Eur. J. Immunol. 2015. 45: 2911–2917
Innate immunity
DOI: 10.1002/eji.201545523
SHORT COMMUNICATION
Caspase-4 mediates non-canonical activation of the NLRP3 inflammasome in human myeloid cells Jonathan L. Schmid-Burgk ∗1 , Moritz M. Gaidt ∗1 , Tobias Schmidt ∗1 , Thomas S. Ebert ∗1 , Eva Bartok1,2 and Veit Hornung1 1 2
Institute of Molecular Medicine, University Hospital, University of Bonn, Bonn, Germany Institute of Clinical Chemistry and Clinical Pharmacology, University Hospital, University of Bonn, Bonn, Germany
Inflammasome activation culminates in activation of caspase-1, which leads to the maturation and subsequent release of cytokines of the interleukin 1 (IL-1) family and results in a particular form of cell death known as pyroptosis. In addition, in the murine system, a so-called non-canonical inflammasome involving caspase-11 has been described that directly responds to cytosolic LPS. Here, we show that the human monocytic cell line THP1 activates the inflammasome in response to cytosolic LPS in a TLR4-independent fashion. This response is mediated by caspase-4 and accompanied by caspase-1 activation, pyroptosis, and IL-1β maturation. In addition to caspase-4, efficient IL-1β conversion upon intracellular LPS delivery relies on potassium efflux, NLRP3, ASC, and caspase-1, indicating that although caspase-4 activation alone is sufficient to induce pyroptosis, this process depends on the NLRP3 inflammasome activation to drive IL-1β maturation. Altogether, this study provides evidence for the presence of a non-canonical inflammasome in humans and its dependence on caspase-4.
Keywords: Caspase-4 r Myeloid cells
r
NLRP3
r
Non-canonical inflammasome
See accompanying article by Baker et al. and Sebastian R¨ uhl and Petr Broz See accompanying Commentary by Rivers-Auty and Brough
Additional supporting information may be found in the online version of this article at the publisher’s web-site
Introduction Inflammatory caspases constitute a functionally and phylogenetically related group of caspases that play an important role in the initiation and regulation of inflammation [1]. The group of murine inflammatory caspases consists of caspase-1, caspase-11, and caspase-12, all located in close proximity on chromosome 9A1. In the human system, a syntenic region is located on chromosome 11q22, yet this locus encodes for four caspases, with caspase-4 and caspase-5 likely being the result of the duplication of an ancestral caspase-11 gene [1]. Although most humans encode for a nonfunctional caspase-12 gene product, the functional relevance
Correspondence: Dr. Veit Hornung e-mail: [email protected] C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
of this protein in inflammation remains to be determined [2]. Caspase-1 is activated upon the assembly of large multiprotein complexes that are triggered upon the encounter of microbe- or damage-associated molecular patterns. These so-called inflammasome complexes consist of a sensing molecule, e.g. the Nod-like receptor (NLR) molecule NLRP3, and the common adapter protein ASC that recruits procaspase-1. Upon recruitment, caspase-1 is activated by proximity-induced autoproteolysis, resulting in a processive enzyme that cleaves and thereby activates cytokines of the IL-1 family [3]. At the same time, caspase-1 activation results in a particular form of cell death, known as pyroptosis. Among the thus far identified microbe- or damage-associated molecular
∗
These authors contributed equally to this work.
www.eji-journal.eu
2911
2912
Jonathan L. Schmid-Burgk et al.
patterns sensing inflammasome molecules, the NLRP3 inflammasome appears to play a central role as a universal response pathway to the perturbation of cellular integrity [4]. More recently, it was found in the murine system that cytosolic recognition of Gram-negative bacteria required the presence of functional caspase-11 in order to trigger NLRP3 inflammasome activation [5]. While caspase-11 activation was shown to induce cell death by itself, independently of NLRP3 inflammasome activation, processing of IL-1β still required the presence of a functional NLRP3 inflammasome pathway (NLRP3, ASC, and caspase-1) and potassium efflux from the cell [6]. To distinguish it from the previously known caspase-11-independent inflammasome pathway, this novel, caspase-11-dependent route of inflammasome engagement has been termed non-canonical inflammasome activation [5]. In subsequent studies, it was also shown that the cytosolic delivery of lipopolysaccharide (LPS), the major component of the outer membrane of Gram-negative bacteria, was both necessary and sufficient to trigger non-canonical inflammasome activation [7, 8]. Moreover, it was discovered that LPS could directly bind to and thereby activate caspase-11 [9]. Altogether, these findings established a novel, TLR4-independent LPS sensing mechanism in the cytosol. The relevance of this pathway is documented by the fact that caspase-11-deficient mice are largely resistant to endotoxemia in the context of a TLR4-independent priming signal [7, 8]. In addition to murine caspase-11, both human caspase-4 and -5 have been found to directly bind to LPS [9]. Whereas both caspases confer LPS sensitivity in a gain-of-function setting, endogenous caspase-4 has been identified in a human monocytic cell line to mediate intracellular LPS responses leading to cell death [9]. Of note, caspase-4 and -5 share less homology to each other or to murine caspase-11 than, for example, functional orthologs of apoptotic caspases, and these differences may indicate specialization regarding their function. In fact, the epistatic role of caspase4 or -5 in inflammasome activation remains unclear. Initially, it was reported that caspase-4 directly cleaves pro-IL-1β [10], yet is less efficient than caspase-1. Furthermore, it was shown that it directly binds caspase-1, thus enhancing its activation, presumably by direct cleavage [11]. Another group reported a proinflammatory function of caspase-4 when expressed in transgenic mice with regard to licensing TLR-mediated inflammasome activation [12]. Caspase-5, on the other hand, was reported to form an inflammasome complex with NLRP1 in THP1 cells [13]. Apart from these data, there is currently no mechanistic insight into how caspase-4 or -5 mediate NLRP3 activation.
