal translocation to s1pr2 in LG3, tyr in LG15 or gol in LG18). The expected
(A)
(B)
(C)
(D)
Figure 3 Targeted deletion and inversion were detected within the spns2 locus. (A) The structure of the spns2 gene (LG5), which contained the spns2-ex5 and spns2-ex6 targets. The distance between the two targets is 7.1 kb. (B) Schematic diagrams of the targeted deletion and inversion. The expected junctions of the targeted deletion and inversion are highlighted with four different colors. The locations of four primers (e5S, e5AS, e6S and e6AS) are indicated as thin arrows. (C, D) PCR products from genomic DNAs of uninjected- or 5-gRNAs/Cas9-mRNA-injected embryos were separated on 2% agarose gels. The primers used are shown above the gels. The targeted deletion was detected by the primers spns2-e5S and spns2-e6AS (C, lane 2; D, lane 2). The targeted inversion was detected by the primers spns2-e5S and spns2-e6S (C, lane 4) and by the primers spns2-e5AS and spns2e6AS (D, lane 4). The expected chromosomal translocations between the spns2 locus (LG5) and other loci (s1pr2 in LG3, tyrosinase in LG15 and golden in LG18) were not detected.
4
Genes to Cells (2014)
© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd
CRISPR/-mediated multiple gene disruptions
targeted deletions and inversions at the spns2 locus were detected and confirmed by sequencing analysis (Fig. 3C,D and Fig. S6 in Supporting Information). In contrast, the expected chromosomal translocations were not detected (Fig. 3C,D and Fig. S7 in Supporting Information). We furthermore examined whether the 7.1-kb fragment derived from the spns2 locus was inserted into other gRNA target sites on LG3, LG15 and LG18 but found that it was not (Fig. S8 in Supporting Information). Thus, the 7.1-kb fragment in the spns2 gene was excised by spns2-ex5- and spns2ex6-gRNA together with the nuclease Cas9, and in some cases, it was predominantly reintegrated in the opposite orientation into the spns2 locus but not into the other gRNA target sites located on different chromosomes. Multiple genome modifications induced by the CRISPR/Cas9 system are heritable
To investigate whether the multiple genome modifications induced by CRISPR/Cas9 are transmitted to the germ-line, we crossed potential F0 founders derived from the 5 gRNAs/Cas9-injected embryos to wild type. Based on our established HMA for a single target site (Ota et al. 2013), we improved HMA as a multi-locus HMA to achieve a highly efficient founder screen for multiple target sites. Because small indel deletions are predominant in genome editing, we designed the locus-specific primers of different sizes (50, 100 and 200 bp). We separately amplified the individual target sites by PCR, and the PCR products were mixed with three loci (s1pr2, 250 bp; tyr, 104 bp; gol 59 bp) or two loci (spns2-ex5, 153 bp; spns2-ex6, 64 bp) and electrophoresed on a 15% polyacrylamide gel. As shown in Fig. 4A,B, we could detect heteroduplex bands of up to three loci in the same lane. For example, F1 embryos #3 and #8 both of which were derived from the F0 founder female 3 have wild-type and mutant alleles in the s1pr2, tyr and gol loci (Fig. 4B). Overall, the HMA profiles of the progeny are dependent on the F0 founders (e.g., the F0 founder male 2 carries at least two types of mutations for tyr, gol and spns2-ex5), suggesting the generation of distinct indel mutations (Fig. 4A). We confirmed that another F0 founder, female 6, carries a mutation in spns2-ex6 (Fig. 4C). Thus, multiple genome modifications were effectively induced by multiple gRNAs/Cas9 injections into zebrafish and inherited by the progeny. Additionally, these data show that the multi-locus HMA is very useful for detecting multiple genome modifications.
