Histopathology 2014
Correspondence CD109 is expressed in epithelial cells of the juvenile thymus DOI: 10.1111/his.12557 © 2014 John Wiley & Sons Ltd
Sir: The thymus constitutes the primary lymphoid organ responsible for the generation of mature, diverse, non-autoreactive T cell repertoire.1 Thymic epithelial cells (TECs) are the major components in thymic microenvironment supporting the development and maturation T cell precursors.2 Organized in a three-dimensional network, TECs express a diverse set of genes coding for parenchymal organspecific membrane proteins, which interact with developing thymocytes and facilitate instructive signals.2 Transforming growth factor (TGF)-b is a widely expressed, highly conserved cytokine that regulates a variety of cellular processes.3 In thymus, TGF-b is expressed in TECs and prevents efficient thymus-dependent T cell maturation.3 CD109, a glycosylphosphatidylinositol (GPI)-anchored glycoprotein, is a co-receptor of TGF-b.4 CD109 binds TGF-b1 with high affinity, enhances internalization of TGF-b receptors and inhibits TGF-b signalling.4 In mammals, CD109 is highly expressed in squamous cells of lung, skin and uterus, but its expression in other epithelial cell types remains unclear. A previous study mentioned that CD109 protein is detected in epithelial cells, vascular endothelial cells (VECs) and smooth muscle cells (SMCs) in infantile thymus tissue.5 However, no image was presented and the expression pattern has not been validated by other studies. In this study, CD109 expression on human juvenile thymic tissues was determined by immunohistochemistry. The tissue microarrays (TMAs) were obtained from US Biomax, Inc. (Rockville, MD, USA; T461 and THY176), which includes human thymic tissues from eight juvenile donors (age 15–21 years). Immunohistochemical staining was performed on the TMAs using a rabbit polyclonal anti-CD109 antibody (HPA009292; Sigma-Aldrich, St Louis, MO, USA) with appropriate controls. After staining, the TMAs were photographed with the Olympus FSX100 imaging system (Olympus, Tokyo, Japan). In all the TMAs of normal thymic tissues, CD109 staining was positive in both cortical and medullary epithelial cells (Figure 1A,B). In cortex, CD109 is
expressed in the subcapsular epithelial cells and thymic nurse cells which surround approximately 100–200 thymocytes.1 No positive staining was observed in VECs, SMCs and perivascular epithelial cells (Figure 1A). In medulla, CD109 is expressed in epithelial cell clusters and the sounding capsular cells of Hassall’s corpuscles, but not in the reticular cells or granular cells in the centre (Figure 1B). To detect CD109 gene expression in TECs, human juvenile unfractionated thymocytes and TECs were obtained as described previously.6 The conditioned media were prepared from thymocytes and co-cultured with TECs for 12 h. The total RNA was extracted from the cells and CD109 mRNA levels were examined by real time–polymerase chain reaction (PCR). The primers were listed in Table 1. As shown in Figure 1C, TECs displayed a higher CD109 expression than the thymocytes (P < 0.05). Co-culture with conditioned media from thymocytes remarkably increased the mRNA expression of CD109 in TECs (1.91 0.56 versus 6.13 1.67-fold, P < 0.01), suggesting that CD109 expression in TECs is regulated by extracellular proteins secreted or modified by developing thymocytes. TECs are crucial in establishing and maintaining the appropriate microenvironment for T cell differentiation. TGF-b signalling inhibits the growth and function of TECs.3 Eliminating TGF-b signalling specifically in TECs increased the size of the TEC compartment and enhanced the negative selection and functional maturation of medullary thymocytes.3 CD109 is a negative regulator of TGF-b signalling.4 Interestingly, we found that CD109 transcription is stimulated by conditioned media collected from thymocytes. In addition, CD109 is not expressed in VECs, SMCs and perivascular epithelial cells, which do not interact directly with developing thymocytes. Thus, CD109 expression in TECs is associated with the microenvironment constituted by thymocytes. CD109 may mediate intercellular signalling from the developing thymocytes and activate TEC proliferation to support T cell maturation by suppression of TGF-b signalling. Our study demonstrated that CD109 expression is restricted in TECs surrounding developing thymocytes and suggested the potential function of CD109 in the balance of TGF-b signalling in TECs. Further studies are necessary to investigate the physiological roles of CD109 in T cell differentiation and underlying molecular mechanisms.
2 Correspondence
A
B
C
10
Relative CD109 mRNA expression
**
8
6
*
4
2
0 Thymocytes
TECs
TECs co-cultured with thymocytes
Histopathology
Correspondence
3
Figure 1. CD109 expression in human juvenile thymic epithelial cells. A,B, Immunostaining of CD109 antibody on human juvenile thymic tissues. A, cortical thymic tissue; rectangular box marks the region shown; arrow refers to CD109 positive subcapsular epithelial cells. B, Medullary thymic tissue; rectangular box marks the region shown; arrow refers to CD109-positive capsular epithelial cells of a Hassall’s corpuscle. C, Real time–polymerase chain reaction (PCR) analysis of CD109 mRNA expression in thymocytes, thymic epithelial cells (TECs) and TECs co-cultured with conditioned media from thymocytes; n = 6. *P < 0.05; **P < 0.01.