Eur. J. Immunol. 2015. 45: 2911–2917
activation. In fact, when human THP1 cells were transfected with LPS using Lipofectamine, cell death was observable as measured by lactate dehydrogenase (LDH) release, yet with delayed kinetics compared to nigericin (Fig. 1A and Supporting Information Fig. 1). On the other hand, extracellular LPS (2 μg/mL) or Lipofectamine by themselves did not confer cytotoxicity. To exclude a role for TLR4 signaling in this response, we used the small molecule TLR4 inhibitor CLI-095 [14], which had no impact on LPS-induced cytotoxicity. Similarly, IL-1β release triggered by LPS transfection or nigericin treatment (Fig. 1B) was not abrogated in the presence of CLI-095, whereas LPS-mediated TNF production was completely blunted (Fig. 1C). Assessing IL-1β release by Western blot (Fig. 1D, upper panel) confirmed the presence of cleaved IL-1β in the supernatant of LPS-transfected as well as nigericinstimulated cells in the presence or absence of TLR4 blockade. Furthermore, immunoblotting revealed that both stimuli led to TLR4-independent activation of the inflammasome as determined by the cleavage of caspase-1 (Fig. 1D, lower panel).
Caspase-4 is critically involved in LPS-mediated cell death and NLRP3 activation To elucidate the pathway activated by intracellular LPS in human cells, we generated THP1 cell lines deficient for NLRP3, ASC, caspase-1, and caspase-4 using the CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR associated protein 9) technology (Supporting Information Fig. 2). As expected, cell death triggered by the canonical inflammasome activator nigericin was dependent on NLRP3, ASC, and caspase-1 (Fig. 2A). On the other hand, LDH release by transfected LPS was only dependent on caspase-4, but still present in NLRP3, ASC, and caspase-1-deficient THP1 cells. Similarly, HMGB1 release upon LPS transfection was also caspase-4 dependent, but NLRP3 independent (Supporting Information Fig. 3). Measuring IL-1β release in the supernatant showed that both nigericin and cytosolic LPS required the presence of the NLRP3 inflammasome pathway (Fig. 2B). Caspase-4, however, was only required to induce IL-1β release in response to transfected LPS but not upon nigericin treatment. Immunoblotting for IL-1β and caspase-1 from supernatants of stimulated cells corroborated these findings (Fig. 2C, upper panels). Probing for caspase-4 in cell lysates revealed a multibanded, but specific pattern that remained unchanged upon stimulation (Fig. 2C, lower panel). This is consistent with previous reports that have shown that caspase-11 processing is not observed in cell extracts upon cytosolic LPS delivery.
Results and discussion TLR4-independent sensing of intracellular LPS in human cells To study the role of non-canonical inflammasome activation in the human system, we used the monocytic cell line THP1, which is competent for both canonical and non-canonical inflammasome C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Caspase-4-mediated NLRP3 activation depends on potassium efflux It has been reported that all activating pathways of the canonical NLRP3 inflammasome converge on efflux of intracellular potassium, and this is necessary and sufficient to activate the inflammasome [15]. To investigate if caspase-4-dependent www.eji-journal.eu
Eur. J. Immunol. 2015. 45: 2911–2917
Innate immunity
Figure 1. Non-canonical inflammasome activation in response to intracellular LPS in human cells. (A and B) THP1 cells incubated with or without CLI-095 were stimulated with nigericin, LPS, transfected LPS, or transfection vehicle alone. (A) LDH release was measured by LDH release assay and (B) IL-1β secretion was measured by ELISA. LF, Lipofectamine. (C) TNF secretion was measured in CLI-095-treated and control THP1 cells by ELISA 24 h after stimulation with 2 μg/mL LPS. Data are shown as mean ± SEM of the means of three independent experiments, each averaging three samples per stimulation. (D) Supernatants and lysates of stimulated CLI-095-treated and control THP1 cells were immunoblotted against IL-1β and caspase-1 24 h after stimulation. Data shown are from a single experiment representative of two performed.
non-canonical activation of the NLRP3 inflammasome was also dependent on potassium efflux, we cultured cells in the presence of increased extracellular potassium chloride concentrations to block potassium efflux. As expected, canonical NLRP3 inflammasomemediated cell death (nigericin) was completely blocked upon the inhibition of potassium efflux, whereas AIM2-mediated cell death was not affected (Fig. 3A). At the same time, non-canonical NLRP3 inflammasome activation (cytosolic LPS) leading to cell death was also not affected by raising extracellular potassium concentrations. On the other hand, blocking potassium efflux inhibited both canonical and non-canonical NLRP3 inflammasome-mediated IL1β maturation (Fig. 3B). AIM2-mediated IL-1β release remained unaffected, when it is taken into account that increasing extracellular potassium concentrations also negatively impacted on proIL-1β production, as observed when studying cell lysates (Fig. 3B, hatched bars).
C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Concluding remarks Testing a panel of THP1 knockout cell lines in response to canonical and non-canonical inflammasome activation confirmed that the TLR4-independent, LPS-mediated, non-canonical NLRP3 inflammasome activation described for the murine system also exists in human myeloid cells [7, 8]. Furthermore, we could identify human caspase-4 as a functional ortholog of murine caspase11. Although both human caspase-4 and -5 have been proposed to bind LPS and mediate non-canonical inflammasome activation, caspase-4-deficient THP1 cells were completely protected from LPS-mediated activation. However, since we could not detect the expression of caspase-5 in THP1 cells by qPCR (Supporting Information Fig. 4), we cannot exclude an involvement of caspase-5 in intracellular LPS sensing in other cell types or under certain stimulatory conditions such as priming with certain cytokines [16].
www.eji-journal.eu
2913
2914
Jonathan L. Schmid-Burgk et al.
Eur. J. Immunol. 2015. 45: 2911–2917
Figure 2. Involvement of inflammatory caspases and canonical inflammasome components in human non-canonical inflammasome activation (A and B) wild-type (WT), ASC-deficient, NLRP3-deficient, CASP1-deficient, and CASP4-deficient THP1 cells were treated with CLI-095 and were stimulated as indicated for 24 h. Two independently generated knockout clones per target gene are shown. (A) LDH release was measured by LDH release assay and (B) IL-1β secretion was measured by ELISA and shown as mean ± SEM of the means of three independent experiments, each averaging three samples per stimulation. LF, Lipofectamine. (C) Supernatants and lysates of stimulated WT and indicated knockout THP1 cells were immunoblotted against IL-1β, caspase-1, and caspase-4 24 h after the stimulation as indicated. Data shown are from a single experiment representative of two experiments performed.
Nevertheless, in this context, it is interesting to note that the human system differs from the murine system in that it encodes for a constitutively expressed cytosolic LPS sensor with caspase-4, whereas its murine counterpart caspase-11 is critically dependent on a proinflammatory priming signal in its expression [17]. Our data unequivocally show that caspase-4 cannot mediate IL-1β maturation directly or in concert with caspase-1. Instead, it requires potassium efflux-mediated NLRP3 activation for caspase-
C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
1 maturation and subsequent IL-1β release (Fig. 3C). This is consistent with the observation that caspase-11 requires potassium efflux and the NLRP3 inflammasome to provide mature caspase-1 and IL-1β in the course of Legionella infection [6]. It will be interesting to further investigate whether potassium efflux leading to NLRP3 inflammasome activation is a nonspecific consequence of cell death induced by caspase-4 activation or if a specific mechanism exists by which caspase-4 induces potassium efflux, e.g. by
www.eji-journal.eu
Eur. J. Immunol. 2015. 45: 2911–2917
Innate immunity
Figure 3. Potassium efflux-dependent NLRP3 activation by caspase-4. (A and B) THP1 cells were treated with CLI-095 and stimulated as indicated for 24 h, in the presence of the indicated concentrations of potassium chloride. (A) LDH release was measured by LDH release assay, and (B) IL-1β secretion was measured by ELISA. LF, Lipofectamine. Data are shown as mean ± SEM of the means of three independent experiments, each averaging three samples per stimulation. (C) Proposed model of the signaling cascade activated by intracellular LPS or nigericin leading to cell death and IL-1β secretion.
the opening of an ion channel, as has been recently shown for the cation channel TRPC1, which is cleaved by murine caspase-11 [18].
(ASC), ATTGACTCCGTTATTCCGAAAGG (CASP1), and GCTCATCCGAATATGGAGGCTGG (CASP4).
CRISPR/Cas9 mediated gene targeting
Materials and methods Cell culture THP1 cells were cultured in RPMI supplemented with 10% v/v FCS, sodium pyruvate (Life Technologies), and ciprofloxacin (Bayer Schering Pharma).
THP1 cells were plated at a density of 2 × 105 per milliliter. After 24 h, 2.5 × 106 cells were resuspended in 250 μL Opti-MEM, mixed with 5 μg plasmid DNA in a 4 mm cuvette, and were electroporated using an exponential pulse at 250 V and 950 μF utilizing a Gene Pulser electroporating device (Bio-Rad Laboratories). Cells were allowed to recover for 2 days in six-well plates filled with 4 mL medium per well. FACS sorting of 20 000 mCherry-positive cells was performed on a BD FACSAria III (BD Biosciences) sorting device.
CRISPR constructs Limiting dilution cloning We used a plasmid encoding a CMV–mCherry–Cas9 expression cassette and a gRNA under the U6 promoter. The CRISPR target sites used were (PAM regions in bold): GCTAATGATCGACTTCAATGGGG (NLRP3), GCTGGAGAACCTGACCGCCGAGG C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Cells were plated at a density of 4, 8, or 16 cells per well of nine round-bottom 96-well plates and grown for 2 weeks. Then, plates were scanned for absorption at 600 nm. Growing clones www.eji-journal.eu
2915
2916
Jonathan L. Schmid-Burgk et al.
were identified using a custom software, and were picked and duplicated by a Biomek FXp (Beckman Coulter) liquid handling system.
Eur. J. Immunol. 2015. 45: 2911–2917
LDH assay Twenty-four hours after stimulation, LDH assay was performed according to the manufacturer’s instructions (Thermo Scientific). Data were normalized to unstimulated and fully lysed control cells. Negative values are not shown.
Genotyping Lysis, PCR, MiSeq sequencing, and evaluation using the OutKnocker software were performed as previously described [19].
Quantitative real-time RT-PCR For the copy number analysis of caspase-4 and -5 in THP1 cells, 1 × 106 THP1 cells were left untreated, stimulated with LPS or LPS and CLI-095 as described. RNA of cells was isolated using an RNeasy Kit (Qiagen), and cDNA Synthesis was performed using RevertAid reverse transcriptase (Fermentas) according to manufacturer’s instructions. For the qPCR reaction with FastSybr Green (Life Technologies), caspase-4 and -5-specific primers were used (CASP4 FWD: AGATGCCCTCAAGCTTTGTC, REV: TGCGGTTGTTTCTCTCCTTT, CASP5 FWD: AGCATCCTTGGCACTCATCT, REV: CCAGGACACGTTATGTGGTG). In addition, plasmids encoding for human caspase-4 and -5 were titrated over 10 logarithmic orders of magnitude and analyzed by qPCR. By correlating the Ct values with the loragithmic copy numbers of the plasmids, standard curves specific for caspase-4 and -5 were determined. The standard curves were used to calculate the copy numbers in the cDNA samples of untreated and treated THP1 cells. Finally, the copy number values were normalized to the concentration of the RNA samples used for cDNA synthesis.
Cell stimulation THP1 cells were bulk differentiated by overnight incubation in 100 ng/mL PMA in 10 cm dishes. Cells were washed twice with PBS, detached using repeated pipetting or trypsinization, and 50 000 cells were seeded per flat-bottom 96-well in medium optionally containing 1 μg/mL CLI-095 (Invivogen). After 24 h, the medium was replaced, and cells were stimulated by adding nigericin to a final concentration of 6.5 μM or by transfection of 300 ng ultrapure LPS (Invivogen) or 200 ng of poly(dA:dT) synthetic DNA using 0.5 μL Lipofectamine 2000 (Life Technologies) per well of a 96-well plate.
SDS PAGE/immunoblotting Twenty-four hours after stimulation in medium containing 2% FCS, supernatants were precipitated as previously described [20], size-separated on 15% SDS PAGE gels, and blotted to 0.2 μm nitrocellulose membranes. Blots were incubated with anti-IL-1 antibody (R&D, AF-201-NA), anti-CASP1-p20 antibody (Adipogen, AG-20B-0048-C100), anti-NLRP3 antibody (Adipogen, AG-20B0014-C100), anti-ASC antibody (Santa Cruz Biotechnology, sc22514-R), and anti-CASP4 antibody (Santa Cruz Biotechnology, sc-56056) for 72 h as primary and respective IgG–HRP conjugates as secondary antibodies (Santa Cruz Biotechnology). Beta actin was blotted with anti-β-actin–HRP (Santa Cruz Biotechnology, sc47778).
Acknowledgments: We kindly thank the group of Dr. E. Endl for their great support with FACSorting. This work was supported by grants from the German Research Foundation (SFB704 and SFB670) and the European Research Council (ERC-2009StG 243046) to V.H. V.H. is a member of the excellence cluster ImmunoSensation. J.L.S.-B. is supported by the German National Academic Foundation. E.B. is supported by the BONFOR program of the University Hospital Bonn.