The results of the multi-locus HMA furthermore suggested that F0 founder male 2 carries tyr, gol and spns2-ex5 mutations and that F0 founder female 3 carries s1pr2, tyr, gol and spns2-ex5 mutations, raising the possibility that crossing these two F0 founders should produce biallelic mutations for tyr, gol and spns2-ex5 and result in two distinct phenotypes. The severe mosaic stripe patterns in the skin of F0 founder male 2 and female 3 suggest that they indeed have stable biallelic mutations in the gol and/or tyr genes (Fig. 5A–C). Four different F1 embryos (#1– #4) derived from the crossing of F0 founder male 2 and female 3 (Fig. 5D–K) were investigated. F1 embryo #1 showed no obvious abnormal phenotype (Fig. 5D,E); F1 embryos #2 and #3 exhibited the cardia bifida phenotype with normal pigmentation in the skin (Fig. 5F–I); and F1 embryo #4 presented both the cardia bifida and hypopigmentation phenotypes (Fig. 5J,K). Sequencing analysis confirmed the genotypes of the individuals: F1 embryo #1 had at least one WT allele for all target loci; F1 embryo #2 had a WT allele and a 2-bp deletion allele for the spns2-ex5 locus as well as a WT allele and a 4-bp deletion allele for the spns2-ex6 locus; F1 embryo #3 had two frameshift mutation alleles for the spns2-ex5 locus; F1 embryo #4 had two frameshift mutation alleles for the spns2-ex5 locus and the gol locus (Fig. 5L). Because F1 embryo #2 exhibited the cardia bifida phenotype, one spns2 allele of this embryo should have the 2 bp deletion, and the other spns2 allele should have the 4 bp deletion. The cardia bifida and/ or hypopigmentation phenotypes in the F1 embryos #3 and #4 were consistent with the genotypes of these embryos. Finally, we examined whether the targeted deletion and inversion of the spns2 locus are transmitted into the germ-line. We screened the progeny of the 11 potential F0 founder fish and found that F0 founder female 8 transmitted a 7.1-kb deletion of the spns2 locus to F1 embryos with a transmission rate of 18.8% (12/64), but we could not detect the inversion (0/64; Fig. S9 in Supporting Information). Sequence analysis confirmed that the F0 founder fish transmitted only one pattern of deleted alleles. Consistent with above observation, it was reported that 3 in 19 F0 founders produced the targeted deletion induced by two TALEN sets for the target gene, while the inversion was detected from only one F0 founder (Xiao et al. 2013). We furthermore examined the possibility of translocation between spns2 locus and other loci. We could not any translocation
© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd
Genes to Cells (2014)
5
S Ota et al. (A)
(B)
(C)
Figure 4 Multi-locus heteroduplex mobility assay for the detection of multiple genome modifications. (A, B) F0 founders male 2 (A) and female 3 (B) were out-crossed with wild-type zebrafish. Subsequently, 5 target loci were independently amplified from the genomic DNA of eight individual embryos. Mixtures of PCR amplicons (s1pr2, tyr and gol or spns2-ex5 and spns2-ex6) were applied to single lanes and separated on 15% polyacrylamide gels. All target loci except for the spns2-ex6 locus had heteroduplex DNAs (circles). (C) A summary of the founder screening. Individual potential F0 founders possessed three or four indel mutations at the five genomic target sites.
in F1 embryos derived from five F0 founders (Fig. S10 in Supporting Information). We emphasize that the chromosomal deletions as well as multiple indel mutations induced by CRISPR/Cas9 were heritable in zebrafish.
Discussion In the present study, we demonstrated simultaneous multiple genome modifications by the CRISPR/Cas9 system in zebrafish. We chose four genes, s1pr2, spns2, 6
Genes to Cells (2014)
gol and tyr, as CRISPR/Cas9 targets because their mutant phenotypes are obvious (Kupperman et al. 2000; Page-McCaw et al. 2004; Lamason et al. 2005; Kawahara et al. 2009). We simultaneously observed two distinct phenotypes, cardia bifida and hypopigmentation, in the 5 gRNAs/Cas9-injected embryos, indicating that the CRISPR/Cas9 system is very useful for the generation of multiple mutations, as previously reported (Jao et al. 2013). In addition, we demonstrated that CRISPR/Cas9-mediated targeted deletions and inversions occurred together with indel
© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd
CRISPR/-mediated multiple gene disruptions
(A)
(B)
(D)
(E)
(F)
(G)
(H)
(I)
(J)
(K)
(C)
(L)
Figure 5 CRISPR/Cas9-mediated indel mutations are heritable. (A–C) Four-month-old WT zebrafish (A), F0 founder male 2 (B), and F0 founder female 3 (C). The F0 founders had mosaic stripe patterns in their skin (areas within white broken rectangles). (D–K) The embryos obtained from the in-crossing of the F0 founders male 2 and female 3. (D, E) F1 embryo #1 showed no developmental abnormality. (F–I) F1 embryos #2 and #3 showed cardia bifida at 1 dpf. (J, K) F1 embryo #4 exhibited cardia bifida at 1 dpf and hypopigmentation of skin melanophores and the retinal pigment epithelium at 2 dpf. (L) Genotypes of the individual F1 embryos. (A–C) Lateral view with anterior to the right and dorsal at the top. (D, F, H, J) Ventral view with anterior at the top. (E, G, I, K) Lateral view with anterior to the left and dorsal at the top.
