66 7 @ 1992 The Japanese Society of Pathology
Case Report of Primary Cardiac Lymphoma The Applications of PCR to the Diagnosis of Primary Cardiac lymphoma
Kiyoshi Kasai', Sadahito Kuwao', Yuichi Sato', Masakazu MurayamaZ, Yuji Harano2, and Toru Kameyal
A 75-year-old man initially complained of pollakiuria and low abdomlnal pain, and died of massive bleeding from an exacerbated gastric ulcer. The dlagnosis of primary cardiac lymphoma was made postmortem. The tumor involved only the epicardium and myocardium, which met the criteria of primary cardiac lymphoma as defined by the Armed Forces Institute of Pathology. The lymphoma consisted of large cells and expressed the B cell marker, CDZO. Although chronic inflammation due to chronic renal failure was observed in the pericardium around the lymphoma, polymerase chain reaction (PCR) was conducted to detect monoclonality at the DNA level in lymphoma cells, which were shown to comprise a monoclonal population. Acta Pathol Jpn 42 : 667-671, 1992.
Primary cardiac lymphoma, B cell lymphoma, Chronic pericarditis, PCR
Key words:
P rima ry cardiac lymphoma with extra nodaI lymphoma involving only the epicardium and myocardium is rare, although frequent secondary involvement of the heart by malignant lymphoma has been frequently described (1, 2). Most cases of primary cardiac lymphoma so far reported were diagnosed incidentally postmortem. Thus, possible underlying causes for the development of most primary cardiac lymphomas remain unclear. Some cases of primary cardiac lymphoma in patients with acquired immune deficiency syndrome (AIDS) have been reported (3,4). This paper presents a case of primary cardiac Received March 18, 1992. Accepted for publication May 6,1992. 'Department of Pathology and aDepartment of Urology, Kitasato University School of Medicine, Kanagawa. Mailing address: Kiyoshi Kasai, M.D., Department of Pathology, Kitasato University School of Medicine, Kitasato 1-151, Sagamihara, Kanagawa 228, Japan.
lymphoma with special reference to immunohistochemical findings and polymerase chain reaction (PCR) results, and the etiologic factors of primary cardiac lymphoma are discussed.
CASEREPORT A 75-year-old Japanese man had been treated for benign prostatic hypertrophy for 15 years and gastric ulcer for 14 years. The family history was non-contrib utory. He presented with pollakiuria, decreased urine volume and lower abdominal pain and was admitted to Kitasato University Hospital due to his chief complaints and examination results. A t the time of physical examination, neither superficial lymph nodes nor a mass could be detected. Erythrocyte sedimentation rate at the time of admission was 55 mm/h. The hematocrit was 41.9%, hemoglobin 14.2 g/dl, red blood cell count 4 . 3 ~ 106/mm3 and platelet count, 26.9x1O4/mm3. White blood cell count was 6,000/mms with 54% segmented neutrophils, 18% lymphocytes, 5% eosinophils and 8% monocytes, indicating slight lymphocytopenia. Subsets of peripheral blood lymphocytes were not analyzed. Peripheral blood smears showed no abnormal cells. The sodium level was 1 2 8 mEq/l, potassium 5.9 mEq/l, chloride 97 mEq/l, calcium 8.1 mg/l, phosphate 3.8 mg/dl. Blood urea nitrogen was 3 5 mg/dl, creatinine 2.5 mg/dl and uric acid 10.9 mg/dl, indicating mild renal failure. Total protein was 6.7 g/dl and albumin 2.9 g/dl. Serum immunoglobulins were not measured. Total bilirubin was 0.9 mg/dl, sGOT 4 9 IU/l, sGPT 11 lU/l, and alkaline phosphatase 132 IU/I. Cardiac enzymes showed ele vated CPK 221 IU/I (normal, 50-176) and LDH 2,300 IU/I (normal, 180-350). Urinalysis on admission showed a pH of 5.0, positive for protein but no sugar or a normal reaction for urobilinogen A serum antibody to human immune deficiency virus (HIV) was not examined.
668
Primary Cardiac Lymphoma (Kasai et a/.)