Conflict of interest: The authors declare no financial or commercial conflict of interest.
References 1 Martinon, F. and Tschopp, J., Inflammatory caspases and inflammasomes: master switches of inflammation. Cell Death Differ. 2007. 14: 10–22. 2 Jimenez Fernandez, D. and Lamkanfi, M., Inflammatory caspases: key regulators of inflammation and cell death. Biol. Chem. 2015. 396: 193–203. 3 Gross, O., Thomas, C. J., Guarda, G. and Tschopp, J., The inflammasome: an integrated view. Immunol. Rev. 2011. 243: 136–151.
ELISA
4 Latz, E., Xiao, T. S. and Stutz, A., Activation and regulation of the inflammasomes. Nat. Rev. Immunol. 2013. 13: 397–411.
Twenty-four hours after stimulation, IL-1β and TNF ELISA were performed according to the manufacturer’s instructions (OptEIA, BD Biosciences). C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
5 Kayagaki, N., Warming, S., Lamkanfi, M., Vande Walle, L., Louie, S., Dong, J., Newton, K. et al., Non-canonical inflammasome activation targets caspase-11. Nature 2011. 479: 117–121.
www.eji-journal.eu
Eur. J. Immunol. 2015. 45: 2911–2917
Innate immunity
6 Case, C. L., Kohler, L. J., Lima, J. B., Strowig, T., de Zoete, M. R.,
16 Lin, X. Y., Choi, M. S. and Porter, A. G., Expression analysis of the human
Flavell, R. A., Zamboni, D. S. et al., Caspase-11 stimulates rapid flagellin-
caspase-1 subfamily reveals specific regulation of the CASP5 gene by
independent pyroptosis in response to Legionella pneumophila. Proc. Natl.
lipopolysaccharide and interferon-gamma. J. Biol. Chem. 2000. 275: 39920–
Acad. Sci. USA 2013. 110: 1851–1856.
39926.
7 Kayagaki, N., Wong, M. T., Stowe, I. B., Ramani, S. R., Gonzalez, L. C.,
17 Wang, S., Miura, M., Jung, Y. K., Zhu, H., Li, E. and Yuan, J., Murine
Akashi-Takamura, S., Miyake, K. et al., Noncanonical inflammasome
caspase-11, an ICE-interacting protease, is essential for the activation of
activation by intracellular LPS independent of TLR4. Science 2013. 341:
ICE. Cell 1998. 92: 501–509.
1246–1249. 8 Hagar, J. A., Powell, D. A., Aachoui, Y., Ernst, R. K. and Miao, E. A., Cytoplasmic LPS activates caspase-11: implications in TLR4-independent endotoxic shock. Science 2013. 341: 1250–1253.
18 Py, B. F., Jin, M., Desai, B. N., Penumaka, A., Zhu, H., Kober, M., Dietrich, A. et al., Caspase-11 controls interleukin-1beta release through degradation of TRPC1. Cell Rep. 2014. 6: 1122–1128. 19 Schmid-Burgk, J. L., Schmidt, T., Gaidt, M. M., Pelka, K., Latz, E., Ebert,
9 Shi, J., Zhao, Y., Wang, Y., Gao, W., Ding, J., Li, P., Hu, L. et al., Inflamma-
T. S. and Hornung, V., OutKnocker: a web tool for rapid and simple
tory caspases are innate immune receptors for intracellular LPS. Nature
genotyping of designer nuclease edited cell lines. Genome Res. 2014. 24:
2014. 514: 187–192.
1719–1723.
10 Kamens, J., Paskind, M., Hugunin, M., Talanian, R. V., Allen, H., Banach,
20 Jakobs, C., Bartok, E., Kubarenko, A., Bauernfeind, F. and Hornung, V.,
D., Bump, N. et al., Identification and characterization of ICH-2, a novel
Immunoblotting for active caspase-1. Methods Mol. Biol. 2013. 1040: 103–
member of the interleukin-1 beta-converting enzyme family of cysteine
115.
proteases. J. Biol. Chem. 1995. 270: 15250–15256. 11 Sollberger, G., Strittmatter, G. E., Kistowska, M., French, L. E. and Beer, H. D., Caspase-4 is required for activation of inflammasomes. J. Immunol. 2012. 188: 1992–2000. 12 Kajiwara, Y., Schiff, T., Voloudakis, G., Gama Sosa, M. A., Elder, G., Bozdagi, O. and Buxbaum, J. D., A critical role for human caspase-4 in endotoxin sensitivity. J. Immunol. 2014. 193: 335–343. 13 Martinon, F., Burns, K. and Tschopp, J., The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-beta. Mol. Cell 2002. 10: 417–426. 14 Ii, M., Matsunaga, N., Hazeki, K., Nakamura, K., Takashima, K., Seya, T., Hazeki, O. et al., A novel cyclohexene derivative, ethyl (6R)-6-
Abbreviations: Cas9: CRISPR associated protein 9 · CRISPR: clustered regularly interspaced short palindromic repeats · Ct: cycle threshold · LDH: lactate dehydrogenase · NLR: Nod-like receptor Full correspondence: Dr. Veit Hornung, Institute of Molecular Medicine, University Hospital, University of Bonn, Sigmund-Freud-Straße 25, 53127 Bonn, Germany Fax: +49-228-28751201 e-mail: [email protected] See accompanying articles: http://dx.doi.org/10.1002/eji.201545655, http://dx.doi.org/10.1002/eji.201545772
[N-(2-Chloro-4-fluorophenyl)sulfamoyl]cyclohex-1-ene-1-carboxylate (TAK-242), selectively inhibits toll-like receptor 4-mediated cytokine production through suppression of intracellular signaling. Mol. Pharmacol. 2006. 69: 1288–1295. 15 Munoz-Planillo, R., Kuffa, P., Martinez-Colon, G., Smith, B. L., Rajendiran, T. M. and Nunez, G., K(+) efflux is the common trigger of NLRP3 inflammasome activation by bacterial toxins and particulate matter. Immunity 2013. 38: 1142–1153.