mutations in the 5 gRNAs/Cas9-injected embryos. Importantly, these multiple modifications included a large deletion that was heritable. To our knowledge, this is the first report to show the germ-line transmission of the simultaneous multiple targeted genes disruption and the targeted chromosomal deletion in
zebrafish, when multiple gRNAs are injected with the Cas9 mRNA into zebrafish embryos. By examining the F1 progeny derived from the potential F0 founders, we showed that the multiple mutant alleles were independently inherited by the progeny. We also examined whether chromosomal translocations between the spns2 locus (LG5) and other target loci (s1pr2 in LG3, tyr in LG15 and gol in LG18) were induced by CRISPR/Cas9. In the 5 gRNAs/ Cas9-injected embryos, PCR amplification using the locus-specific primers failed to reveal such chromosomal translocations. Cho et al., however, did find CRISPR/Cas9-mediated chromosomal translocations between on-target and off-target loci (Cho et al. 2014). However, their study investigated mammalian cells, while ours used live zebrafish embryos; unknown mechanisms may protect vertebrates from such translocations during early development. Additionally, the chromosomal locations of the targets may affect the efficacy of the chromosomal translocations. Indeed, the spns2 locus is located near the center of the chromosome, while the other genes (gol, s1pr2 and tyr) are located near the ends. The previously reported chromosomal translocations were detected in two target loci located near the chromosome ends (Cho et al. 2014), raising the possibility that short chromosomal fragments move more easily to other chromosomes. This speculation is consistent with our finding that chromosomal translocations among the gol, s1pr2 and tyr loci did not occur along with the multiple genome modifications (Fig. S7 in Supporting Information). Precise genome modifications are difficult to generate with the TALEN-mediated gene knock-in technology (Bedell et al. 2012; Zu et al. 2013). Therefore, it is very important to understand how donor fragments are integrated into the targeted genomic locus. We observed that a 7.1-kb fragment in the spns2 locus was excised from the chromosome by CRISPR/Cas9 and reintegrated in the opposite orientation at the same locus. At the same time, we did not detect the integration of this fragment into other target loci (gol, s1pr2 and tyr) located in other chromosomes, suggesting the importance of the distance between the fragment and the target locus during chromosomal integration. Our findings suggest that artificial access by the donor DNA to the target locus might improve the effectiveness of targeted gene knock-in technology. We previously demonstrated that HMA is very useful for detecting small indel mutations induced by artificial nucleases and for identifying possible founders that possess useful mutant alleles (Ota et al. 2013). In
© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd
Genes to Cells (2014)
7
S Ota et al.
the present study, we improved HMA as multi-locus HMA to simultaneously analyze different target loci. Because the CRISPR/Cas9 system is suitable for multiple genome modifications, our multi-locus HMA provides a powerful tool for the detection of simultaneous genome modifications in genome editing.
Experimental procedures Guide RNA vector and Cas9 plasmid To construct a pCS2P-gRNA vector containing the T7 promoter, the sequence of the gRNA scaffold was amplified from the pDR274 vector (Hwang et al. 2013) by PCR using the primers T7-gRNA-EcoRI (50 -GGAATTCTAATAC GACTCACTATAGGAGACGCTGCAGCCCGGGGGATC CCGTCTCGTTTTAGAGCTAGAAATAG-30 ) and gRNASmaI (50 -TCCCCCGGGAAAAAAAGCACCGACTCGGTG C-30 ). After EcoRI and SmaI digestion, the resultant fragments were inserted into the EcoRI and SnaBI-cleaved pCS2P vector. To construct an individual gRNA vector encoding gRNAs with customized targeting sequences, appropriately designed and annealed oligonucleotides were inserted into the BsmBI-cleaved pCS2P-gRNA vector. The sequences of the genomic target sites and oligonucleotides are listed in Table S1. The pCS2-hSpCas9 plasmid was kindly provided by Dr. Kinoshita (Kyoto University).