Slight cardiomegaly and calcification of the aorta were noted on chest roentogenogra ms. Electrocardiogram results showed sinus rhythm with non-specific ST-T changes. Excretory urography (IVP) indicated nonvisualization of the right kidney but no abnormalities in the left ureter and kidney. Computerized tomograms (CT) showed slight swelling of lymph nodes in the paraaortic area. Gastrofiberscopy indicated two ulcers of the gastric fundus. Gastrointestinal bleeding from the gastric ulcer subsequently occurred and progressed to disseminated intravascular coagulation (DIC). Despite efforts to stabilize the patients' conditions, he died on the 1 6 t h day of hospitalization. Autopsy was performed 12 hours postmortem. The body weighed 63 kg. Although the left thoracic cavity contained 100 ml of yellow fluid, no pericardial effusion was found in the pericardial cavity. The heart weighed 400 g. The epicardium of the antero-lateral wall of the right atrium and ventricle was thickened and a grayishwhite tumor measuring 7 x 4 ~ cm 2 in dimensions was found situated beneath the epicardium and along the antero-lateral wall of the right side of the heart (Fig. 1). The tumor infiltrated the free wall of the right atrium and ventricle but did not extend t o the endocardium, atrial and ventricular septae or left atrium and ventricle. A small tumor in the prostate measuring 1 cm in diameter was found with no metastasis. There were 3 gastric ulcers of 3 m m in diameter o r less on the upper part of the lesser curvature. The edges were clear cut but not raised or rolled. The surface of the ulceration was
Figure 1. Macroscopic findings of the heart weighing 400 g, sectioned t o show a homogeneous, grayish-white tumor in the antero-lateral wall of right atrium and ventricle. The arrow indicates the tumor.
covered with blood clots. The spleen was congested. The capsules of both kidneys were stripped with slight difficulty, leaving a finely granular, reddish-brown surface. Both kidney pelves were slightly dilated. Bronchopneumonia, chronic cystitis and arteriosclerosis were also evident.
MATERIALS AND METHODS Tissues of the cardiac lesion described above were fixed in 10% formalin, routinely processed and embedded in paraffin. Three pm-thick paraffin sections were stained with hematoxylin and eosin or were immunostained as described previously (5). Briefly, the sections were deparaffinized in xylene and soaked in absolute methanol containing 0.3% H,O, for 30 min to block endogenous peroxidase activity. After being washed in phosphate buffered saline (PBS) for 2 0 min, the sections were incubated with antibodies overnight at 4°C. Immunoperoxidase staining was then performed according to the Avidin-biotin-complex (ABC) method. The reagents used for the ABC method were purchased from Vector Laboratory, CA. Dilution and incubation time were as specified by the staining procedure of the VECTASTAIN ABC KIT. The following antibodies were used : anti-immunoglobulin (Ig) heavy chains (IgG, IgA, IgM), anti-lg light chains ( x , 1) and SL26 (CD20) were purchased f r o m Dakopatts, Copenhagen. U C H L l (CD45RO) was purchased from Nichirei, Tokyo. Oligomer primers of Ig heavy chain genes used in the PCR were synthesized on an Applied Biosystems Model 381A (Applied Biosystems Inc., Foster City) and their sequences were the following and as described previously (6). For a primer common t o most VH segments and another primer complimentary to all JH region, 5CTGTCGACACGGCCGTGTATTACTG3' and 5AACTGCAGAGGAGACGGTGACC3' were synthesized. They were purified using oligonucleotide purification cartridges (Applied Biosystems Inc.). DNA for PCR was extracted from formalin-fixed paraffin embedded tissues (six 10-pm-thick sections) according t o methods reported previously(7). PCR was conducted in a thermal reactor (Hybaid, Middlesex). The reaction mixture contained a total amount of 1 ,ug of sample DNA, 10 m M Tris-HCI (pH 8.8),50 m M KCI, 2.5 m M MgCI,, 0.1 mg/ ml gelatin, 2 0 0 p M dNTP, 0.5,uM of each 5'- and 3'primers and 2.5 units of Amplitaq polymerase (Takara, Kyoto) a t a final volume of l 0 O p I . The mixture was overlaid with mineral oil and then amplified. The amplification was carried out for 30 cycles, each consisting of annealing for 30 seconds at 55"C, extension for 1 minute at 72'C, and denaturation for 30 seconds at 94°C. PCR products were electrophoresed in a 3%
Acta Pathologica Japonica 42 (9) : 1992
669
Figure 2. Hematoxylin and eosin (HE) staining of the cardiac lymphoma ( a ) showing neoplastic infiltrations comprising of large lymphoid cells and HE staining of the epicardium (b) showing small lymphocytic infiltration and fibrinous exudates of the epicardial surface.
agarose gel and stained with ethidium bromide and photographed as described previously (5). Histopathological findings and results of PCR of the cardiac tumor Light microscopy showed the tumor t o consist of sheets of atypical large lymphoid cells having indistinct cytoplasm and oval or round vesicular nuclei with a few nucleoli. The tumor cells proliferated densely and infiltrated the epicardium and myocardium (Fig. 2a). The surface of the epicardium of the right atrium and ventricle was slightly thickened by fibrosis and was infiltrated by a small number of small lymphocytes and was partially covered by fibrinous exudates (Fig. 2b), indicating chronic pericardit is. lmmunohistochemical examination using paraffin-embedded tissue indicated the cytoplasm of many large lymphoid cells to positively stain with SL26 (CD20) (Fig. 3) but not with UCHLl (CD45RO). The large lymphoid cells were thus Of B-cell lineage. However, no k G , k A , IgM, x chains or , Ichains could be detected in these
Figure 3. lmmunoperoxidase staining by SL26 of a section of the cardiac lymphoma. sL26 reacted with most lymphoma cells.
6 70
Primary Cardiac Lyfmphoma (Kasai et d.)
1 2
194bp 118bp
Figure 4. PCR products of I g heavy chain genes in the patient with cardiac lymphoma. lane 1, lambda phage DNA following digestion with Hind Ill as a molecular weight marker; lane 2, PCR products amplified from paraffin embedded sections of the cardiac lymphoma.
cells. PCR was conducted to detect monoclonality a t the DNA level in lymphoid cell populations in paraffinembedded sections. The results of PCR are shown in Fig. 4. One sharp band within the predicted size ranging from 100 base pairs (bp) to 120 bp was amplified from sections, suggesting neoplastic disease. No lymphoma cells could be found in lymph nodes, including the mediastinal and the paraaortic lymph nodes, spleen, liver, or bone marrow. Histological examination of both kidneys showed arteriolar benign nephrosclerosis and chronic pyelonephritis. In the prostate, moderately differentiated adenocarcinoma was diagnosed corresponding to a nodular lesion measuring 1 c'm in diameter without metastasis.
DISCUSSION Primary cardiac lymphoma is an extremely rare disease and is defined as an extranodal lymphoma involving only the heart and pericardium since secondary lymphomatous involvement of the heart is far more common (1, 2). In the present case, the tumor invaded the epicardium and myocardium of the right atrium and ventricle and no metastasis outside the heart could be seen at autopsy, thus confirming the diagnosis of primary cardiac lymphoma. Although primary sarcomas are commonly noted on the right side of the heart, more than half of primary cardiac lymphomas so far reported were shown to involve the right atrium and ventricle (2).
The common histologic and immunohistochemical features of primary cardiac lymphoma previously reported in detail represent diffuse large cell lymphoma of B-cell origin (2). Although approximately 20 primary cardiac lymphomas have been described, their etiologic factors have yet to be clarified in detail (8-15). Recently, a few cases of primary cardiac lymphoma in immunocompromised patients including a renal transplant recipient 16). and those with AIDS have been reported (3,4, Slight lymphocytopenia was noted in the present case but the antibody to HIV and serum immunological tests were not examined. A case in which the high-titer antinuclear antibody was identified in the pericardial fluid of a patient with primary cardiac lymphoma has been presented (17) and extranodal malignant lymphomas arising in organ-specific autoimmune disease have also been noted (18). Lymphomas arising in such patients were exclusive of the B-cell type as also noted in the present case. Pyothorax-associated lymphomas have recently been reported (19). They developed in tissue affected by inflammation of a non-autoimmune nature over a long period. Thus, chronic inflammatory stimulation of a non-autoimmune nature may be an etiologic factor for the development of malignant lymphoma (19). In the present case, chronic non-specific inflammation associated with renal failure due to arteriolar benign nephrosclerosis was observed in the pericardium around the cardiac tumor, although the exact relationship between the chronic inflammatory stimulation and the development of lymphoma in the present case remains undetermined. In this study, the B cell antigen (CD20) was expressed in lymphoma cells but no Ig heavy or light chains could be detected. lmmunohistochemical analysis of Ig heavy and light chains is the most useful immunophenotypic means for confirming B-lineage tumors but their lineage-specific antigens, including Ig and B cell antigens, have been reported as undetectable in a subset of B-cell lymphoma (20), although the immunoreactivity of Ig may possibly have been lost in the formalin-fixed paraffin embedded sections in the present study. The finding of clonal rearrangement of Ig genes in these tumors may thus support the diagnosis of lymphoma. Recently, analysis of Ig genes in the paraffin embedded sections by PCR has been shown to be useful for distinguishing neoplastic from reactive disorders (21). Although chronic non-specific inflammation was noted around the lymphoma in the present case, amplified Ig DNA of a single size was found in paraffin-embedded sections by PCR, indicating a monoclonal cell population to be present in the cardiac tumor and, thus confirming the tumor to be of B-lineage.
Acta Pathologica Japoriica 42 (9): 1992 Acknowledgements : We are grateful to Mrs. Tomoko Tsuruta, Kuniko Kadoya and Benio Sato for their technical assista nce.
REFERENCES 1. McAllister HA and Fenoglio JJ. Malignant lymphoma. In McAllister HA and Fenoglio JH, eds. Tumors of the Cardiovascular System. (Atlas of Tumor Pathology, 2nd Series, Fascicle 15) Armed Forces Institute of Pathology, Washington, D.C., 1978: 99-100. 2. Curtsinger CR, Wilson MJ, and Yoneda K. Primary cardiac lymphoma. Cancer 64 : 521 -525,1989. 3. Constantino A, West TE, Gupta M, and Loghmanee F. Primary cardiac lymphoma in a patient with acquired immune deficiency syndrome. Cancer 60 : 2801-
2805,1987. 4. Guarner J, Brynes RK, Chan WC, Birdsong G, and Hertzler G. Primary non-Hodgkin's lymphoma of the heart in two patients with the acquired immunode ficiency syndrome. Arch Pathol Lab Med 1 1 1 : 254-
256,1987. 5. Kasai K, Kameya T, Ono M, ef a/. Relationships among expression, transcript ion and rearrangement of T-cell receptor p gene in T-cell lymphomas. Virchows Arch [A] 417: 57-65, 1990. 6. McCarthy KP, Sloane JP, and Wiedemann LM. Rapid method for distinguish clonal from polyclonal B-cell populations in surgical biopsy specimens. J Clin Pathol 43 : 429-432,1990. 7. Uhara H, Sat0 Y, Mukai K. et a/. Detection of EpsteinBarr virus DNA in Re&-Stemberg cells of Hodgkin's disease using the polymerase chain reaction and in situ hybridization. Jpn J Cancer Res 81 : 272-278,1990. 8. Whorten CM. Primary malignant tumors of the heart: Report of a case. Cancer 2: 245-260,1949. 9. Chou S,Arkles LB, Gill GD, et a/. Primary lymphoma of the heart: A case report. Cancer 52: 744-747,
1983. 10. Roh LS and Paparo GP. Primary malignant lymphoma of the heart in sudden unexpected death J
671
Forensic Sci 27 : 718-722,1982. 11. Pozniak AL, Thomas RD, Hobbs CB, and Lever JV. Primary malignant lymphoma of the heart: Antemortem cytologic diagnosis. Acta Cytol 30 : 662-664,
1986. 12. Bear PA and Moodie DS. Malignant primary cardiac tumors: The Cleveland clinic experience, 1956 to 1986. Chest 92 : 860-862,1987. 13. Casteli MJ, Mihalov ML, Posniak HV, and Gattuso P. Primary cardiac lymphoma initially diagnosed by routine cytology: Case report and literature review. Acta Cytol 33 : 355-358,1989. 1 4. Roberts CS, Gottdiener JS, and Roberts WC. Clinically undetected cardiac lymphoma causing fatal congestive heart failure. Am Heart J 120: 1239-1242,1990. 15. Scully RE, Mark EJ, and McNeely BV. Case records of the Massachusetts General Hospital : Case 4-1985. N Engl J Med 312 : 226-237,1985. 16. Rodenburg CJ, Klein P, Maes A, and Paul LC. Malignant lymphoma confined to the heart, 13 years after a cadaver kidney transplant. N Engl J Med 313: 122,
1985. 17. Leventhal LJ, DeMarco DM, and Zurier RB. Antinuclear antibody in pericardial fluid from a patient with primary cardiac lymphoma. Arch Intern Med 150:
1 1 13-11 1 5, 1990. 1 8. Aozasa K, lnoue A, Tajima K, et a/. Malignant lymphomas of the thyroid gland: Analysis of 79 patients with emphasis on histologic prognostic factors. Cancer 58: 100-104,1986. 19. luchi K, lchimiya A, Akashi A, et a/. Non-Hodgkin's lymphoma of the pleural cavity developing from longstanding pyothomx. Cancer 60: 1771-1775,1987. 20. Picker W, Weiss LM, Medeiros LJ, Wood GS, and Warnke RA. lmmunophenotypic criteria for the diagnosis of non-Hodgkin's lymphoma. Am J Pathol 128 :
181-201,1987. 21. Wan JH, Trainer KJ, Brisco MJ, and Morley AA. Monoclonality in B cell lymphoma detected in paraffin embedded sections using the polymerase chain reaction. J Clin Pathol 43: 888-890,1990.
Case Report of Primary Cardiac Lymphoma The Applications of PCR to the Diagnosis of Primary Cardiac lymphoma
Kiyoshi Kasai', Sadahito Kuwao', Yuichi Sato', Masakazu MurayamaZ, Yuji Harano2, and Toru Kameyal
A 75-year-old man initially complained of pollakiuria and low abdomlnal pain, and died of massive bleeding from an exacerbated gastric ulcer. The dlagnosis of primary cardiac lymphoma was made postmortem. The tumor involved only the epicardium and myocardium, which met the criteria of primary cardiac lymphoma as defined by the Armed Forces Institute of Pathology. The lymphoma consisted of large cells and expressed the B cell marker, CDZO. Although chronic inflammation due to chronic renal failure was observed in the pericardium around the lymphoma, polymerase chain reaction (PCR) was conducted to detect monoclonality at the DNA level in lymphoma cells, which were shown to comprise a monoclonal population. Acta Pathol Jpn 42 : 667-671, 1992.
Primary cardiac lymphoma, B cell lymphoma, Chronic pericarditis, PCR
Key words:
P rima ry cardiac lymphoma with extra nodaI lymphoma involving only the epicardium and myocardium is rare, although frequent secondary involvement of the heart by malignant lymphoma has been frequently described (1, 2). Most cases of primary cardiac lymphoma so far reported were diagnosed incidentally postmortem. Thus, possible underlying causes for the development of most primary cardiac lymphomas remain unclear. Some cases of primary cardiac lymphoma in patients with acquired immune deficiency syndrome (AIDS) have been reported (3,4). This paper presents a case of primary cardiac Received March 18, 1992. Accepted for publication May 6,1992. 'Department of Pathology and aDepartment of Urology, Kitasato University School of Medicine, Kanagawa. Mailing address: Kiyoshi Kasai, M.D., Department of Pathology, Kitasato University School of Medicine, Kitasato 1-151, Sagamihara, Kanagawa 228, Japan.
lymphoma with special reference to immunohistochemical findings and polymerase chain reaction (PCR) results, and the etiologic factors of primary cardiac lymphoma are discussed.
CASEREPORT A 75-year-old Japanese man had been treated for benign prostatic hypertrophy for 15 years and gastric ulcer for 14 years. The family history was non-contrib utory. He presented with pollakiuria, decreased urine volume and lower abdominal pain and was admitted to Kitasato University Hospital due to his chief complaints and examination results. A t the time of physical examination, neither superficial lymph nodes nor a mass could be detected. Erythrocyte sedimentation rate at the time of admission was 55 mm/h. The hematocrit was 41.9%, hemoglobin 14.2 g/dl, red blood cell count 4 . 3 ~ 106/mm3 and platelet count, 26.9x1O4/mm3. White blood cell count was 6,000/mms with 54% segmented neutrophils, 18% lymphocytes, 5% eosinophils and 8% monocytes, indicating slight lymphocytopenia. Subsets of peripheral blood lymphocytes were not analyzed. Peripheral blood smears showed no abnormal cells. The sodium level was 1 2 8 mEq/l, potassium 5.9 mEq/l, chloride 97 mEq/l, calcium 8.1 mg/l, phosphate 3.8 mg/dl. Blood urea nitrogen was 3 5 mg/dl, creatinine 2.5 mg/dl and uric acid 10.9 mg/dl, indicating mild renal failure. Total protein was 6.7 g/dl and albumin 2.9 g/dl. Serum immunoglobulins were not measured. Total bilirubin was 0.9 mg/dl, sGOT 4 9 IU/l, sGPT 11 lU/l, and alkaline phosphatase 132 IU/I. Cardiac enzymes showed ele vated CPK 221 IU/I (normal, 50-176) and LDH 2,300 IU/I (normal, 180-350). Urinalysis on admission showed a pH of 5.0, positive for protein but no sugar or a normal reaction for urobilinogen A serum antibody to human immune deficiency virus (HIV) was not examined.
668
Primary Cardiac Lymphoma (Kasai et a/.)
Slight cardiomegaly and calcification of the aorta were noted on chest roentogenogra ms. Electrocardiogram results showed sinus rhythm with non-specific ST-T changes. Excretory urography (IVP) indicated nonvisualization of the right kidney but no abnormalities in the left ureter and kidney. Computerized tomograms (CT) showed slight swelling of lymph nodes in the paraaortic area. Gastrofiberscopy indicated two ulcers of the gastric fundus. Gastrointestinal bleeding from the gastric ulcer subsequently occurred and progressed to disseminated intravascular coagulation (DIC). Despite efforts to stabilize the patients' conditions, he died on the 1 6 t h day of hospitalization. Autopsy was performed 12 hours postmortem. The body weighed 63 kg. Although the left thoracic cavity contained 100 ml of yellow fluid, no pericardial effusion was found in the pericardial cavity. The heart weighed 400 g. The epicardium of the antero-lateral wall of the right atrium and ventricle was thickened and a grayishwhite tumor measuring 7 x 4 ~ cm 2 in dimensions was found situated beneath the epicardium and along the antero-lateral wall of the right side of the heart (Fig. 1). The tumor infiltrated the free wall of the right atrium and ventricle but did not extend t o the endocardium, atrial and ventricular septae or left atrium and ventricle. A small tumor in the prostate measuring 1 cm in diameter was found with no metastasis. There were 3 gastric ulcers of 3 m m in diameter o r less on the upper part of the lesser curvature. The edges were clear cut but not raised or rolled. The surface of the ulceration was
Figure 1. Macroscopic findings of the heart weighing 400 g, sectioned t o show a homogeneous, grayish-white tumor in the antero-lateral wall of right atrium and ventricle. The arrow indicates the tumor.
covered with blood clots. The spleen was congested. The capsules of both kidneys were stripped with slight difficulty, leaving a finely granular, reddish-brown surface. Both kidney pelves were slightly dilated. Bronchopneumonia, chronic cystitis and arteriosclerosis were also evident.
MATERIALS AND METHODS Tissues of the cardiac lesion described above were fixed in 10% formalin, routinely processed and embedded in paraffin. Three pm-thick paraffin sections were stained with hematoxylin and eosin or were immunostained as described previously (5). Briefly, the sections were deparaffinized in xylene and soaked in absolute methanol containing 0.3% H,O, for 30 min to block endogenous peroxidase activity. After being washed in phosphate buffered saline (PBS) for 2 0 min, the sections were incubated with antibodies overnight at 4°C. Immunoperoxidase staining was then performed according to the Avidin-biotin-complex (ABC) method. The reagents used for the ABC method were purchased from Vector Laboratory, CA. Dilution and incubation time were as specified by the staining procedure of the VECTASTAIN ABC KIT. The following antibodies were used : anti-immunoglobulin (Ig) heavy chains (IgG, IgA, IgM), anti-lg light chains ( x , 1) and SL26 (CD20) were purchased f r o m Dakopatts, Copenhagen. U C H L l (CD45RO) was purchased from Nichirei, Tokyo. Oligomer primers of Ig heavy chain genes used in the PCR were synthesized on an Applied Biosystems Model 381A (Applied Biosystems Inc., Foster City) and their sequences were the following and as described previously (6). For a primer common t o most VH segments and another primer complimentary to all JH region, 5CTGTCGACACGGCCGTGTATTACTG3' and 5AACTGCAGAGGAGACGGTGACC3' were synthesized. They were purified using oligonucleotide purification cartridges (Applied Biosystems Inc.). DNA for PCR was extracted from formalin-fixed paraffin embedded tissues (six 10-pm-thick sections) according t o methods reported previously(7). PCR was conducted in a thermal reactor (Hybaid, Middlesex). The reaction mixture contained a total amount of 1 ,ug of sample DNA, 10 m M Tris-HCI (pH 8.8),50 m M KCI, 2.5 m M MgCI,, 0.1 mg/ ml gelatin, 2 0 0 p M dNTP, 0.5,uM of each 5'- and 3'primers and 2.5 units of Amplitaq polymerase (Takara, Kyoto) a t a final volume of l 0 O p I . The mixture was overlaid with mineral oil and then amplified. The amplification was carried out for 30 cycles, each consisting of annealing for 30 seconds at 55"C, extension for 1 minute at 72'C, and denaturation for 30 seconds at 94°C. PCR products were electrophoresed in a 3%
Acta Pathologica Japonica 42 (9) : 1992
669
Figure 2. Hematoxylin and eosin (HE) staining of the cardiac lymphoma ( a ) showing neoplastic infiltrations comprising of large lymphoid cells and HE staining of the epicardium (b) showing small lymphocytic infiltration and fibrinous exudates of the epicardial surface.
agarose gel and stained with ethidium bromide and photographed as described previously (5). Histopathological findings and results of PCR of the cardiac tumor Light microscopy showed the tumor t o consist of sheets of atypical large lymphoid cells having indistinct cytoplasm and oval or round vesicular nuclei with a few nucleoli. The tumor cells proliferated densely and infiltrated the epicardium and myocardium (Fig. 2a). The surface of the epicardium of the right atrium and ventricle was slightly thickened by fibrosis and was infiltrated by a small number of small lymphocytes and was partially covered by fibrinous exudates (Fig. 2b), indicating chronic pericardit is. lmmunohistochemical examination using paraffin-embedded tissue indicated the cytoplasm of many large lymphoid cells to positively stain with SL26 (CD20) (Fig. 3) but not with UCHLl (CD45RO). The large lymphoid cells were thus Of B-cell lineage. However, no k G , k A , IgM, x chains or , Ichains could be detected in these
Figure 3. lmmunoperoxidase staining by SL26 of a section of the cardiac lymphoma. sL26 reacted with most lymphoma cells.
6 70
Primary Cardiac Lyfmphoma (Kasai et d.)
1 2
194bp 118bp
Figure 4. PCR products of I g heavy chain genes in the patient with cardiac lymphoma. lane 1, lambda phage DNA following digestion with Hind Ill as a molecular weight marker; lane 2, PCR products amplified from paraffin embedded sections of the cardiac lymphoma.
cells. PCR was conducted to detect monoclonality a t the DNA level in lymphoid cell populations in paraffinembedded sections. The results of PCR are shown in Fig. 4. One sharp band within the predicted size ranging from 100 base pairs (bp) to 120 bp was amplified from sections, suggesting neoplastic disease. No lymphoma cells could be found in lymph nodes, including the mediastinal and the paraaortic lymph nodes, spleen, liver, or bone marrow. Histological examination of both kidneys showed arteriolar benign nephrosclerosis and chronic pyelonephritis. In the prostate, moderately differentiated adenocarcinoma was diagnosed corresponding to a nodular lesion measuring 1 c'm in diameter without metastasis.
DISCUSSION Primary cardiac lymphoma is an extremely rare disease and is defined as an extranodal lymphoma involving only the heart and pericardium since secondary lymphomatous involvement of the heart is far more common (1, 2). In the present case, the tumor invaded the epicardium and myocardium of the right atrium and ventricle and no metastasis outside the heart could be seen at autopsy, thus confirming the diagnosis of primary cardiac lymphoma. Although primary sarcomas are commonly noted on the right side of the heart, more than half of primary cardiac lymphomas so far reported were shown to involve the right atrium and ventricle (2).
The common histologic and immunohistochemical features of primary cardiac lymphoma previously reported in detail represent diffuse large cell lymphoma of B-cell origin (2). Although approximately 20 primary cardiac lymphomas have been described, their etiologic factors have yet to be clarified in detail (8-15). Recently, a few cases of primary cardiac lymphoma in immunocompromised patients including a renal transplant recipient 16). and those with AIDS have been reported (3,4, Slight lymphocytopenia was noted in the present case but the antibody to HIV and serum immunological tests were not examined. A case in which the high-titer antinuclear antibody was identified in the pericardial fluid of a patient with primary cardiac lymphoma has been presented (17) and extranodal malignant lymphomas arising in organ-specific autoimmune disease have also been noted (18). Lymphomas arising in such patients were exclusive of the B-cell type as also noted in the present case. Pyothorax-associated lymphomas have recently been reported (19). They developed in tissue affected by inflammation of a non-autoimmune nature over a long period. Thus, chronic inflammatory stimulation of a non-autoimmune nature may be an etiologic factor for the development of malignant lymphoma (19). In the present case, chronic non-specific inflammation associated with renal failure due to arteriolar benign nephrosclerosis was observed in the pericardium around the cardiac tumor, although the exact relationship between the chronic inflammatory stimulation and the development of lymphoma in the present case remains undetermined. In this study, the B cell antigen (CD20) was expressed in lymphoma cells but no Ig heavy or light chains could be detected. lmmunohistochemical analysis of Ig heavy and light chains is the most useful immunophenotypic means for confirming B-lineage tumors but their lineage-specific antigens, including Ig and B cell antigens, have been reported as undetectable in a subset of B-cell lymphoma (20), although the immunoreactivity of Ig may possibly have been lost in the formalin-fixed paraffin embedded sections in the present study. The finding of clonal rearrangement of Ig genes in these tumors may thus support the diagnosis of lymphoma. Recently, analysis of Ig genes in the paraffin embedded sections by PCR has been shown to be useful for distinguishing neoplastic from reactive disorders (21). Although chronic non-specific inflammation was noted around the lymphoma in the present case, amplified Ig DNA of a single size was found in paraffin-embedded sections by PCR, indicating a monoclonal cell population to be present in the cardiac tumor and, thus confirming the tumor to be of B-lineage.
Acta Pathologica Japoriica 42 (9): 1992 Acknowledgements : We are grateful to Mrs. Tomoko Tsuruta, Kuniko Kadoya and Benio Sato for their technical assista nce.
REFERENCES 1. McAllister HA and Fenoglio JJ. Malignant lymphoma. In McAllister HA and Fenoglio JH, eds. Tumors of the Cardiovascular System. (Atlas of Tumor Pathology, 2nd Series, Fascicle 15) Armed Forces Institute of Pathology, Washington, D.C., 1978: 99-100. 2. Curtsinger CR, Wilson MJ, and Yoneda K. Primary cardiac lymphoma. Cancer 64 : 521 -525,1989. 3. Constantino A, West TE, Gupta M, and Loghmanee F. Primary cardiac lymphoma in a patient with acquired immune deficiency syndrome. Cancer 60 : 2801-
2805,1987. 4. Guarner J, Brynes RK, Chan WC, Birdsong G, and Hertzler G. Primary non-Hodgkin's lymphoma of the heart in two patients with the acquired immunode ficiency syndrome. Arch Pathol Lab Med 1 1 1 : 254-
256,1987. 5. Kasai K, Kameya T, Ono M, ef a/. Relationships among expression, transcript ion and rearrangement of T-cell receptor p gene in T-cell lymphomas. Virchows Arch [A] 417: 57-65, 1990. 6. McCarthy KP, Sloane JP, and Wiedemann LM. Rapid method for distinguish clonal from polyclonal B-cell populations in surgical biopsy specimens. J Clin Pathol 43 : 429-432,1990. 7. Uhara H, Sat0 Y, Mukai K. et a/. Detection of EpsteinBarr virus DNA in Re&-Stemberg cells of Hodgkin's disease using the polymerase chain reaction and in situ hybridization. Jpn J Cancer Res 81 : 272-278,1990. 8. Whorten CM. Primary malignant tumors of the heart: Report of a case. Cancer 2: 245-260,1949. 9. Chou S,Arkles LB, Gill GD, et a/. Primary lymphoma of the heart: A case report. Cancer 52: 744-747,
1983. 10. Roh LS and Paparo GP. Primary malignant lymphoma of the heart in sudden unexpected death J
671
Forensic Sci 27 : 718-722,1982. 11. Pozniak AL, Thomas RD, Hobbs CB, and Lever JV. Primary malignant lymphoma of the heart: Antemortem cytologic diagnosis. Acta Cytol 30 : 662-664,
1986. 12. Bear PA and Moodie DS. Malignant primary cardiac tumors: The Cleveland clinic experience, 1956 to 1986. Chest 92 : 860-862,1987. 13. Casteli MJ, Mihalov ML, Posniak HV, and Gattuso P. Primary cardiac lymphoma initially diagnosed by routine cytology: Case report and literature review. Acta Cytol 33 : 355-358,1989. 1 4. Roberts CS, Gottdiener JS, and Roberts WC. Clinically undetected cardiac lymphoma causing fatal congestive heart failure. Am Heart J 120: 1239-1242,1990. 15. Scully RE, Mark EJ, and McNeely BV. Case records of the Massachusetts General Hospital : Case 4-1985. N Engl J Med 312 : 226-237,1985. 16. Rodenburg CJ, Klein P, Maes A, and Paul LC. Malignant lymphoma confined to the heart, 13 years after a cadaver kidney transplant. N Engl J Med 313: 122,
1985. 17. Leventhal LJ, DeMarco DM, and Zurier RB. Antinuclear antibody in pericardial fluid from a patient with primary cardiac lymphoma. Arch Intern Med 150:
1 1 13-11 1 5, 1990. 1 8. Aozasa K, lnoue A, Tajima K, et a/. Malignant lymphomas of the thyroid gland: Analysis of 79 patients with emphasis on histologic prognostic factors. Cancer 58: 100-104,1986. 19. luchi K, lchimiya A, Akashi A, et a/. Non-Hodgkin's lymphoma of the pleural cavity developing from longstanding pyothomx. Cancer 60: 1771-1775,1987. 20. Picker W, Weiss LM, Medeiros LJ, Wood GS, and Warnke RA. lmmunophenotypic criteria for the diagnosis of non-Hodgkin's lymphoma. Am J Pathol 128 :
181-201,1987. 21. Wan JH, Trainer KJ, Brisco MJ, and Morley AA. Monoclonality in B cell lymphoma detected in paraffin embedded sections using the polymerase chain reaction. J Clin Pathol 43: 888-890,1990.