Table 1. Reverse transcription–polymerase chain reaction (RT–PCR) primer sequences Gene
Sequence
Size (bp)
Temperature (°C)
Forward
GCCTTTGATTTAGATGTTGCTGTA
188
57.6
Reverse
TATTCCACTTTCTTCACTGTCTCG
CD109
56.8
b-actin Forward
CGTCTTCCCCTCCATCG
Reverse
CTCGTTAATGTCACGCAC
94
54.8 51.7
All sequences are in the 50 –30 orientation. bp, base pairs. ACKNOWLEDGEMENT
This study was supported by a Shandong Taishan Scholarship from Shandong Provincial Government. Fengyun Dong1 Yao Wang1 Liqun Li1 Xiaochun Liu2 Suhua Yan1 Ju Liu1 1
Shandong Provincial Qianfoshan Hospital, Shandong University, Jinan, China, and 2Department of Investigational Cancer Therapeutics, University of Texas MD Anderson Cancer Center, Houston, TX, USA
Histopathology
1. Boyd RL, Tucek CL, Godfrey DI et al. The thymic microenvironment. Immunol. Today 1993; 14; 445–459. 2. Anderson G, Takahama Y. Thymic epithelial cells: working class heroes for T cell development and repertoire selection. Trends Immunol. 2012; 33; 256–263. 3. Hauri-Hohl M, Zuklys S, Hollander GA, Ziegler SF. A regulatory role for TGF-beta signaling in the establishment and function of the thymic medulla. Nat. Immunol. 2014; 15; 554–561. 4. Finnson KW, Tam BY, Liu K et al. Identification of CD109 as part of the TGF-beta receptor system in human keratinocytes. FASEB J. 2006; 20; 1525–1527. 5. Kaymaz FF, Dagdeviren A, Asan E. Antigenic profile of human thymus in concurrence with ‘clusters of thymic epithelial staining’ classification. Ann. Anat. 2003; 185; 163–171. 6. Scupoli MT, Fiorini E, Marchisio PC et al. Lymphoid adhesion promotes human thymic epithelial cell survival via NF-(kappa)B activation. J. Cell Sci. 2000; 113; 169–177.
Correspondence CD109 is expressed in epithelial cells of the juvenile thymus DOI: 10.1111/his.12557 © 2014 John Wiley & Sons Ltd
Sir: The thymus constitutes the primary lymphoid organ responsible for the generation of mature, diverse, non-autoreactive T cell repertoire.1 Thymic epithelial cells (TECs) are the major components in thymic microenvironment supporting the development and maturation T cell precursors.2 Organized in a three-dimensional network, TECs express a diverse set of genes coding for parenchymal organspecific membrane proteins, which interact with developing thymocytes and facilitate instructive signals.2 Transforming growth factor (TGF)-b is a widely expressed, highly conserved cytokine that regulates a variety of cellular processes.3 In thymus, TGF-b is expressed in TECs and prevents efficient thymus-dependent T cell maturation.3 CD109, a glycosylphosphatidylinositol (GPI)-anchored glycoprotein, is a co-receptor of TGF-b.4 CD109 binds TGF-b1 with high affinity, enhances internalization of TGF-b receptors and inhibits TGF-b signalling.4 In mammals, CD109 is highly expressed in squamous cells of lung, skin and uterus, but its expression in other epithelial cell types remains unclear. A previous study mentioned that CD109 protein is detected in epithelial cells, vascular endothelial cells (VECs) and smooth muscle cells (SMCs) in infantile thymus tissue.5 However, no image was presented and the expression pattern has not been validated by other studies. In this study, CD109 expression on human juvenile thymic tissues was determined by immunohistochemistry. The tissue microarrays (TMAs) were obtained from US Biomax, Inc. (Rockville, MD, USA; T461 and THY176), which includes human thymic tissues from eight juvenile donors (age 15–21 years). Immunohistochemical staining was performed on the TMAs using a rabbit polyclonal anti-CD109 antibody (HPA009292; Sigma-Aldrich, St Louis, MO, USA) with appropriate controls. After staining, the TMAs were photographed with the Olympus FSX100 imaging system (Olympus, Tokyo, Japan). In all the TMAs of normal thymic tissues, CD109 staining was positive in both cortical and medullary epithelial cells (Figure 1A,B). In cortex, CD109 is
expressed in the subcapsular epithelial cells and thymic nurse cells which surround approximately 100–200 thymocytes.1 No positive staining was observed in VECs, SMCs and perivascular epithelial cells (Figure 1A). In medulla, CD109 is expressed in epithelial cell clusters and the sounding capsular cells of Hassall’s corpuscles, but not in the reticular cells or granular cells in the centre (Figure 1B). To detect CD109 gene expression in TECs, human juvenile unfractionated thymocytes and TECs were obtained as described previously.6 The conditioned media were prepared from thymocytes and co-cultured with TECs for 12 h. The total RNA was extracted from the cells and CD109 mRNA levels were examined by real time–polymerase chain reaction (PCR). The primers were listed in Table 1. As shown in Figure 1C, TECs displayed a higher CD109 expression than the thymocytes (P < 0.05). Co-culture with conditioned media from thymocytes remarkably increased the mRNA expression of CD109 in TECs (1.91 0.56 versus 6.13 1.67-fold, P < 0.01), suggesting that CD109 expression in TECs is regulated by extracellular proteins secreted or modified by developing thymocytes. TECs are crucial in establishing and maintaining the appropriate microenvironment for T cell differentiation. TGF-b signalling inhibits the growth and function of TECs.3 Eliminating TGF-b signalling specifically in TECs increased the size of the TEC compartment and enhanced the negative selection and functional maturation of medullary thymocytes.3 CD109 is a negative regulator of TGF-b signalling.4 Interestingly, we found that CD109 transcription is stimulated by conditioned media collected from thymocytes. In addition, CD109 is not expressed in VECs, SMCs and perivascular epithelial cells, which do not interact directly with developing thymocytes. Thus, CD109 expression in TECs is associated with the microenvironment constituted by thymocytes. CD109 may mediate intercellular signalling from the developing thymocytes and activate TEC proliferation to support T cell maturation by suppression of TGF-b signalling. Our study demonstrated that CD109 expression is restricted in TECs surrounding developing thymocytes and suggested the potential function of CD109 in the balance of TGF-b signalling in TECs. Further studies are necessary to investigate the physiological roles of CD109 in T cell differentiation and underlying molecular mechanisms.
2 Correspondence
A
B
C
10
Relative CD109 mRNA expression
**
8
6
*
4
2
0 Thymocytes
TECs
TECs co-cultured with thymocytes
Histopathology
Correspondence
3
Figure 1. CD109 expression in human juvenile thymic epithelial cells. A,B, Immunostaining of CD109 antibody on human juvenile thymic tissues. A, cortical thymic tissue; rectangular box marks the region shown; arrow refers to CD109 positive subcapsular epithelial cells. B, Medullary thymic tissue; rectangular box marks the region shown; arrow refers to CD109-positive capsular epithelial cells of a Hassall’s corpuscle. C, Real time–polymerase chain reaction (PCR) analysis of CD109 mRNA expression in thymocytes, thymic epithelial cells (TECs) and TECs co-cultured with conditioned media from thymocytes; n = 6. *P < 0.05; **P < 0.01.
Table 1. Reverse transcription–polymerase chain reaction (RT–PCR) primer sequences Gene
Sequence
Size (bp)
Temperature (°C)
Forward
GCCTTTGATTTAGATGTTGCTGTA
188
57.6
Reverse
TATTCCACTTTCTTCACTGTCTCG
CD109
56.8
b-actin Forward
CGTCTTCCCCTCCATCG
Reverse
CTCGTTAATGTCACGCAC
94
54.8 51.7
All sequences are in the 50 –30 orientation. bp, base pairs. ACKNOWLEDGEMENT
This study was supported by a Shandong Taishan Scholarship from Shandong Provincial Government. Fengyun Dong1 Yao Wang1 Liqun Li1 Xiaochun Liu2 Suhua Yan1 Ju Liu1 1
Shandong Provincial Qianfoshan Hospital, Shandong University, Jinan, China, and 2Department of Investigational Cancer Therapeutics, University of Texas MD Anderson Cancer Center, Houston, TX, USA
Histopathology
1. Boyd RL, Tucek CL, Godfrey DI et al. The thymic microenvironment. Immunol. Today 1993; 14; 445–459. 2. Anderson G, Takahama Y. Thymic epithelial cells: working class heroes for T cell development and repertoire selection. Trends Immunol. 2012; 33; 256–263. 3. Hauri-Hohl M, Zuklys S, Hollander GA, Ziegler SF. A regulatory role for TGF-beta signaling in the establishment and function of the thymic medulla. Nat. Immunol. 2014; 15; 554–561. 4. Finnson KW, Tam BY, Liu K et al. Identification of CD109 as part of the TGF-beta receptor system in human keratinocytes. FASEB J. 2006; 20; 1525–1527. 5. Kaymaz FF, Dagdeviren A, Asan E. Antigenic profile of human thymus in concurrence with ‘clusters of thymic epithelial staining’ classification. Ann. Anat. 2003; 185; 163–171. 6. Scupoli MT, Fiorini E, Marchisio PC et al. Lymphoid adhesion promotes human thymic epithelial cell survival via NF-(kappa)B activation. J. Cell Sci. 2000; 113; 169–177.