Preparation of gRNA and Cas9 mRNA Template DNAs of the gRNAs were prepared by PCR amplification using the following primers gRNA-F (50 -GAATTCT AATACGACTCAC-30 ) and gRNA-R (50 -AAAAGCACC GACTCGG-30 ). The PCR products were purified using the MinElute Gel Extraction kit (QIAGEN, Venlo, The Netherlands) after agarose gel electrophoresis. gRNAs were transcribed using the MAXIscript T7 kit (Life Technologies, Carlsbad, CA, USA) and purified by phenol–chloroform extraction and EtOH precipitation. We selected a sequence of the form 50 -GGN18NGG-30 in the zebrafish genome as a CRISPR/Cas9 target (Table S1 in Supporting Information). Because previous studies showed that gRNAs that contain 1–2 nucleotide mismatches with their genomic target sequences at the 50 end are functional, we also introduced a mismatch nucleotide into the s1pr2 and tyr target sites to contain a GG dinucleotide at the 50 end for transcription by T7 RNA polymerase. For Cas9 mRNA, pCS2hSpCas9 was linearized with NotI digestion. Cas9 mRNA was transcribed using the mMESSAGE mMACHINE SP6 kit (Life Technologies) and purified using the RNeasy Mini Kit (QIAGEN).
Microinjection We established a stable Tg(cmlc2:EGFP) line by injection of pTol-cmlc2 promoter-EGFP plasmid with Tol2 RNA. Five
8
Genes to Cells (2014)
gRNAs (gol-, s1pr2-, spns2-ex5-, spns2-ex6- and tyr-gRNA; 25 pg each) and Cas9 mRNA (250 pg) were co-injected into 1-2 cell stage zebrafish embryos derived from Tg(cmlc2:EGFP) fish.
Preparation of genomic DNA Uninjected or 5 gRNAs/Cas9-mRNA-injected embryos were incubated in 50 ll of lysis buffer (10 mM Tris-HCl [pH 8.0], 1 mM EDTA, 0.3% Tween-20 and 0.3% NP40 containing 200 lg/ml proteinase K) at 55 °C for 3 h. Then, the solution was incubated at 100 °C for 10 min to inactivate proteinase K.
Heteroduplex mobility assay (HMA) and multi-locus HMA Genomic DNAs were prepared from uninjected embryos and 5 gRNAs/Cas9 mRNA-injected embryos at 2 days postfertilization (dpf). DNA fragments (100–150 bp) containing individual gRNA target sites were amplified by PCR with TaKaRa Ex Taq (TaKaRa, Otsu, Japan) using the locus-specific primers listed in Table S2. The PCR conditions were as follows: 30 cycles of 98 °C for 10 s, 55 °C for 30 s and 72 ° C for 30 s. The resulting PCR products were electrophoresed on a 15% polyacrylamide gel. To estimate the mutation rate for the individual gRNA target sites, PCR products were subcloned into the pGEM-T Easy vector (Promega, Madison, WI, USA). After the plasmid DNAs were prepared from individual colonies, random sequencing was carried out. For multi-locus HMA, we designed the locus-specific primers that produce different sized PCR products. Individual PCR product sizes were the following: 59 bp for gol, 104 bp for tyr, 250 bp for s1pr2, 153 bp for spns2-ex5 and 64 bp for spns2-ex6. The PCR products of gol, tyr and s1pr2 were mixed at a ratio of 6:3:1 and applied in a single lane. The PCR products of spns2-ex5 and spns2-ex6 were mixed at a ratio of 4 : 5 and applied in a single lane.
Detection of targeted deletion and inversion Targeted deletion and inversion between the spns2-exon5 and spns2-exon6 loci were analyzed by the PCR amplification of the spns2 target sites using the locus-specific primers listed in Table S2. The PCR conditions were as follows: 94 °C for 2 min, and 35 cycles of 98 °C for 10 s and 68 °C for 30 s. The resulting PCR products were electrophoresed on a 2% agarose gel. To detect the targeted deletion, the forward primer of the spns2-exon 5 target and the reverse primer of the spns2-exon 6 target were used. To detect the targeted inversion, the forward primer of the spns2-exon 5 target and the forward primer of the spns2-exon 6 target or the reverse primer of the spns2-exon 5 target and the reverse primer of the spns2exon 6 target were used. The PCR products were subcloned into the pGEM-T Easy vector. After plasmid DNAs were pre-
© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd
CRISPR/-mediated multiple gene disruptions pared from individual colonies, random sequencing was carried out. To detect chromosomal translocations, the locus-specific primers located on other target genes on different chromosomes were used.