C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
See accompanying Commentary: http://dx.doi.org/10.1002/eji.201545958 Received: 28/1/2015 Revised: 6/6/2015 Accepted: 10/7/2015 Accepted article online: 6/8/2015
www.eji-journal.eu
2917
Innate immunity
DOI: 10.1002/eji.201545523
SHORT COMMUNICATION
Caspase-4 mediates non-canonical activation of the NLRP3 inflammasome in human myeloid cells Jonathan L. Schmid-Burgk ∗1 , Moritz M. Gaidt ∗1 , Tobias Schmidt ∗1 , Thomas S. Ebert ∗1 , Eva Bartok1,2 and Veit Hornung1 1 2
Institute of Molecular Medicine, University Hospital, University of Bonn, Bonn, Germany Institute of Clinical Chemistry and Clinical Pharmacology, University Hospital, University of Bonn, Bonn, Germany
Inflammasome activation culminates in activation of caspase-1, which leads to the maturation and subsequent release of cytokines of the interleukin 1 (IL-1) family and results in a particular form of cell death known as pyroptosis. In addition, in the murine system, a so-called non-canonical inflammasome involving caspase-11 has been described that directly responds to cytosolic LPS. Here, we show that the human monocytic cell line THP1 activates the inflammasome in response to cytosolic LPS in a TLR4-independent fashion. This response is mediated by caspase-4 and accompanied by caspase-1 activation, pyroptosis, and IL-1β maturation. In addition to caspase-4, efficient IL-1β conversion upon intracellular LPS delivery relies on potassium efflux, NLRP3, ASC, and caspase-1, indicating that although caspase-4 activation alone is sufficient to induce pyroptosis, this process depends on the NLRP3 inflammasome activation to drive IL-1β maturation. Altogether, this study provides evidence for the presence of a non-canonical inflammasome in humans and its dependence on caspase-4.
Keywords: Caspase-4 r Myeloid cells
r
NLRP3
r
Non-canonical inflammasome
See accompanying article by Baker et al. and Sebastian R¨ uhl and Petr Broz See accompanying Commentary by Rivers-Auty and Brough
Additional supporting information may be found in the online version of this article at the publisher’s web-site
Introduction Inflammatory caspases constitute a functionally and phylogenetically related group of caspases that play an important role in the initiation and regulation of inflammation [1]. The group of murine inflammatory caspases consists of caspase-1, caspase-11, and caspase-12, all located in close proximity on chromosome 9A1. In the human system, a syntenic region is located on chromosome 11q22, yet this locus encodes for four caspases, with caspase-4 and caspase-5 likely being the result of the duplication of an ancestral caspase-11 gene [1]. Although most humans encode for a nonfunctional caspase-12 gene product, the functional relevance
Correspondence: Dr. Veit Hornung e-mail: [email protected] C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
of this protein in inflammation remains to be determined [2]. Caspase-1 is activated upon the assembly of large multiprotein complexes that are triggered upon the encounter of microbe- or damage-associated molecular patterns. These so-called inflammasome complexes consist of a sensing molecule, e.g. the Nod-like receptor (NLR) molecule NLRP3, and the common adapter protein ASC that recruits procaspase-1. Upon recruitment, caspase-1 is activated by proximity-induced autoproteolysis, resulting in a processive enzyme that cleaves and thereby activates cytokines of the IL-1 family [3]. At the same time, caspase-1 activation results in a particular form of cell death, known as pyroptosis. Among the thus far identified microbe- or damage-associated molecular
∗
These authors contributed equally to this work.
www.eji-journal.eu
2911
2912
Jonathan L. Schmid-Burgk et al.
patterns sensing inflammasome molecules, the NLRP3 inflammasome appears to play a central role as a universal response pathway to the perturbation of cellular integrity [4]. More recently, it was found in the murine system that cytosolic recognition of Gram-negative bacteria required the presence of functional caspase-11 in order to trigger NLRP3 inflammasome activation [5]. While caspase-11 activation was shown to induce cell death by itself, independently of NLRP3 inflammasome activation, processing of IL-1β still required the presence of a functional NLRP3 inflammasome pathway (NLRP3, ASC, and caspase-1) and potassium efflux from the cell [6]. To distinguish it from the previously known caspase-11-independent inflammasome pathway, this novel, caspase-11-dependent route of inflammasome engagement has been termed non-canonical inflammasome activation [5]. In subsequent studies, it was also shown that the cytosolic delivery of lipopolysaccharide (LPS), the major component of the outer membrane of Gram-negative bacteria, was both necessary and sufficient to trigger non-canonical inflammasome activation [7, 8]. Moreover, it was discovered that LPS could directly bind to and thereby activate caspase-11 [9]. Altogether, these findings established a novel, TLR4-independent LPS sensing mechanism in the cytosol. The relevance of this pathway is documented by the fact that caspase-11-deficient mice are largely resistant to endotoxemia in the context of a TLR4-independent priming signal [7, 8]. In addition to murine caspase-11, both human caspase-4 and -5 have been found to directly bind to LPS [9]. Whereas both caspases confer LPS sensitivity in a gain-of-function setting, endogenous caspase-4 has been identified in a human monocytic cell line to mediate intracellular LPS responses leading to cell death [9]. Of note, caspase-4 and -5 share less homology to each other or to murine caspase-11 than, for example, functional orthologs of apoptotic caspases, and these differences may indicate specialization regarding their function. In fact, the epistatic role of caspase4 or -5 in inflammasome activation remains unclear. Initially, it was reported that caspase-4 directly cleaves pro-IL-1β [10], yet is less efficient than caspase-1. Furthermore, it was shown that it directly binds caspase-1, thus enhancing its activation, presumably by direct cleavage [11]. Another group reported a proinflammatory function of caspase-4 when expressed in transgenic mice with regard to licensing TLR-mediated inflammasome activation [12]. Caspase-5, on the other hand, was reported to form an inflammasome complex with NLRP1 in THP1 cells [13]. Apart from these data, there is currently no mechanistic insight into how caspase-4 or -5 mediate NLRP3 activation.
Eur. J. Immunol. 2015. 45: 2911–2917
activation. In fact, when human THP1 cells were transfected with LPS using Lipofectamine, cell death was observable as measured by lactate dehydrogenase (LDH) release, yet with delayed kinetics compared to nigericin (Fig. 1A and Supporting Information Fig. 1). On the other hand, extracellular LPS (2 μg/mL) or Lipofectamine by themselves did not confer cytotoxicity. To exclude a role for TLR4 signaling in this response, we used the small molecule TLR4 inhibitor CLI-095 [14], which had no impact on LPS-induced cytotoxicity. Similarly, IL-1β release triggered by LPS transfection or nigericin treatment (Fig. 1B) was not abrogated in the presence of CLI-095, whereas LPS-mediated TNF production was completely blunted (Fig. 1C). Assessing IL-1β release by Western blot (Fig. 1D, upper panel) confirmed the presence of cleaved IL-1β in the supernatant of LPS-transfected as well as nigericinstimulated cells in the presence or absence of TLR4 blockade. Furthermore, immunoblotting revealed that both stimuli led to TLR4-independent activation of the inflammasome as determined by the cleavage of caspase-1 (Fig. 1D, lower panel).
Caspase-4 is critically involved in LPS-mediated cell death and NLRP3 activation To elucidate the pathway activated by intracellular LPS in human cells, we generated THP1 cell lines deficient for NLRP3, ASC, caspase-1, and caspase-4 using the CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR associated protein 9) technology (Supporting Information Fig. 2). As expected, cell death triggered by the canonical inflammasome activator nigericin was dependent on NLRP3, ASC, and caspase-1 (Fig. 2A). On the other hand, LDH release by transfected LPS was only dependent on caspase-4, but still present in NLRP3, ASC, and caspase-1-deficient THP1 cells. Similarly, HMGB1 release upon LPS transfection was also caspase-4 dependent, but NLRP3 independent (Supporting Information Fig. 3). Measuring IL-1β release in the supernatant showed that both nigericin and cytosolic LPS required the presence of the NLRP3 inflammasome pathway (Fig. 2B). Caspase-4, however, was only required to induce IL-1β release in response to transfected LPS but not upon nigericin treatment. Immunoblotting for IL-1β and caspase-1 from supernatants of stimulated cells corroborated these findings (Fig. 2C, upper panels). Probing for caspase-4 in cell lysates revealed a multibanded, but specific pattern that remained unchanged upon stimulation (Fig. 2C, lower panel). This is consistent with previous reports that have shown that caspase-11 processing is not observed in cell extracts upon cytosolic LPS delivery.
Results and discussion TLR4-independent sensing of intracellular LPS in human cells To study the role of non-canonical inflammasome activation in the human system, we used the monocytic cell line THP1, which is competent for both canonical and non-canonical inflammasome C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Caspase-4-mediated NLRP3 activation depends on potassium efflux It has been reported that all activating pathways of the canonical NLRP3 inflammasome converge on efflux of intracellular potassium, and this is necessary and sufficient to activate the inflammasome [15]. To investigate if caspase-4-dependent www.eji-journal.eu
Eur. J. Immunol. 2015. 45: 2911–2917
Innate immunity
Figure 1. Non-canonical inflammasome activation in response to intracellular LPS in human cells. (A and B) THP1 cells incubated with or without CLI-095 were stimulated with nigericin, LPS, transfected LPS, or transfection vehicle alone. (A) LDH release was measured by LDH release assay and (B) IL-1β secretion was measured by ELISA. LF, Lipofectamine. (C) TNF secretion was measured in CLI-095-treated and control THP1 cells by ELISA 24 h after stimulation with 2 μg/mL LPS. Data are shown as mean ± SEM of the means of three independent experiments, each averaging three samples per stimulation. (D) Supernatants and lysates of stimulated CLI-095-treated and control THP1 cells were immunoblotted against IL-1β and caspase-1 24 h after stimulation. Data shown are from a single experiment representative of two performed.
non-canonical activation of the NLRP3 inflammasome was also dependent on potassium efflux, we cultured cells in the presence of increased extracellular potassium chloride concentrations to block potassium efflux. As expected, canonical NLRP3 inflammasomemediated cell death (nigericin) was completely blocked upon the inhibition of potassium efflux, whereas AIM2-mediated cell death was not affected (Fig. 3A). At the same time, non-canonical NLRP3 inflammasome activation (cytosolic LPS) leading to cell death was also not affected by raising extracellular potassium concentrations. On the other hand, blocking potassium efflux inhibited both canonical and non-canonical NLRP3 inflammasome-mediated IL1β maturation (Fig. 3B). AIM2-mediated IL-1β release remained unaffected, when it is taken into account that increasing extracellular potassium concentrations also negatively impacted on proIL-1β production, as observed when studying cell lysates (Fig. 3B, hatched bars).
C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Concluding remarks Testing a panel of THP1 knockout cell lines in response to canonical and non-canonical inflammasome activation confirmed that the TLR4-independent, LPS-mediated, non-canonical NLRP3 inflammasome activation described for the murine system also exists in human myeloid cells [7, 8]. Furthermore, we could identify human caspase-4 as a functional ortholog of murine caspase11. Although both human caspase-4 and -5 have been proposed to bind LPS and mediate non-canonical inflammasome activation, caspase-4-deficient THP1 cells were completely protected from LPS-mediated activation. However, since we could not detect the expression of caspase-5 in THP1 cells by qPCR (Supporting Information Fig. 4), we cannot exclude an involvement of caspase-5 in intracellular LPS sensing in other cell types or under certain stimulatory conditions such as priming with certain cytokines [16].
www.eji-journal.eu
2913
2914
Jonathan L. Schmid-Burgk et al.
Eur. J. Immunol. 2015. 45: 2911–2917
Figure 2. Involvement of inflammatory caspases and canonical inflammasome components in human non-canonical inflammasome activation (A and B) wild-type (WT), ASC-deficient, NLRP3-deficient, CASP1-deficient, and CASP4-deficient THP1 cells were treated with CLI-095 and were stimulated as indicated for 24 h. Two independently generated knockout clones per target gene are shown. (A) LDH release was measured by LDH release assay and (B) IL-1β secretion was measured by ELISA and shown as mean ± SEM of the means of three independent experiments, each averaging three samples per stimulation. LF, Lipofectamine. (C) Supernatants and lysates of stimulated WT and indicated knockout THP1 cells were immunoblotted against IL-1β, caspase-1, and caspase-4 24 h after the stimulation as indicated. Data shown are from a single experiment representative of two experiments performed.
Nevertheless, in this context, it is interesting to note that the human system differs from the murine system in that it encodes for a constitutively expressed cytosolic LPS sensor with caspase-4, whereas its murine counterpart caspase-11 is critically dependent on a proinflammatory priming signal in its expression [17]. Our data unequivocally show that caspase-4 cannot mediate IL-1β maturation directly or in concert with caspase-1. Instead, it requires potassium efflux-mediated NLRP3 activation for caspase-
C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
1 maturation and subsequent IL-1β release (Fig. 3C). This is consistent with the observation that caspase-11 requires potassium efflux and the NLRP3 inflammasome to provide mature caspase-1 and IL-1β in the course of Legionella infection [6]. It will be interesting to further investigate whether potassium efflux leading to NLRP3 inflammasome activation is a nonspecific consequence of cell death induced by caspase-4 activation or if a specific mechanism exists by which caspase-4 induces potassium efflux, e.g. by
www.eji-journal.eu
Eur. J. Immunol. 2015. 45: 2911–2917
Innate immunity
Figure 3. Potassium efflux-dependent NLRP3 activation by caspase-4. (A and B) THP1 cells were treated with CLI-095 and stimulated as indicated for 24 h, in the presence of the indicated concentrations of potassium chloride. (A) LDH release was measured by LDH release assay, and (B) IL-1β secretion was measured by ELISA. LF, Lipofectamine. Data are shown as mean ± SEM of the means of three independent experiments, each averaging three samples per stimulation. (C) Proposed model of the signaling cascade activated by intracellular LPS or nigericin leading to cell death and IL-1β secretion.
the opening of an ion channel, as has been recently shown for the cation channel TRPC1, which is cleaved by murine caspase-11 [18].
(ASC), ATTGACTCCGTTATTCCGAAAGG (CASP1), and GCTCATCCGAATATGGAGGCTGG (CASP4).
CRISPR/Cas9 mediated gene targeting
Materials and methods Cell culture THP1 cells were cultured in RPMI supplemented with 10% v/v FCS, sodium pyruvate (Life Technologies), and ciprofloxacin (Bayer Schering Pharma).
THP1 cells were plated at a density of 2 × 105 per milliliter. After 24 h, 2.5 × 106 cells were resuspended in 250 μL Opti-MEM, mixed with 5 μg plasmid DNA in a 4 mm cuvette, and were electroporated using an exponential pulse at 250 V and 950 μF utilizing a Gene Pulser electroporating device (Bio-Rad Laboratories). Cells were allowed to recover for 2 days in six-well plates filled with 4 mL medium per well. FACS sorting of 20 000 mCherry-positive cells was performed on a BD FACSAria III (BD Biosciences) sorting device.
CRISPR constructs Limiting dilution cloning We used a plasmid encoding a CMV–mCherry–Cas9 expression cassette and a gRNA under the U6 promoter. The CRISPR target sites used were (PAM regions in bold): GCTAATGATCGACTTCAATGGGG (NLRP3), GCTGGAGAACCTGACCGCCGAGG C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Cells were plated at a density of 4, 8, or 16 cells per well of nine round-bottom 96-well plates and grown for 2 weeks. Then, plates were scanned for absorption at 600 nm. Growing clones www.eji-journal.eu
2915
2916
Jonathan L. Schmid-Burgk et al.
were identified using a custom software, and were picked and duplicated by a Biomek FXp (Beckman Coulter) liquid handling system.
Eur. J. Immunol. 2015. 45: 2911–2917
LDH assay Twenty-four hours after stimulation, LDH assay was performed according to the manufacturer’s instructions (Thermo Scientific). Data were normalized to unstimulated and fully lysed control cells. Negative values are not shown.
Genotyping Lysis, PCR, MiSeq sequencing, and evaluation using the OutKnocker software were performed as previously described [19].
Quantitative real-time RT-PCR For the copy number analysis of caspase-4 and -5 in THP1 cells, 1 × 106 THP1 cells were left untreated, stimulated with LPS or LPS and CLI-095 as described. RNA of cells was isolated using an RNeasy Kit (Qiagen), and cDNA Synthesis was performed using RevertAid reverse transcriptase (Fermentas) according to manufacturer’s instructions. For the qPCR reaction with FastSybr Green (Life Technologies), caspase-4 and -5-specific primers were used (CASP4 FWD: AGATGCCCTCAAGCTTTGTC, REV: TGCGGTTGTTTCTCTCCTTT, CASP5 FWD: AGCATCCTTGGCACTCATCT, REV: CCAGGACACGTTATGTGGTG). In addition, plasmids encoding for human caspase-4 and -5 were titrated over 10 logarithmic orders of magnitude and analyzed by qPCR. By correlating the Ct values with the loragithmic copy numbers of the plasmids, standard curves specific for caspase-4 and -5 were determined. The standard curves were used to calculate the copy numbers in the cDNA samples of untreated and treated THP1 cells. Finally, the copy number values were normalized to the concentration of the RNA samples used for cDNA synthesis.
Cell stimulation THP1 cells were bulk differentiated by overnight incubation in 100 ng/mL PMA in 10 cm dishes. Cells were washed twice with PBS, detached using repeated pipetting or trypsinization, and 50 000 cells were seeded per flat-bottom 96-well in medium optionally containing 1 μg/mL CLI-095 (Invivogen). After 24 h, the medium was replaced, and cells were stimulated by adding nigericin to a final concentration of 6.5 μM or by transfection of 300 ng ultrapure LPS (Invivogen) or 200 ng of poly(dA:dT) synthetic DNA using 0.5 μL Lipofectamine 2000 (Life Technologies) per well of a 96-well plate.
SDS PAGE/immunoblotting Twenty-four hours after stimulation in medium containing 2% FCS, supernatants were precipitated as previously described [20], size-separated on 15% SDS PAGE gels, and blotted to 0.2 μm nitrocellulose membranes. Blots were incubated with anti-IL-1 antibody (R&D, AF-201-NA), anti-CASP1-p20 antibody (Adipogen, AG-20B-0048-C100), anti-NLRP3 antibody (Adipogen, AG-20B0014-C100), anti-ASC antibody (Santa Cruz Biotechnology, sc22514-R), and anti-CASP4 antibody (Santa Cruz Biotechnology, sc-56056) for 72 h as primary and respective IgG–HRP conjugates as secondary antibodies (Santa Cruz Biotechnology). Beta actin was blotted with anti-β-actin–HRP (Santa Cruz Biotechnology, sc47778).
Acknowledgments: We kindly thank the group of Dr. E. Endl for their great support with FACSorting. This work was supported by grants from the German Research Foundation (SFB704 and SFB670) and the European Research Council (ERC-2009StG 243046) to V.H. V.H. is a member of the excellence cluster ImmunoSensation. J.L.S.-B. is supported by the German National Academic Foundation. E.B. is supported by the BONFOR program of the University Hospital Bonn.
Conflict of interest: The authors declare no financial or commercial conflict of interest.
References 1 Martinon, F. and Tschopp, J., Inflammatory caspases and inflammasomes: master switches of inflammation. Cell Death Differ. 2007. 14: 10–22. 2 Jimenez Fernandez, D. and Lamkanfi, M., Inflammatory caspases: key regulators of inflammation and cell death. Biol. Chem. 2015. 396: 193–203. 3 Gross, O., Thomas, C. J., Guarda, G. and Tschopp, J., The inflammasome: an integrated view. Immunol. Rev. 2011. 243: 136–151.
ELISA
4 Latz, E., Xiao, T. S. and Stutz, A., Activation and regulation of the inflammasomes. Nat. Rev. Immunol. 2013. 13: 397–411.
Twenty-four hours after stimulation, IL-1β and TNF ELISA were performed according to the manufacturer’s instructions (OptEIA, BD Biosciences). C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
5 Kayagaki, N., Warming, S., Lamkanfi, M., Vande Walle, L., Louie, S., Dong, J., Newton, K. et al., Non-canonical inflammasome activation targets caspase-11. Nature 2011. 479: 117–121.
www.eji-journal.eu
Eur. J. Immunol. 2015. 45: 2911–2917
Innate immunity
6 Case, C. L., Kohler, L. J., Lima, J. B., Strowig, T., de Zoete, M. R.,
16 Lin, X. Y., Choi, M. S. and Porter, A. G., Expression analysis of the human
Flavell, R. A., Zamboni, D. S. et al., Caspase-11 stimulates rapid flagellin-
caspase-1 subfamily reveals specific regulation of the CASP5 gene by
independent pyroptosis in response to Legionella pneumophila. Proc. Natl.
lipopolysaccharide and interferon-gamma. J. Biol. Chem. 2000. 275: 39920–
Acad. Sci. USA 2013. 110: 1851–1856.
39926.
7 Kayagaki, N., Wong, M. T., Stowe, I. B., Ramani, S. R., Gonzalez, L. C.,
17 Wang, S., Miura, M., Jung, Y. K., Zhu, H., Li, E. and Yuan, J., Murine
Akashi-Takamura, S., Miyake, K. et al., Noncanonical inflammasome
caspase-11, an ICE-interacting protease, is essential for the activation of
activation by intracellular LPS independent of TLR4. Science 2013. 341:
ICE. Cell 1998. 92: 501–509.
1246–1249. 8 Hagar, J. A., Powell, D. A., Aachoui, Y., Ernst, R. K. and Miao, E. A., Cytoplasmic LPS activates caspase-11: implications in TLR4-independent endotoxic shock. Science 2013. 341: 1250–1253.
18 Py, B. F., Jin, M., Desai, B. N., Penumaka, A., Zhu, H., Kober, M., Dietrich, A. et al., Caspase-11 controls interleukin-1beta release through degradation of TRPC1. Cell Rep. 2014. 6: 1122–1128. 19 Schmid-Burgk, J. L., Schmidt, T., Gaidt, M. M., Pelka, K., Latz, E., Ebert,
9 Shi, J., Zhao, Y., Wang, Y., Gao, W., Ding, J., Li, P., Hu, L. et al., Inflamma-
T. S. and Hornung, V., OutKnocker: a web tool for rapid and simple
tory caspases are innate immune receptors for intracellular LPS. Nature
genotyping of designer nuclease edited cell lines. Genome Res. 2014. 24:
2014. 514: 187–192.
1719–1723.
10 Kamens, J., Paskind, M., Hugunin, M., Talanian, R. V., Allen, H., Banach,
20 Jakobs, C., Bartok, E., Kubarenko, A., Bauernfeind, F. and Hornung, V.,
D., Bump, N. et al., Identification and characterization of ICH-2, a novel
Immunoblotting for active caspase-1. Methods Mol. Biol. 2013. 1040: 103–
member of the interleukin-1 beta-converting enzyme family of cysteine
115.
proteases. J. Biol. Chem. 1995. 270: 15250–15256. 11 Sollberger, G., Strittmatter, G. E., Kistowska, M., French, L. E. and Beer, H. D., Caspase-4 is required for activation of inflammasomes. J. Immunol. 2012. 188: 1992–2000. 12 Kajiwara, Y., Schiff, T., Voloudakis, G., Gama Sosa, M. A., Elder, G., Bozdagi, O. and Buxbaum, J. D., A critical role for human caspase-4 in endotoxin sensitivity. J. Immunol. 2014. 193: 335–343. 13 Martinon, F., Burns, K. and Tschopp, J., The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-beta. Mol. Cell 2002. 10: 417–426. 14 Ii, M., Matsunaga, N., Hazeki, K., Nakamura, K., Takashima, K., Seya, T., Hazeki, O. et al., A novel cyclohexene derivative, ethyl (6R)-6-
Abbreviations: Cas9: CRISPR associated protein 9 · CRISPR: clustered regularly interspaced short palindromic repeats · Ct: cycle threshold · LDH: lactate dehydrogenase · NLR: Nod-like receptor Full correspondence: Dr. Veit Hornung, Institute of Molecular Medicine, University Hospital, University of Bonn, Sigmund-Freud-Straße 25, 53127 Bonn, Germany Fax: +49-228-28751201 e-mail: [email protected] See accompanying articles: http://dx.doi.org/10.1002/eji.201545655, http://dx.doi.org/10.1002/eji.201545772
[N-(2-Chloro-4-fluorophenyl)sulfamoyl]cyclohex-1-ene-1-carboxylate (TAK-242), selectively inhibits toll-like receptor 4-mediated cytokine production through suppression of intracellular signaling. Mol. Pharmacol. 2006. 69: 1288–1295. 15 Munoz-Planillo, R., Kuffa, P., Martinez-Colon, G., Smith, B. L., Rajendiran, T. M. and Nunez, G., K(+) efflux is the common trigger of NLRP3 inflammasome activation by bacterial toxins and particulate matter. Immunity 2013. 38: 1142–1153.
C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
See accompanying Commentary: http://dx.doi.org/10.1002/eji.201545958 Received: 28/1/2015 Revised: 6/6/2015 Accepted: 10/7/2015 Accepted article online: 6/8/2015
www.eji-journal.eu
2917