Acknowledgements We would like to thank R. Fukuoka, M. Komeno, M. Hayashi and S. Ohara for zebrafish maintenance, P. Karagiannis for valuable comments, and F. Zhang and M. Kinoshita for pCS2hSpCas9. S. Ota was supported by the Research Fellow of Japan Society for the Promotion Science. This work was supported by the Program for Next Generation World-Leading Researchers (NEXT Program), the Japan Society for the Promotion of Science and Takeda Science Foundation.
References Bae, S., Park, J. & Kim, J.S. (2014) Cas-OFFinder: a fast and versatile algorithm that searches for potential off-target sites of Cas9 RNA-guided endoncleases. Bioinformatics Doi:10. 1093/bioinformatics/btu048. Bedell, V.M., Wang, Y., Campbell, J.M., et al. (2012) In vivo genome editing using a high-efficiency TALEN system. Nature 491, 114–118. Bogdanove, A.J. & Voytas, D.F. (2011) TAL effectors: customizable proteins for DNA targeting. Science 333, 1843– 1846. Chang, N., Sun, C., Gao, L., Zhu, D., Xu, X., Zhu, X., Xiong, J.W. & Xi, J.J. (2013) Genome editing with RNAguided Cas9 nuclease in Zebrafish embryos. Cell Res. 23, 465–472. Cho, S.W., Kim, S., Kim, Y., Kweon, J., Kim, H.S., Bae, S. & Kim, J.S. (2014) Analysis of off-target effects of CRISPR/Cas-derived RNA-guided endonucleases and nickases. Genome Res. 24, 132–141. Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X., Jiang, W., Marraffini, L.A. & Zhang, F. (2013) Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819–823. Dahlem, T.J., Hoshijima, K., Jurynec, M.J., Gunther, D., Starker, C.G., Locke, A.S., Weis, A.M., Voytas, D.F. & Grunwald, D.J. (2012) Simple methods for generating and detecting locus-specific mutations induced with TALENs in the zebrafish genome. PLoS Genet. 8, e1002861. Hisano, Y., Ota, S. & Kawahara, A. (2013) Genome editing using artificial site-specific nucleases in zebrafish. Dev. Growth Differ. 56, 26–33. Hruscha, A., Krawits, P., Rechenberg, A., Heinrich, V., Hecht, J., Haass, C. & Schmid, B. (2013) Efficient CRISPR/Cas9 genome editing with low off-target effects in zebrafish. Development 140, 4982–4987. Hwang, W.Y., Fu, Y., Reyon, D., Maeder, M.L., Tsai, S.Q., Sander, J.D., Peterson, R.T., Yeh, J.R. & Joung, J.K. (2013) Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat. Biotechnol. 31, 227–229.
Jao, L.E., Wente, S.R. & Chen, W. (2013) Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc. Natl Acad. Sci. USA. 110, 13904–13909. Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J.A. & Charpentier, E. (2012) A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816–821. Kawahara, A., Nishi, T., Hisano, Y., Fukui, H., Yamaguchi, A. & Mochizuki, N. (2009) The sphingolipid transporter spns2 functions in migration of zebrafish myocardial precursors. Science 323, 524–527. Kupperman, E., An, S., Osborne, N., Waldron, S. & Stainier, D.Y. (2000) A sphingosine-1-phosphate receptor regulates cell migration during vertebrate heart development. Nature 406, 192–195. Lamason, R.L., Mohideen, M.A., Mest, J.R., et al. (2005) SLC24A5, a putative cation exchanger, affects pigmentation in zebrafish and humans. Science 310, 1782–1786. Li, D., Qiu, Z., Shao, Y., Chen, Y., Guan, Y., Liu, M., Li, Y., Gao, N., Wang, L., Lu, X., Zhao, Y. & Liu, M. (2013a) Heritable gene targeting in the mouse and rat using a CRISPR-Cas system. Nat. Biotechnol. 31, 681–683. Li, W., Teng, F., Li, T. & Zhou, Q. (2013b) Simultaneous generation and germline transmission of multiple gene mutations in rat using CRISPR-Cas systems. Nat. Biotechnol. 31, 684–686. Mali, P., Yang, L., Esvelt, K.M., Aach, J., Guell, M., DiCarlo, J.E., Norville, J.E. & Church, G.M. (2013) RNA-guided human genome engineering via Cas9. Science 339, 823–826. Miller, J.C., Holmes, M.C., Wang, J., Guschin, D.Y., Lee, Y.L., Rupniewski, I., Beausejour, C.M., Waite, A.J., Wang, N.S., Kim, K.A., Gregory, P.D., Pabo, C.O. & Rebar, E.J. (2007) An improved zinc-finger nuclease architecture for highly specific genome editing. Nat. Biotechnol. 25, 778–785. Ota, S., Hisano, Y., Muraki, M., Hoshijima, K., Dahlem, T.J., Grunwald, D.J., Okada, Y. & Kawahara, A. (2013) Efficient identification of TALEN-mediated genome modifications using heteroduplex mobility assays. Genes Cells 18, 450–458. Page-McCaw, P.S., Chung, S.C., Muto, A., Roeser, T., Staub, W., Finger-Baier, K.C., Korenbrot, J.I. & Baier, H. (2004) Retinal network adaptation to bright light requires tyrosinase. Nat. Neurosci. 7, 1329–1336. Sung, Y.H., Kim, J.M., Kim, H.T., Lee, J., Jeon, J., Jin, Y., Choi, J.H., Ban, Y.H., Ha, S.J., Kim, C.H., Lee, H.W. & Kim, J.S. (2014) Highly efficient gene knockout in mice and zebrafish with RNA-guided endonucleases. Genome Res. 24, 125–131. Urnov, F.D., Rebar, E.J., Holmes, M.C., Zhang, H.S. & Gregory, P.D. (2010) Genome editing with engineered zinc finger nucleases. Nat. Rev. Genet. 11, 636–646. Wiedenheft, B., Sternberg, S.H. & Doudna, J.A. (2012) RNA-guided genetic silencing systems in bacteria and archaea. Nature 482, 331–338. Xiao, A., Wang, Z., Hu, Y., Wu, Y., Luo, Z., Yang, Z., Zu, Y., Li, W., Huang, P., Tong, X., Zhu, Z., Lin, S. &
© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd
Genes to Cells (2014)
9
S Ota et al. Zhang, B. (2013) Chromosomal deletions and inversions mediated by TALENs and CRISPR/Cas in zebrafish. Nucleic Acids Res. 41, e141. Zu, Y., Tong, X., Wang, Z., Liu, D., Pan, R., Li, Z., Hu, Y., Luo, Z., Huang, P., Wu, Q., Zhu, Z., Zhang, B. & Lin, S. (2013) TALEN-mediated precise genome modification by homologous recombination in zebrafish. Nat. Methods 10, 329–331.
Figure S5 Off-target analysis of multiple gRNAs/Cas9induced mutations.
Received: 18 February 2014 Accepted: 26 March 2014
Figure S8 The 7.1-kb fragment between the two distinct spns2 gRNA target sites in the spns2 locus was reintegrated in the opposite orientation into the spns2 locus (inversion, lane 2).
Supporting Information Additional Supporting Information may be found in the online version of this article at the publisher’s web site:
Figure S7 Examination of chromosomal translocations among the s1pr2 (LG3), tyr (LG15) and gol (LG18) loci.
Figure S9 The targeted 7.1-kb deletion of the spns2 locus was transmitted into the germ-lines.
Figure S2 Multiple genome modifications by the CRISPR/ Cas9 system.
Figure S10 The chromosomal translocations between the spns2 (LG5) and other loci (s1pr2 in LG3, tyrosinase in LG15 and golden in LG18) were not detected in F1 embryos derived from the F0 founders (female 8, male 6, male 8, male 9 and male 11).
Figure S3 Injection of five gRNAs without Cas9 caused no morphological effect.
Table S1 Sequences of genomic target sites and oligonucleotides used for constructing gRNA vectors
Figure S4 Sequences of the 5-gRNAs/Cas9-induced indel mutations in the golden, s1pr2, spns2-exon 5, spns2-exon 6 and tyrosinase target sites.
Table S2 PCR primers used in this study
Figure S1 DNA sequence of the guide RNA vector pCS2PgRNA.
10
Figure S6 Sequences of the targeted deletions and inversions at the spns2 locus in the 5 gRNAs plus Cas9-injected embryos.
Genes to Cells (2014)
© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd
