RESEARCH ARTICLE

CD200R1 and CD200 Expression Are Regulated by PPAR-c in Activated Glial Cells Guido Dentesano,1 Joan Serratosa,1 Josep M. Tusell,1 Pol Ram on,1 Tony Valente,1 Josep Saura,2 and Carme Sol a1 The mechanisms that control microglial activation are of interest, since neuroinflammation, which involves reactive microglia, may be an additional target in the search for therapeutic strategies to treat neurodegenerative diseases. Neuron-microglia interaction through contact-dependent or independent mechanisms is involved in the regulation of the microglial phenotype in both physiological and pathological conditions. The interaction between CD200, which is mainly present in neurons but also in astrocytes, and CD200R1, which is mainly present in microglia, is one of the mechanisms involved in keeping the microglial proinflammatory phenotype under control in physiological conditions. Alterations in the expression of CD200 and CD200R1 have been described in neurodegenerative diseases, but little is known about the mechanism of regulation of these proteins under physiological or pathological conditions. The aim of this work was to study the modulation of CD200 and CD200R1 expression by peroxisome proliferator-activated receptor gamma (PPAR-c), a transcription factor involved in the control of the inflammatory response. Mouse primary neuronal and glial cultures and neuron-microglia cocultures were treated with the PPAR-c endogenous ligand 15-deoxy-D12, 14-prostaglandin J2 (15d-PGJ2) in the presence and absence of lipopolysaccharide plus interferon-c (LPS/IFN-c)-induced glial activation. We show that 15d-PGJ2 inhibits the pro-inflammatory response and prevents both CD200R1 downregulation and CD200 upregulation in reactive glial cells. In addition, 15d-PGJ2 abrogates reactive-microglia induced neurotoxicity in neuron-microglia cultures through a CD200-CD200R1 dependent mechanism. These results suggest that PPAR-c modulates CD200 and CD200R1 gene expression and that CD200-CD200R1 interaction is involved in the anti-inflammatory and neuroprotective action of PPAR-c agonists. GLIA 2014;00:000–000

Key words: neuroinflammation, anti-inflammatory, neuroprotection, microglia, astroglia, in vitro

Introduction

M

icroglial cells are involved in inflammatory and immune responses of the CNS. Under physiological conditions, they constantly survey the extracellular milieu, ready to act against modifications derived from alterations in the normal functioning of the CNS. Microglial activation includes a wide range of phenotypes, which are probably present at the same time in different microglial populations to re-establish brain homeostasis and minimize neuronal damage (Colton, 2009; Hanisch and Kettenmann, 2007; Ransohoff and Cardona, 2010). Some of the numerous genes overexpressed in reactive microglia are involved in the production of factors typical of an inflammatory response, which are necessary for the

immune response but have a potential neurotoxic effect (Block et al., 2007). Consequently, the progression and resolution of microglial activation has to be tightly controlled and microglial activation should resolve when the reactive phenotype is no longer necessary, to avoid negative secondary effects. A common phenomenon in all neurodegenerative diseases is the presence of chronic glial activation or neuroinflammation, which may contribute to the progress of neuronal damage in these pathologies (Glass et al., 2010). The specific mechanisms that lead to the initiation of brain inflammation in a particular neurological disease are not well understood. Neither are the mechanisms that contribute to chronic neuroinflammation. Possible alterations in the regulatory factors involved in the

View this article online at wileyonlinelibrary.com. DOI: 10.1002/glia.22656 Published online Month 00, 2014 in Wiley Online Library (wileyonlinelibrary.com). Received Aug 1, 2013, Accepted for publication Feb 25, 2014. Address correspondence to Carme Sol a, Department Cerebral Ischemia and Neurodegeneration, IIBB-CSIC, C/Rossell o 161, 6th Floor, E-08036 Barcelona, Spain. E-mail: [email protected] From the 1Department of Cerebral Ischemia and Neurodegeneration, Institut d’Investigacions Biome`diques de Barcelona-Consejo Superior de Investigaciones Cientıficas (CSIC), Institut d’Investigacions Biome`diques August-Pi i Sunyer (IDIBAPS), Barcelona, Spain; 2Biochemistry and Molecular Biology Unit, School of Medicine, University of Barcelona, IDIBAPS, Barcelona, Spain. Additional Supporting Information may be found in the online version of this article.

C 2014 Wiley Periodicals, Inc. 1 V

initiation, maintenance, and resolution of brain inflammation may contribute to the development of neuronal damage in neurodegenerative diseases. The mechanisms of control of glial activation are then possible targets to be considered in therapeutic approaches. Microglia act as sensors of neural activity and neurons play a relevant role in maintaining microglial cells in a nonactivated state in physiological conditions, through contactdependent and contact-independent inhibitory signals (Tian et al., 2009). Consequently, pathological insults resulting in alterations in neuronal and/or microglial function will modify neuron-microglia communication and result in microglial activation. One of the inhibitory mechanisms involved in the control of the inflammatory response in microglial cells is CD200CD200R1 interaction (Ransohoff and Cardona, 2010; Wang et al., 2007). CD200 is a surface glycoprotein that in the CNS is mainly expressed by neurons, although expression in other cell types cannot be discarded. CD200 has an extracellular portion with two immunoglobulin domains, typical of proteins involved in cell-to-cell interaction. The CD200 receptor CD200R1, which has a similar structure but with an additional intracellular domain that is susceptible to phosphorylation and involved in signal transduction, is mainly expressed in myeloid cells, such as microglia in the CNS. Alterations in CD200 and CD200R1 expression have been described in Alzheimer’s disease (Walker et al., 2009) and multiple sclerosis (Koning et al., 2007, 2009). Results from studies with experimental animal models of neurodegenerative diseases show that impairment of CD200-CD200R1 interaction results in more severe pathology (Broderick et al., 2002; Hoek et al., 2000; Meuth et al., 2008; Wright et al., 2000b), while enhancement of CD200R1 signalling alleviates pathological outcome (Copland et al., 2007; Chitnis et al., 2007; Liu et al., 2010). Little is known about the mechanisms involved in the control of CD200 and CD200R1 expression in physiological and pathological conditions. In a previous study, we showed that CD200R1 expression is inhibited in reactive microglial cells in vitro, and that the transcription factor CCAAT/enhancer binding protein beta (C/EBPb) plays a role in this inhibition (Dentesano et al., 2012). Thus, C/EBPb, whose expression is increased in reactive microglia, is involved in both the induction of proinflammatory gene expression and the inhibition of the expression of antiinflammatory molecules. Peroxisome proliferator-activated receptor-gamma (PPAR-c) transcription factor activation plays a role in controlling the inflammatory response by inhibiting the expression of proinflammatory factors, and PPAR-c agonists have been found to have anti-inflammatory and neuroprotective properties (Kapadia et al., 2009). The aim of this study was to examine the possible modulation of CD200 and CD200R1 expression by PPAR-c. We determined whether 2

the endogenous PPAR-c agonist 15-deoxy-D12, 14-prostaglandin J2 (15d-PGJ2) modulated CD200 and CD200R1 expression and whether CD200-CD200R1 interaction was involved in the neuroprotective effect of this PPAR-c agonist. We used mouse primary microglial, mixed glial, and neuronal cultures, as well as neuron-microglia cocultures. We observed that 15dPGJ2 abrogated the inflammatory response and prevented CD200R1 expression inhibition in reactive microglial cells. The PPAR-c agonist also had an effect on CD200 expression in astrocytes. In addition, 15d-PGJ2 protected against reactive microglia induced neurotoxicity in neuron-microglia cultures, an effect that was dependent on CD200R1 signalling. These results show that PPAR-c agonists modulate CD200 and CD200R1 expression in reactive glial cells, and that CD200CD200R1 interaction is necessary for the neuroprotective effect of PPAR-c agonists.

Material and Methods Experiments were carried out in accordance with European Union directives (86/609/EU) and Spanish regulations (BOE 67/8509-12, 1988) on the use of laboratory animals, and were approved by the Ethics and Scientific Committees of Barcelona University and the Hospital Clınic Provincial de Barcelona.

Cell Cultures Mixed glial and microglial cultures were prepared from postnatal day 1–3 C57BL/6 mice (Charles River, Lyon, France), as previously described (Ejarque-Ortiz et al., 2007). To prepare mixed glial cultures, cerebral cortices were dissected, stripped of their meninges, and digested with 0.25% trypsin-EDTA solution (Invitrogen, Carlsbad, CA; 25–30 min shaking at 37 C). Trypsinization was stopped by adding an equal volume of culture medium, to which 0.02% deoxyribonuclease I (Sigma-Adrich, St. Louis, MO) was added. The culture medium consisted of Dulbecco’s modified Eagle medium-F12 nutrient mixture (Invitrogen) supplemented with 10% heatinactivated fetal bovine serum (FBS, Invitrogen), 0.1% penicillinstreptomycin (Invitrogen), and 0.5 lg/mL amphotericin B R ). The solution was brought to a single cell suspension (FungizoneV by repeated pipetting and filtered by passing through a 100-lm-pore mesh. Cells were pelleted, resuspended in fresh culture medium, seeded at a density of 3.5 3 105 cells/mL and cultured at 37 C in a 5% CO2 humidified atmosphere. The medium was replaced every 10 days. Cultures are confluent after 10–12 days in vitro (DIV) and were used after 21 DIV. Astrocytes were the most abundant cell type and microglial cells were 20%. Microglial cultures were obtained from mixed glial cultures by mild trypsinization as described (Saura et al., 2003). Briefly, 21 DIV mixed glial cultures were treated for 30 min with 0.06% trypsinEDTA. This resulted in the detachment of an intact layer of cells containing virtually all the astrocytes, leaving a population of firmly attached cells identified as >98% microglia. The microglial cultures were treated 24 h after isolation. Primary cortical neuronal cultures were prepared from C57BL/6 mice on embryonic day 16, as previously described

Volume 00, No. 00

Dentesano et al.: PPAR-g Modulation of CD200R1-CD200 Expression

TABLE 1: Primers Used for qRT-PCR and for qChIP

qRT-PCR Accession number

Forward primer (50 > 30 )

CD200

NM_010818.3

CTGTGAGGGATTTGACTTTTTGC CCGAGGCACTCGACTTCCT

CD200R1

NM_021325.3

AGGAGGATGAAATGCAGCCTTA

TGCCTCCACCTTAGTCACAGTATC

COX-2

NM_011198.3

TGCAGAATTGAAAGCCCTCT

CCCCAAAGATAGCATCTGGA

gp91phox

NM_001127330.1

ACTCCTTGGGTCAGCACTGGCT

GCAACACGCACTGGAACCCCT

HPRT1*

NM_013556.2

ATCATTATGCCGAGGATTTGG

GCAAAGAACTTATAGCCCCC

IL-1b

NM_008361.3

TGGTGTGTGACGTTCCCATTA

CAGCACGAGGCTTTTTTGTTG

IL-6

NM_031168.1

CCAGTTTGGTAGCATCCATC

CCGCAGAGGAGACTTCACAG

iNOS

NM_010927.3

GGCAGCCTGTGAGACCTTTG

GCATTGGAAGTGAAGCGTTTC

PPAR-c

NM_001127330.1

CCTTCTAACTCCCTCATGGC

ACCTGATGGCATTGTGAGAC

RNS18*

NR_003286.2

GTAACCCGTTGAACCCCATT

CCATCCAATCGGTAGTAGCG

TNF-a

NM_013693.2

TGATCCGCGACGTGGGAA

ACCGCCTGGAGTTCTGGAA

Target gene

Reverse primer (50 > 30 )

qChIP Gene promoter Box (distance to TSS) Forward primer (50 > 30 )

Reverse primer (50 > 30 )

CD200

10 (2181/2204) 20 (21401/21424)

GCCAGGGAAATGTCCTCATA AGTTGGTGCCTGGTTGTAGC

CTGGCAGGGCTATGAAAGAG CCAACAGGCTGAAAGAGGAG

CD200R1

1 (23/2297) 2 (21366/21389) 3(24456/24479)

TCTCACCATGGCATTTTCAA GGGGACTGCAATCAGGTCTA TGATTGGGTGTGCAGCTTTA

ATGCCCAAGACAGATGGATG CTCTGCCAAGCAACCTCAAT GACCCTTTGCCTTGTTTCAA

*Reference genes. TSS: Transcription start site.

(Gresa-Arribas et al., 2010). Briefly, cells were seeded at a density of 8 3 105 cells per mL in poly-D-lysine (Sigma-Aldrich) precoated plates and cultured at 37 C in a 5% CO2 humidified atmosphere. These cultures contained 76% neurons, 17% astrocytes, < 1% microglial cells, and 6% other cell types. These neuronal-glial cultures are called “neuronal cultures” here. In some experiments, neuronal-enriched cultures were obtained, in which glial cell proliferation was inhibited by adding 10 lM cytosine arabinoside 24 h after seeding. These cultures were used at 6–8 DIV. Neuron–microglia cocultures were obtained as previously described (Gresa-Arribas et al., 2010). Microglial cultures, obtained as described above, were incubated with 0.25% trypsin for 10 min at 37 C. Trypsinization was stopped by adding the same volume of culture medium with 10% FBS and cells were gently scraped and collected. Cells were centrifuged for 5 min at 200g. The pellet was resuspended in neuronal culture medium and aliquots of the cell suspension (50 lL/well) were seeded on top of 5 DIV primary neuronal culture at a final density of 4 3 105 cells/mL (1.3 3 105 cells/ cm2) and treated for 48 h on the following day (6 DIV).

Treatments Cultures were treated with LPS from Escherichia coli (100 ng/mL; 026:B6; Sigma-Aldrich) plus interferon (IFN)-c (30 ng/mL;

Month 2014

Sigma-Aldrich) for 6 h for mRNA extraction and chromatin immunoprecipitation, 24 h for protein extraction and immunocytochemistry, 24 and 48 h for nitrite and cell viability assays. Control cells were treated with an equivalent volume of culture medium. The PPAR-c agonist 15-deoxy-D12,14-prostaglandin J2 (15dPGJ2; 18,570; Cayman Chemical Company, Ann Arbor, MI) was added to the culture media 1 h prior to LPS/IFN-c treatment at a final concentration of 1 lM. The PPARc antagonists GW9662 (sc202641; Santa Cruz Biotechnology, Temecula, CA) and bisphenol A diglycidyl ether (BADGE, 70,790, Cayman Chemicals Company) were added to the culture media 30 min prior to 15d-PGJ2 treatment at a final concentration of 1 lM. Rat anti-mouse CD200R1 blocking antibody or its corresponding serotype (rat IgG; AbD Serotec, Bio-Rad Laboratories) were added to the culture media 30 min prior to 15d-PGJ2 treatment at a final concentration of 0.1 lg/mL.

Nitric Oxide (NO) Production NO production was assessed by the colorimetric Griess reaction in culture supernatants. Optical density at 540 nm was determined using a microplate reader (Multiskan Spectrum; Thermo Electron Corporation, Waltham, CA).

3

Quantitative Real-Time PCR (qRT-PCR) mRNA expression was analyzed by qRT-PCR as described previously (Dentesano et al., 2012). For isolation of total RNA, one well from six-well plates was used per experimental condition. Total RNA from mixed glial cultures was isolated using a High Pure RNA Isolation Kit (Roche Diagnostics, Mannheim, Germany). For microglial cultures, we used a PureLink RNA micro kit (Invitrogen). RNA was reverse transcribed with random primers using Transcriptor Reverse Transcriptase (Roche Diagnostics). Three nanograms of cDNA were used to perform qRT-PCR. The primers used (Integrated DNA Technology, IDT, Skokie, IL) are shown in Table 1. qRT-PCR was carried out using the IQ SYBR Green SuperMix (Bio-Rad Laboratories, Hercules, CA) in 15 lL of final volume, using an iCycler MyIQ apparatus (Bio-Rad Laboratories). Samples were run for 50 cycles (95 C for 15 s, 60 C for 30 s, and 72 C for 15 s). Relative gene expression values were calculated using the comparative Ct or DDCt method (Livak and Schmittgen, 2001) and iQ5 2.0 software (Bio-Rad Laboratories). Ct values were corrected according to the amplification efficiency of the respective primer pair, which was estimated from standard curves generated by dilution of a cDNA pool.

Immunocytochemistry Cultured cells were fixed with 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4) for 20 min at room temperature. Single and double immunofluorescence approaches were performed. With the exception of CD200R1 immunolabeling, cells were permeated with 0.3% Triton X-100 in phosphate-buffered saline (PBS) containing 1% bovine serum albumin (BSA) and 10% normal goat or/and normal donkey serum (depending on the secondary antibody/dyes used) for 20 min at room temperature. Cells were then incubated overnight at 4 C with primary antibodies (see Table 2). Once they had been rinsed in PBS, cells were incubated for 1 h at room temperature with secondary antibodies (see Table 2). Antibodies were diluted in 0.3% Triton X-100 in PBS containing 1% BSA and 10% normal goat or normal donkey serum. Cell nuclei were stained with Hoechst 33258 (Sigma). Microscopy images were obtained with an Olympus IX70 microscope (Olympus, Okoya, Japan) and a digital camera (CC-12, Olympus Soft Imaging Solutions GmbH, Hamburg, Germany). Additional images were obtained with a TCS SP5 laser scanning confocal microscope (Leica, Heidelberg, Germany).

Total Protein Extraction For the isolation of total protein, one well on a six-well plate was used for each experimental condition, with the exception of microglial cultures, where a pool of two wells was used. After a cold PBS wash, cells were scraped and recovered in 100 lL of RIPA buffer (1% Igepal CA-630, 5 mg/mL sodium deoxycholate, 1 mg/mL sodium dodecyl phosphate and protease inhibitor cocktail ComR , Roche Diagnostics, in PBS). Samples were sonicated, centripleteV fuged for 10 min at 10,400g and stored at 220 C. A different protocol was used to evaluate CD200R1 expression in microglial cells: a non-denaturing lysis buffer was considered (20 mM Tris HCl pH 8; 137 mM NaCl, 10% glycerol, 1% Igepal, 2mM EDTA, and R ) and cells were scraped off the dish, transferred to a preCompleteV cooled microfuge tube and maintained in constant agitation for 30

4

min at 4 C. Once the samples had been centrifuged for 12 min at 13,400g, the supernatant was collected. The amount of protein was determined by the Lowry assay (Total Protein kit micro-Lowry, Sigma-Aldrich).

Western Blot Western blot analyses of total protein extracts were performed as described (Dentesano et al., 2012). Briefly, 30 lg of protein were subjected to SDS-PAGE on a 10% polyacrylamide minigel, and transferred to a polyvinylidene difluoride membrane (Millipore, Bedford, MA). Membranes were incubated with primary (4 C, overnight) and horseradish peroxidase-labeled secondary (1 h at room temperature) antibodies (Table 2). The signal was developed with ECL-Plus (GE Healthcare, Little Chalfont, UK) and images were obtained using a VersaDoc System (Bio-Rad Laboratories). Data are expressed as the ratio between the band intensity of the protein of interest and the loading control protein (b-actin).

Quantitative Chromatin Immunoprecipitation (qChIP) MatInspector (Genomatix) and Match 1.0 (Biobase) were used to identify putative PPAR-c consensus sequences in the 5000 bp region upstream of the transcription start site of CD200R1 and CD200 mouse genes. Results from the two software programs were analyzed and overlapped to select the predicted target boxes. qChIP was performed as previously described (Dentesano et al. 2012). One 75 cm2 flask of mixed glial cultures was considered per experimental condition. For chromatin immunoprecipitation, 4 lg of polyclonal rabbit anti-PPAR-c antibody (Santa Cruz Biotechnology) or rabbit IgG (negative control) (Santa Cruz Biotechnology) were used. The sequences for each amplified locus and the primers used are shown in Table 1. Samples were run for 45 cycles (95 C for 30 s, 62 C for 1 min, and 72 C for 30 s). For details regarding the data analysis, see the section on quantitative qRT-PCR.

Cell Viability Tests Cell viability in microglial, mixed glial, and neuronal cultures was estimated by measuring the reduction of cellular 3-(4,5-dimethyl thiazol-2-y1)22,5-diphenyl tetrazolium bromide (MTT) 24 h after LPS/IFN-c treatment, in the absence and in the presence of 15dPGJ2. Briefly, MTT was added during the final 30, 60, or 90 min (mixed glial, neuronal, and microglial cultures, respectively) of incubation. The medium was then removed and 100 lL of DMSO was added to each well to dissolve the dark blue crystals formed. Optical density at 560 nm was determined using a microplate reader (Multiskan Spectrum; Thermo Electron Corporation, Waltham, CA). Neuronal viability in neuron-microglia cocultures was evaluated by a microtubule-associated protein 2 (MAP2)-ELISA assay as previously described (Gresa-Arribas et al., 2010). Briefly, MAP2 immunostaining was performed using peroxidase labeling with the antibodies shown in Table 2. Colour was developed with the ABTS Peroxidase Substrate Kit (Vector) following the manufacturer’s instructions and absorbance was read at 405 nm. Neuronal viability was expressed as a percentage of control levels. In some wells colour was developed with diaminobenzidine to obtain an image of MAP2 immunostaining.

Volume 00, No. 00

Dentesano et al.: PPAR-g Modulation of CD200R1-CD200 Expression

TABLE 2: Antibodies Used in Western Blot Assays and Immunocytochemistry

Primary antibody

Species

Company

Dilution

Secondary antibody

Dilution

Company

b-Actin

Mouse

Sigma-Aldrich

1/50,000

Goat anti-mouse HRP

1/5,000

Santa Cruz Biotechnology

CD200

Goat

R&D

1/1000

Mouse anti-goat HRP

1/5,000

Sigma-Aldrich

CD200R1

Goat

Santa Cruz Biotechnology

1/500

Mouse anti-goat HRP

1/5,000

Sigma-Aldrich

COX-2

Rabbit

Santa Cruz Biotechnology

1/1,000

Donkey anti-rabbit HRP

1/5,000

GE Healthcare

gp91phox

Mouse

BD Biosciences

1/1,000

Goat anti-mouse HRP

1/5,000

Santa Cruz Biotechnology

iNOS

Rabbit

BD Biosciences

1/300

Donkey anti-rabbit HRP

1/5,000

GE Healthcare

Western blot

Immunocytochemistry CD11b

Rat

AbD Serotec

1/200

Alexa 594 donkey anti-rat

1/1,000

Invitrogen

CD68

Rat

AbD Serotec

1/1000

Alexa 546 goat anti-rat

1/1,000

Invitrogen

CD200

Goat

R&D

1/50

Alexa 488 donkey anti-goat

1/1,000

Invitrogen

CD200R1

Goat

R&D

1/50

Alexa 546 donkey anti-goat Alexa 488 donkey anti-goat

1/1,000 1/1,000

Invitrogen Invitrogen

EAAT1

Rabbit

Abcam

1/500

Alexa 546 donkey anti rabbit

1/1,000

Invitrogen

GFAP

Rabbit

DAKO

1/1,000

Alexa 546 donkey anti rabbit

1/1,000

Invitrogen

MAP2

Mouse

Sigma-Aldrich

1=4,000

Alexa 488 donkey anti-mouse

1/1,000

Invitrogen

NG2

Rabbit

Sanford-Burnham Medical Research Institute*

1/500

Biotinilated horse anti-mouse Alexa 546 donkey anti rabbit

1/200 1/1,000

Vector Invitrogen

PPAR-c

Mouse

Santa Cruz Biotechnology

1/15

Alexa 488 goat anti-mouse

1/1,000

Invitrogen

S100

Rabbit

DAKO

1/1,000

Alexa 546 donkey anti rabbit

1/1,000

Invitrogen

COX-2: cyclooxygenase 2; EAAT1: excitatory aminoacid transporter 1; GFAP: glial fibrillary acidic protein; gp91phox: NADPH oxidase NOX2; HRP: horseradish peroxidase; iNOS: inducible NO synthase; MAP-2: microtubule-associated protein 2; NG2: chondroitin sulfate proteoglycan; PPAR-c: peroxisome proliferator-activated receptor c. *Gift from Dr. W. B. Stallcup (Sanford-Burnham Medical Research Institute, La Jolla, CA).

Data Presentation and Statistical Analysis The results are presented as the mean 1 SEM values. Statistical analyses were performed using one-way analysis of variance (ANOVA) followed by the Bonferroni post-test when three or more experimental groups were compared or by the Dunnett’s post-test when individual data groups were compared with the control group. Values of P < 0.05 were considered statistically significant.

Results CD200R1 Expression Inhibition Induced by Pro-inflammatory Stimuli is Prevented by 15d-PGJ2 Using primary microglial cell cultures, we studied whether the anti-inflammatory effect attributed to the PPAR-c endogMonth 2014

enous ligand 15d-PGJ2 occurred in the presence of modifications in the expression of the inhibitory immune receptor CD200R1. In preliminary experiments, we treated microglial cultures with different concentrations of 15d-PGJ2 (ranging from 1 to 10 lM). We selected 1 lM as the working concentration to be used, because it already significantly inhibited the pro-inflammatory effect of LPS/IFN-c in microglial cells, considering NO production as an indicator of proinflammatory activation (Fig. 1A). 15d-PGJ2 did not modify microglial cell viability at any of the concentrations tested, as estimated by the MTT reduction assay (see Supporting Information 1). The anti-inflammatory properties of 1 lM 15d-

5

PGJ2 in microglia were further confirmed by evaluation of the effect of the PPAR-c agonist on the expression of genes involved in the production of pro-inflammatory molecules in LPS/IFN-c-treated cells, such as the enzymes iNOS, COX2, and gp91phox and the cytokines IL-1b, IL-6, and TNF-a. iNOS, COX2, and gp91phox mRNA expression were clearly induced in LPS/IFN-c-treated microglial cells. This effect was inhibited by 15d-PGJ2 pretreatment (Fig. 1B–D). IL-1b, IL6, and TNF-a mRNA expression were also clearly induced in LPS/IFN-c-treated microglial cells, and this effect was significantly inhibited by 15d-PGJ2 pretreatment (Fig. 1E–G), with the only exception of TNF-a. In a previous study, we showed that CD200R1 mRNA expression was lower in microglial cells in response to LPS (Dentesano et al., 2012). Here, we confirmed that this decrease was also observed in LPS/IFN-c-treated microglial cells, and we then determined the effect of 15d-PGJ2 on CD200R1 mRNA expression in the absence and presence of LPS/IFN-c. A significant decrease in CD200R1 expression was observed in microglial cell cultures 6 h after LPS/IFN-ctreatment (Fig. 2A). 15d-PGJ2 (1 lM) did not modify microglial CD200R1 mRNA basal levels, but 15d-PGJ2 pretreatment (1 h) inhibited the LPS/IFN-c-induced decrease. These effects were confirmed at protein level. Immunocytochemical localization of CD200R1 in primary microglial cell cultures showed CD200R1 expression in basal conditions, which colocalized with the microglial cell surface marker CD11b, and decreased expression 24 h after LPS/IFN-c treatment (Fig. 2B); 15d-PGJ2 pretreatment abrogated the decrease induced by LPS/IFN-c. Similar results were obtained by Western blot (Fig. 2C). PPAR-c Antagonists Inhibit the Effect of 15d-PGJ2 on CD200R1 Expression It has been postulated that the anti-inflammatory effect of PPAR-c agonists can be explained by mechanisms other than their action on PPAR-c. We used the PPAR-c antagonists GW9662 and BADGE to determine the involvement of PPAR-c in the effect of 15d-PGJ2 on microglial CD200R1 expression. Using qRT-PCR, we observed that both GW9662 and BADGE antagonized the effect of 15d-PGJ2 at the level of CD200R1 expression in LPS/IFN-c-treated microglial cultures (Fig. 2D). In preliminary experiments, we observed that GW9662 and BADGE had no effect on CD200R1 mRNA expression, both alone and in the presence of LPS/IFN-c treatment (see Supporting Information 2). PPAR-c Expression in Reactive Microglia: Effect of 15d-PGJ2 As LPS/IFN-c treatment decreased CD200R1 expression in microglial cells and 15d-PGJ2 pretreatment abrogated this 6

FIGURE 1: Anti-inflammatory properties of 15d-PGJ2 in primary microglial cultures. Effect of 15d-PGJ2 on NO production (A), iNOS (B), COX-2 (C), gp91phox (D), IL-1b (E), Il-6 (F), and TNF-a (G) mRNA expression in LPS/IFN-c(L/I)-treated cultures. NO production was determined 48 h after L/I treatment. mRNA expression was evaluated 6 h after L/I treatment. When indicated, cultures were pretreated with 15d-PGJ2 (1 lM for 1 h). Bars are means 6 SEM of three independent experiments. *P < 0.05, ** P < 0.01, and *** P < 0.001 vs. C; # P < 0.05 and ## P < 0.001 versus L/I; one-way ANOVA (repeated measures) and Bonferroni post-test.

effect through PPAR-c, we studied possible changes of PPARc expression in our experimental conditions. PPAR-c mRNA expression was determined in primary microglial cultures by qRT-PCR (Fig. 3A). Microglial cultures showed basal PPAR-c mRNA expression, and the expression was significantly decreased 6 h after LPS/IFN-c treatment. 15d-PGJ2 did not modify PPAR-c mRNA basal levels, but 15d-PGJ2 pretreatment reversed the LPS/IFN-c-induced decrease. These effects were confirmed at protein expression level by immunocytochemistry (Fig. 3B). Control cells showed moderate and diffuse PPAR-c immunostaining in the cytoplasm and the cell Volume 00, No. 00

Dentesano et al.: PPAR-g Modulation of CD200R1-CD200 Expression

nucleus. Some cells also showed bright, dotted PPAR-c immunostaining in the cytoplasm. PPAR-c immunostaining decreased in LPS/IFN-c-treated microglial cells, as did the number of cells showing dotted PPAR-c immunostaining in the cytoplasm. 15d-PGJ2 pretreatment reversed the LPS/IFNc-induced decrease. We also determined the time-course of PPAR-c mRNA expression in microglial cells at 2, 4, 8, and 24 h of LPS/IFN-c treatment. A significant and maintained

decrease in PPAR-c mRNA expression was observed in LPS/ IFN-c-treated microglial cells between 2 and 24 h after treatment (Fig. 3C). A similar pattern of CD200R1 mRNA expression was observed in microglial cell cultures following LPS/IFN-c treatment (Fig. 3D). 15d-PGJ2 Effect on CD200 Expression In the CNS, CD200, the CD200R1 ligand, is mainly expressed in neurons. However, CD200 expression has also been reported in vivo in reactive astrocytes and in astrocytes in culture. We next studied whether 15d-PGJ2 modified CD200 expression. We first characterized CD200 expression in neuronal and mixed glial cultures by Western blot and immunocytochemistry. We observed that CD200 mRNA and protein were consistently expressed in neuron-enriched cultures, while the expression was much lower in mixed glial cultures (Fig. 4A,B). No significant CD200 expression was detected in microglial cultures (Fig. 4A,B). In neuronal cultures, in which some astrocytes were also present, strong CD200 immunolabeling was detected, which colocalized with MAP2 immunolabeling (specific neuronal marker; Fig. 4C). In mixed glial cultures, a moderately low CD200 immunolabeling was observed in all the confluent layer of astrocytes, and a strong labeling in some scattered cells (Fig. 5A, first row). Using double immunostaining, cells showing moderate immunolabeling were also GFAP and EAAT1 positive (specific astroglial markers; Fig. 5A, second and third row, respectively). Some of the cells strongly labeled with anti-CD200 were also GFAP or S100b (specific astroglial markers) positive, and some of them NG2 (oligodendrocyte precursor marker) positive (Fig. 5B). None of them were CD68 (specific microglial marker) positive cells (Fig. 5B).

FIGURE 2: Regulation of microglial CD200R1 expression by 15dPGJ2. Effect of PPAR-c antagonists. A: CD200R1 mRNA expression, (B) CD200R1 immunostaining, and (C) CD200R1 protein expression by western blot in control (C), LPS/IFN-c (L/I), 15dPGJ2, and 15d-PGJ2 1 L/I-treated cultures. C2-C4 and C5-C7 are images of control microglial cells showing CD200R1 immunostaining (green), CD11b immunostaining (red) and corresponding overlays obtained by confocal miscroscopy, showing CD200R1 and CD11b colocalization. Bar 5 25 lm (confocal images) and 100 lm. A representative western blot image is shown. D: CD200R1 mRNA expression in C, L/I, and 15d-PGJ2 1 L/I-treated cultures, in the absence and in the presence of PPAR-c antagonists GW9662 or BADGE. mRNA expression was evaluated 6 h after L/I treatment and CD200R1 protein (immunostaining and western blot) 24 h after L/I treatment. When indicated, cultures were pretreated with 15d-PGJ2 (1 lM for 1 h) and PPAR-c antagonists (1 lM) were added to the culture media 30 min prior to 15d-PGJ2 treatment. Bars are means 6 SEM of three-four independent experiments. *P < 0.05 and *** P < 0.001 versus C; # P < 0.05 and ### P < 0.001 versus L/I; && P < 0.01 versus 15dPGJ2 1 L/I; one-way ANOVA (repeated measures) and Bonferroni post-test. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

Month 2014

7

CD200 protein expression was not modified in neuronenriched cultures treated with LPS/IFN-c, in either the presence or absence of 15d-PGJ2 pretreatment (Fig. 6A). However, CD200 mRNA and protein expression were increased in primary mixed glial cultures in response to LPS/IFN-c treatment, and this effect was prevented by 15d-PGJ2 pretreatment (Fig. 6B,C). 15d-PGJ2 did not modify cell viability in mixed glial

and in neuronal cultures at any of the concentrations tested, as estimated by the MTT reduction assay (see Supporting Information 1). The PPAR-c antagonists GW9662 and BADGE totally inhibited the effect of 15d-PGJ2 on CD200 expression (Fig. 6B). In preliminary experiments, we observed that GW9662 and BADGE had no effect on CD200 mRNA expression, both alone and in the presence of LPS/IFN-c treatment (see Supporting Information 2). PPAR-c mRNA expression was significantly inhibited in LPS/IFN-c-treated cultures. This effect was attenuated in the presence of 15d-PGJ2 pretreatment (Fig. 6D). The modulation of CD200 expression by 15d-PGJ2 in LPS/IFN-c-treated mixed glial cultures was associated with inhibition of the expression of proteins involved in the pro-inflammatory response, such as iNOS (Fig. 7A), COX2 (Fig. 7B), and gp91phox (Fig. 7C), as well as IL-1b (Fig. 7D), IL-6 mRNA (Fig. 7E) and TNF-a (Fig. 7F). PPAR-c Binding to CD200R1 and CD200 Promoters Using mixed glial cultures, we next studied whether 15dPGJ2 regulation of CD200R1 expression in microglial cells and CD200 expression in astrocytes was due to the direct interaction of PPAR-c with DNA binding sites in the gene promoters. We analyzed the 5,000 bp regions upstream from the transcription start sites of CD200R1 and CD200 genes using Match-1.0 (public version, BioBase) and MatInspector (Genomatix) bioinformatic software, to look for putative PPAR-c binding sites. Three putative binding sites were identified in the CD200R1 promoter (herein referred to as box 1–3), and 2 putative binding sites were identified in the CD200 promoter (herein referred to as box 10 and 20 ), the positions and sequences of which are indicated in Table 1. We then investigated whether PPAR-c could bind to these sites in a qChIP assay using primary mixed glial cultures. In untreated primary mixed glial cultures, we observed significant binding of PPAR-c in box 3 of the CD200R1 promoter, but no binding in box 1 and 2 (Fig. 8A–C). LPS/IFN-c treatment significantly inhibited PPAR-c binding to box 3 (Fig. FIGURE 3: PPAR-c expression in reactive microglial cells: effect of 15d-PGJ2. A: PPAR-c mRNA expression in control (C), LPS/ IFN-c (L/I), and 15d-PGJ2 1 L/I microglia treated cultures. mRNA expression was evaluated 6 h after L/I treatment. When indicated, cultures were pretreated with 15d-PGJ2 (1 lM for 1 h). Bars are means 6 SEM of three independent experiments. ** P < 0.01 versus C; ## P < 0.01 versus L/I; one-way ANOVA (repeated measures) and Bonferroni post-test. B: PPAR-c immunostaining in microglial cultures 24 h after L/I treatment. When indicated, cultures were pretreated with 15d-PGJ2 (1 lM for 1 h). Bar 5 100 lm. Time course of PPAR-c (C) and CD200R1 (D) mRNA expression in primary microglial cells after L/I-treatment. Bars are means 6 SEM of four independent experiments. * P < 0.05 and ** P < 0.01 versus C; one-way ANOVA (repeated measures) and Dunnett’s post-test. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

8

Volume 00, No. 00

Dentesano et al.: PPAR-g Modulation of CD200R1-CD200 Expression

FIGURE 4: Comparative expression of CD200 in neurons and astrocytes. A: CD200 mRNA and (B) protein expression in control neuronal cultures (N), mixed glial cultures (MG), and microglial cultures (M). A representative western blot image is shown. Bars are means 6 SEM of three independent experiments. * P < 0.05 and *** P < 0.001 versus neuronal cultures; # P < 0.05 versus mixed glial cultures; one-way ANOVA and Bonferroni post-test. (C) CD200 protein expression localization in neuronal cultures by immunocytochemistry. Anti-CD200 colocalizes with anti-MAP-2, but not with anti-GFAP immunolabeling. Bar 5 50 lm. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

8C). While 15d-PGJ2 treatment significantly increased PPAR-c binding to box 1 (Fig. 8A), 15d-PGJ2 pretreatment did not have any effect on the inhibition of PPAR-c binding induced by LPS/IFN-c treatment in box 3 (Fig. 8C). In addition, PPAR-c binding to box 10 of the CD200 promoter, but not to box 20 , was detected in untreated cultures. The effect was inhibited in LPS/IFN-c-treated cultures (Fig. 8D–E). 15d-PGJ2 treatment decreased PPAR-c binding to box 10 but increased PPAR-c binding to box 20 , but it did not have any effect on the inhibition of PPAR-c binding induced by LPS/IFN-c treatment in box 10 (Fig. 8D). 15d-PGJ2 Protects Against Neurotoxicity Induced by Reactive Microglia in Neuron-Microglia Cocultures: Role of CD200-CD200R1 We also studied whether 15d-PGJ2 treatment resulted in neuroprotection in an in vitro experimental model of neuroinflammmation, using neuron-microglia cocultures in which Month 2014

neuronal death was induced by microglia activation with LPS/IFN-c. Neuron-microglia cocultures treated for 48 h with LPS/IFN-c showed clear alterations of the neuronal network as observed by MAP2 immunostaining. This effect was inhibited by 15d-PGJ2 pretreatment (Fig. 9A). Neuronal viability estimated with the MAP2-ABTS-ELISA assay showed a significant decrease in LPS/IFN-c-treated cocultures, while 15d-PGJ2 pretreatment provided significant protection against neurotoxicity induced by LPS/IFN-c (Fig. 9B). We used an anti-CD200R1-blocking antibody to elucidate whether CD200-CD200R1 interaction played a role in the neuroprotective action of 15d-PGJ2 against LPS/IFN-cinduced neuronal death. Pretreatment of neuron-microglia cocultures with 0.1 lg/mL of the blocking antibody inhibited the protective action of 15d-PGJ2 against the neurotoxicity induced by LPS/IFN-c. This effect was not observed with control isotype pretreatment at the same concentration (Fig. 9A,B).

9

FIGURE 5: CD200 in mixed glial cultures. A: CD200 protein expression localization in mixed glial cultures by immunocytochemistry. Both a moderate labeling of the cellular network and a strong labeling of some scattered cells are observed (first row of images). The moderate anti-CD200 immunolabeling in the cellular network colocalizes with anti-GFAP and anti-EAAT1 positive cells (second and third row of images, respectively). Arrowheads encircle cells showing GFAP immunostaining surrounded by CD200 immunostaining. CD200 and EAAT1 labeling show similar images. Bar 5 100 lm. B: Some of the cells showing high anti-CD200 immunolabeling are anti-GFAP or anti-S100b positive (astroglial markers), others are NG2 positive (oligodendrocyte/astrocyte precursor marker), but none of them are anti-CD68 positive (microglial marker). Arrowheads point out individual cells showing double immunolabeling. Nuclei are labeled with Hoechst in merge images. Bar 5 50 lm. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

We also determined NO production in the cocultures as an index of microglial activation (Fig. 9C). LPS/IFN-c-treatment induced NO production in neuron-microglia cocultures. This effect was partially inhibited by 15d-PGJ2 pretreatment. Pretreatment with anti-CD200R1-blocking antibody, but not with the corresponding isotype, abrogated the effect of 15d-PGJ2.

Discussion We report that expression of the inhibitory immune receptor CD200R1 and its ligand CD200 are modulated by the 10

PPAR-c agonist 15d-PGJ2 in activated glial cells. CD200R1 expression is basally observed in microglial cells and inhibited in response to LPS/IFN-c, and 15d-PGJ2 abrogates this inhibition. CD200 is constitutively expressed mainly in neurons, and to a lesser extent in astrocytes. LPS/IFN-c increases CD200 expression in astrocytes, not in neurons, and this is inhibited by 15d-PGJ2. These effects of 15d-PGJ2 are due to its interaction with PPAR-c, because they are inhibited by PPAR-c antagonists. Our results suggest that PPAR-c binding to CD200R1 and CD200 gene promoters occurs under basal conditions in microglial and astroglial cells respectively, and is Volume 00, No. 00

Dentesano et al.: PPAR-g Modulation of CD200R1-CD200 Expression

FIGURE 6: Effect of 15d-PGJ2 on the regulation of CD200 expression in LPS/IFN-c-treated cultures. A: CD200 protein expression in neuron-enriched cultures; effect of LPS/IFN-c in the absence and presence of 15d-PGJ2 pretreatment (1, 2, 5, and 10 lM). Image of a representative western blot. B: CD200 mRNA by qRT-PCR in control (C), LPS/IFN-c (L/I), and 15d-PGJ2 1 L/I-treated mixed glial cultures, in the absence and presence of the PPAR-c antagonists GW9662 or BADGE. When indicated, cultures were pretreated with 15d-PGJ2 (1 lM for 1 h) and PPAR-c antagonists (1 lM) were added to the culture media 30 min prior to 15d-PGJ2 treatment. C: CD200 protein expression in mixed glial cultures; effect of L/I with the absence and presence of 15d-PGJ2 pretreatment (1, 2, 5, and 10 lM). Image of a representative Western blot. D: PPAR-c mRNA expression by qRT-PCR in control (C), LPS/IFN-c (L/I), and 15d-PGJ2 1 L/I mixed glial cultures. When indicated, cultures were pretreated with 15d-PGJ2 (1 lM for 1 h). Bars are means 6 SEM of three independent experiments. Protein expression was determined 24 h after L/I treatment and mRNA expression 6 h after L/I treatment. **P < 0.01 and *** P < 0.001 versus C; # P < 0.05 and ## P < 0.01 versus L/I; & P < 0.05 versus 15d-PGJ2 1 L/I; one-way ANOVA (repeated measures) and Bonferroni post-test.

inhibited by LPS/IFN-c treatment. However, although 15dPGJ2 increases PPAR-c binding to both CD200R1 and CD200 gene promoters, 15d-PGJ2 pretreatment does not prevent the LPS/IFN-c-induced decrease in PPAR-c binding, which suggests that PPAR-c has an indirect effect on CD200R1 and CD200 gene expression. Pretreatment with 15d-PGJ2 inhibits the expression of pro-inflammatory markers in microglia and mixed glial cultures, and has a neuroprotective effect on LPS/IFN-c-induced neurotoxicity in neuron-microglia cocultures. Interestingly, CD200-CD200R1 interaction is necessary for the neuroprotection that was observed. Month 2014

Little is known of the mechanisms that regulate CD200 and CD200R1 expression in normal brain and in response to neural damage. In a previous study, we showed that C/EBPb, a transcription factor involved in the induction of proinflammatory gene expression, negatively regulates CD200R1 expression in reactive microglia in vitro (Dentesano et al., 2012). We now show that PPAR-c, a transcription factor involved in the inhibition of pro-inflammatory gene expression, regulates CD200 and CD200R1 expression. Consequently, mechanisms both positively and negatively involved in the control of the pro-inflammatory response in reactive glia are able to regulate the expression of CD200 and/or 11

FIGURE 7: Effect of 15d-PGJ2 pretreatment on the expression of pro-inflammatory enzymes and cytokines in LPS/IFN-c-treated mixed glial cultures. A: iNOS, (B) COX-2, and (C) gp91phox protein expression, as well as IL-1b (D), IL-6 (E), and TNF-a (F) mRNA expression in mixed glial cultures; effect of LPS/IFN-c (L/I) in the absence and presence of 15d-PGJ2 pretreatment. Protein expression was evaluated 24 h after L/I treatment and mRNA expression 6 h after L/I treatment. When indicated, cultures were pretreated with 15d-PGJ2 (1 h) at different concentrations (protein determinations) or at 1 lM (mRNA determinations). Bars are means 6 SEM of three independent experiments. The images show representative western blots. *P < 0.05, ** P < 0.01, and *** P < 0.001 versus C; # P < 0.05, ## P < 0.01, and ### P < 0.001 versus L/I; one-way ANOVA (repeated measures) and Bonferroni post-test.

CD200R1. Positive regulation of murine neuronal CD200 expression by the anti-inflammatory cytokines IL-4 and IL-10 has also been described (Hernangomez et al., 2012; Lyons et al., 2007). In addition, IL-4 and IL-13 positively regulate the expression of CD200R1 in human microglia and macrophages (Walker et al., 2009), but not in mouse macrophages (Koning et al., 2010). CD200R1 stimulation results in the inhibition of the pro-inflammatory phenotype in microglial cells (Cox et al., 2012; Hernangomez et al., 2012; Liu et al., 2010; Lyons et al., 2012) and the inhibition of CD200R1 function potentiates it (Lyons et al., 2007; Wang et al., 2011; Zhang et al., 2011), suggesting that CD200-CD200R1 interaction is involved in the suppression of the pro-inflammatory phenotype in microglia. We show that LPS/IFN-c treatment results in a rapid and maintained inhibition of CD200R1 expression in microglial cells, an effect that might facilitate their proinflammatory response. CD200 expression in mixed glial cultures is also modulated by LPS/IFN-c. Neurons are the main 12

cell type that expresses CD200 in the CNS. However, CD200 expression has also been reported in reactive astrocytes in the brain of Alzheimer’s disease (Walker et al., 2009) or multiple sclerosis (Koning et al., 2009) patients, as well as in murine astrocyte cultures by flow cytometry and western blot (Costello et al., 2011; Lyons et al., 2012). In this study, we detect CD200 expression in mixed glial cultures and we localize this expression mainly in astrocytes by immunocytochemistry, although some NG2 positive oligodendrocyte precursor cells also express CD200. Opposite to its effect on microglial CD200R1 expression, LPS/IFN-c increased CD200 expression in mixed glial cultures, but not in neuronal cultures. This increase in reactive mixed glial cultures could be interpreted as an unsuccessful compensatory response to recover CD200-CD200R1 function alteration, due to decreased expression of the receptor. We show that 15d-PGJ2 prevents LPS/IFN-c-induced changes in CD200R1 and CD200 expression in glial cells, suggesting that the antiinflammatory action of this compound could be mediated, at Volume 00, No. 00

Dentesano et al.: PPAR-g Modulation of CD200R1-CD200 Expression

FIGURE 8: PPAR-c binding to CD200R1 and CD200 gene promoters in glial cells. Analysis of PPAR-c binding to box 1 (A), box 2 (B), and box 3 (C) putative binding sites of CD200R1 gene promoter and to box 10 (D) and box 20 (E) putative binding sites of CD200 gene promoter in control (C), and LPS/IFN-c (L/I), 15d-PGJ2 and 15d-PGJ2 1 L/I-treated mixed glial cultures by qChIP. Chromatin immunoprecipitation was performed 6 h after L/I treatment. When indicated, cultures were pretreated with 15d-PGJ2 (1 lM for 1 h). Rabbit IgG was used as a negative control. Bars are means 1 SEM of three independent experiments. **P < 0.01 versus IgG; ## P < 0.01 and ### P < 0.001 versus C; && P < 0.01 versus L/I. One-way ANOVA and Bonferroni post-test.

least in part, by the recovery of normal levels and function of CD200-CD200R1. We observed that the effects of 15d-PGJ2 pretreatment on CD200R1 and CD200 expression are accompanied by the inhibition of the LPS/IFN-c-induced expression of proinflammatory enzymes and cytokines both in microglial and mixed glial cultures. Various authors report the antiinflammatory effects of the synthetic PPAR-c agonists thiazolidinediones, and specifically the endogenous PPAR-c ligand 15d-PGJ2 in activated primary microglial and astroglial cells in vitro, such as inhibition of NO and pro-inflammatory cytokines and chemokines production, and inhibition of iNOS expression (Bernardo et al., 2000; Giri et al., 2004; Gurley et al., 2008; Storer et al., 2005; Xu and Drew, 2007). Although the inhibition of COX-2 expression by 15d-PGJ2 has been reported using the microglial cell line BV2 (Koppal et al., 2000) and reactive astrocytes (Janabi et al., 2002), we show the inhibition of COX-2 in primary microglial cells. In addition, to our knowledge this is the first report of 15dPGJ2 inhibition of gp91phox expression in reactive glial cells. The anti-inflammatory action of PPAR-c in activated glial cells may be mainly due to inhibition of the expression of inflammatory-response genes (Drew et al., 2006). HowMonth 2014

ever, PPAR-c regulation of gene expression involves both transcriptional activation and repression (Ricote and Glass, 2007). It has been proposed that transcriptional regulation by ligand-activated PPAR-c is the result of direct interaction with specific binding sites in the promoters of target genes, the PPAR response elements. Nevertheless, both ligandindependent and PPAR response element-independent transrepression have also been postulated (Ricote and Glass, 2007). In addition, despite the agonistic properties of thiazolidinediones and 15d-PGJ2 at the level of PPAR-c, these compounds also have PPAR-c-independent anti-inflammatory actions. Thus, their anti-inflammatory effect has been described in PPAR-c-deficient cells (Phulwani et al., 2006; Welch et al., 2003) as well as in the presence of PPAR-c antagonists (Giri et al., 2004; Kim et al., 2012). Additional targets suggested for the anti-inflammatory action of synthetic PPAR-c agonists and 15d-PGJ2 are the inhibition of NF-jB function (Giri et al., 2004; Janabi et al., 2002; Petrova et al., 1999), inhibition of the PI3K/Akt pathway (Giri et al., 2004), suppression of ERK1/2 activation (Kim et al., 2012), induction of MAPK phosphatase-1 activity (Lee et al., 2008) or induction of the suppressor of cytokine signalling 1 and 3 (Park et al., 2003). We show that the effect of 15d-PGJ2 on 13

CD200R1 and CD200 expression in reactive glial cells is mainly mediated by its interaction with PPAR-c because it is abrogated by the PPAR-c antagonists GW9662 and BADGE, which act on the ligand-binding domain of PPAR-c and pre-

vent ligand-dependent activation of the nuclear receptor (Leesnitzer et al., 2002; Wright et al., 2000a). With the qChIP experiments, we show that PPAR-c is involved in the regulation of CD200R1 and CD200 expression through direct binding to their promoters both basally and in response to LPS/IFN-c. As regards CD200R1 gene expression, PPAR-c binds to a PPAR response element in box 3 of the CD200R1 promoter in basal conditions, which suggests that PPAR-c plays a role in the basal expression of this gene. In addition, this binding is inhibited by LPS/IFN-c, which could mediate the inhibition of CD200R1 expression observed in this condition. This effect could be due to the decrease in PPAR-c expression that we detected in LPS/IFNc-treated microglial cells. However, although 15d-PGJ2 induces an increase in PPAR-c binding to box 1 of the CD200R1 promoter, it does not modify CD200R1 expression per se. These results and the fact that several of the PPAR-c binding sites analyzed do not show the same pattern of response suggest that each site has a different relevance to the regulation of CD200R1 expression by PPAR-c. Moreover, 15d-PGJ2 pretreatment does not abrogate the decrease in PPAR-c binding to the CD200R1 gene promoter observed after LPS/IFNc treatment, although it is able to inhibit the decrease in PPAR-c and CD200R1 expression induced by LPS/IFN-c. Together, these results suggest that PPAR-c participates in control of the gene expression of CD200R1 in microglia both in basal conditions and in response to a proinflammatory stimulus, but that indirect effects of PPAR-c on

FIGURE 9: Neuroprotective action of 15d-PGJ2 pretreatment in neuronal-microglial cocultures treated with LPS/IFN-c. Involvement of CD200R1. A: MAP2 immunocytochemistry in control (C), LPS/IFN-c (L/I), and 15d-PGJ2 1 L/I-treated cocultures, the latter in the absence and presence of CD200R1 blocking antibody (BAb) or its corresponding isotype (Iso). MAP2 positive neuronal processes are abundant in control and 15d-PGJ2 1 L/I-treated cocultures, but dramatically decreased in L/I-treated cocultures, which is taken as an index of neuronal damage/death. Bar 5 100 lm. B: Evaluation of neuronal viability by MAP2-ABTS-ELISA assay. 15d-PGJ2 pretreatment significantly prevents L/I-induced neurotoxicity. This neuroprotective effect is inhibited on the presence of anti-CD200R1 blocking antibody (BAb); the corresponding isotype (Iso) has no effect on L/I-induced neurotoxicity. Results are presented as % of MAP2 immunostaining in control cultures. MAP2 immunostaining was performed 48 h after L/I treatment. When indicated, cultures were pretreated with 15dPGJ2 (1 lM for 1 h) and CD200R1 blocking antibody (BAb, 0.1 lg/mL) or the corresponding isotope (Iso, 0.1 lg/mL), added to the culture media 30 min prior to 15d-PGJ2 treatment. C: Nitric oxide (NO) production in the cocultures. Bars are means 6 SEM of three independent experiments. *P < 0.05 and *** P < 0.001 versus C; # P < 0.05, ## P < 0.01 and ### P < 0.001 versus L/I; & P < 0.05 and &&& P < 0.001 versus 15d-PGJ2 1 L/I; one-way ANOVA (repeated measures) and Bonferroni post-test. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

14

Volume 00, No. 00

Dentesano et al.: PPAR-g Modulation of CD200R1-CD200 Expression

CD200R1 gene expression cannot be discarded. As regards CD200 gene expression, PPAR-c binds to a PPAR response element in box 10 of the CD200 gene promoter in basal conditions, which suggests that this transcription factor is involved in the control of the basal expression of this gene in astrocytes. However, although LPS/IFN-c treatment induces an increase in CD200 expression, the binding is inhibited in LPS/IFN-c-treated mixed glial cultures, in which a decrease in PPAR-c expression is also observed. 15d-PGJ2 induces an increase in PPAR-c binding to box 20 of the CD200 gene promoter, but CD200 expression is not modified. In addition, 15d-PGJ2 pretreatment does not abrogate LPS/IFN-cinduced PPAR-c binding inhibition, but avoids an LPS/IFNc-induced increase in CD200 expression. All these results suggest that although PPAR-c activation can modify CD200 expression in reactive astrocytes, additional mechanisms apart from PPAR-c binding to its specific DNA binding site are involved in the observed effect. Several in vitro studies describe the neuroprotective properties of the synthetic PPAR-c agonists thiazolidinediones (Fuenzalida et al., 2007; Luna-Medina et al., 2005; Xing et al., 2008), which can be attributed to both an antiinflammatory effect and a direct antiapoptotic effect on neuronal viability. Neuroprotective effects of thiazolidinediones in experimental animal models of ischemia (Patzer et al., 2008; Tureyen et al., 2007) and neurodegenerative diseases (Carta et al., 2011; Diab et al., 2004; Heneka et al., 2005; Natarajan and Bright, 2002, Schintu et al., 2009; Sch€ utz et al., 2005) have also been described. These studies have conducted to consider PPAR-c agonists as candidate drugs in clinical assays for the treatment of neurodegenerative diseases. We show that 15d-PGJ2 pretreatment results in a clear neuroprotective effect in LPS/IFN-c-treated neuron-microglia cocultures. We have previously reported the critical role of NO production by reactive microglial cells in the induction of neurotoxicity in this experimental model of neuroinflammation (Gresa-Arribas et al., 2012). Consequently, 15d-PGJ2 pretreatment inhibition of NO production in LPS/IFN-c-treated neuronmicroglia cocultures probably plays a role in the neuroprotective effect observed. Interestingly, 15d-PGJ2 neuroprotection is dependent on CD200-CD200R1 interaction, because it is abolished by an anti-CD200R1 blocking antibody. The blocking antibody also suppresses the 15d-PGJ2-induced inhibition of NO production in LPS/IFN-c-treated cocultures. These results suggest that CD200-CD200R1 interaction plays a role in the neuroprotective action of 15d-PGJ2. In summary, we show that the PPAR-c agonist 15dPGJ2 regulates CD200 and CD200R1 expression and inhibits the pro-inflammatory response in reactive glial cells. 15dPGJ2 also abrogates reactive microglia induced neurotoxicity, which is dependent on CD200-CD200R1 interaction. These Month 2014

results suggest that CD200-CD200R1 interaction is involved in the anti-inflammatory and neuroprotective action of PPAR-c agonists. In addition, they point out astrocytemicroglia communication through CD200-CD200R1 as an additional target to take into account in the development of therapeutic strategies to reduce neuroinflammation in neurodegenerative diseases.

Acknowledgment Grant sponsor: La Marato de TV3; Grant number: 110530; Grant sponsor: Instituto de Salud Carlos III, Spain-FEDER funds, European Union; Grant number: PI10/378 and PI12/ 00709. The authors thank Dr. W. B. Stallcup (Sanford-Burnham Medical Research Institute, La Jolla, California, USA) for anti NG2 antibody. The authors also thank Unai Perpi~ na for technical assistance, and Anna Bosch (Confocal Microscopy Unit - Scientific and Technical Services - University of Barcelona) for her technical assistance in the confocal microscopy experiments. GD and TV are recipients of JAE-CSIC-FSE and IDIBAPS contracts respectively.

References Bernardo A, Levi G, Minguetti L. 2000. Role of the peroxisome proiferatoractivated receptor-c (PPAR-c) and its natural ligand 15-deoxy-D12,14-prostaglandin J2 in the regulation of microglial functions. Eur J Neurosci 12:2215– 2223. Block ML, Zecca L, Hong JH. 2007. Microglia-mediated neurotoxicity: Uncovering the molecular mechanisms. Nature Rev 8:57–69. Broderick C, Hoek RM, Forrester JV, Liversidge J, Sedgwick JD, Dick AD. 2002. Constitutive retinal CD200 expression regulates resident microglia and activation state of inflammatory cells during experimental autoimmune uveoretinitis. Am J Pathol 161:1669–1677. Carta AR, Frau L, Pisanu A, Wardas J, Spiga S, Carboni E. 2011. Rosiglitazone decreases peroxisome-proliferator receptor-gamma levels in microglia and inhibits TNF-alpha production: New evidences on neuroprotection in a progressive Parkinson’s disease model. Neuroscience 194:250–261. Chitnis T, Imitola J, Wang Y, Elyaman W, Chawla P, Sharuk M, Raddassi K, Bronson RT, Koury SJ. 2007. Elevated neuronal expression of CD200 protects Wlds mice from inflammation-mediated neurodegeneration. Am J Pathol 170: 1695–1712. Colton CA. 2009. Heterogeneity of microglial activation in the innate immune response in the brain. J Neuroimmune Pharmacol 4:399–418. Copland DA, Calder CJ, Raveney BJ, Nicholson LB, Phillips J, Cherwinski H, Jenmalm M, Sedgwick JD, Dick AD. 2007. Monoclonal antibody-mediated CD200 receptor signalling supresses macrophage activation and tissue damage in experimental autoimmune uveoretinitis. Am J Pathol 171:396–398. Costello DA, Lyons A, Denieffe S, Browne TC, Cox, FF, Lynch MA. 2011. Long term potentiation is impaired in membrane glycoprotein CD200deficient mice. J Biol Chem 286:34722–34732. Cox FF, Carney D, Miller AM, Lynch MA. 2012. CD200 fusion protein decreases microglial activation in the hippocampus of aged rats. Brain Behav Immun 26:789–796. Dentesano G, Straccia M, Ejarque-Ortiz A, Tusell JM, Serratosa J, Saura J, Sol a C. 2012. Inhibition of CD200R1 expression by C/EBPbeta in reactive microglial cells. J Neuroinflammation 9:165.

15

Diab A, Hussain RZ, Lovett-Racke AE, Chavis JA, Derw PD, Racke MK. 2004. Ligands for the peroxisome proliferator-activated receptor-c and the retinoid X receptor exert additive anti-inflammatory effects on experimental autoimmune encephalomyelitis. J Neuroimmunol 148:116–126. Drew PD, Xu J, Storer PD, Chasis JA, Racke MK. 2006. Peroxisome proliferator-activated receptor agonist regulation of glial activation: Relevance to CNS inflammatory disorders. Neurochem Int 49:183–189. Ejarque-Ortiz A, Medina MG, Tusell JM, P erez-Gonz alez AP, Serratosa J, Saura J. 2007. Upregulation of CCAAT/enhancer binding protein b in activated astrocytes and microglia. Glia 55:178–188. Fuenzalida K, Quintanilla R, Ramos P, Piderit D, Fuentealba RA, Martinez G, Inestrosa NC, Bronfman M. 2007. Peroxisome proliferator-activated receptor gamma up-regulates the Bcl-2 anti-apoptotic protein in neurons and induces mitochondrial stabilization and protection against oxidative stress and apoptosis. J Biol Chem 282:37006–37015. Giri S, Rattan R, Singh AK, Singh I. 2004. The 15-deoxy-delta12,14prostaglandin J2 inhibits the inflammatory response in primary rat astrocytes via down-regulating multiple steps in phosphatidylinositol 3-kinase-Akt-NFkappaB-p300 pathway independent of peroxisome proliferator-activated receptor gamma. J Immunol 173:5196–208. Glass CK, Saijo K, Winner B, Marchetto MC, Gage FH. 2010. Mechanisms underlying inflammation in neurodegeneration. Cell 140:918–934. Gresa-Arribas N, Serratosa J, Saura J, and Sol a C. 2010. Inhibition of CCAAT/enhancer binding protein d expression by chrysin in microglial cells results in anti-inflammatory and neuroprotective effects. J Neurochem 115: 526–536.

tem and multiple sclerosis lesions suggested neuron-glia and glia-glia interactions. J Neuropathol Exp Neurol 68:159–167. Koning N, van Eijk M, Pouwels W, Brouwer MS, Voheringer D, Huitinga I, Hoek RM, Raes G, Hamann J. 2010. Expression of the inhibitory CD200 receptor is associated with alternative macrophage activation. J Innate Immun 2:195–200. Koppal T, Petrova TV, Van Eldik LJ. 2000. Cyclopentenone prostaglandin 15deoxy-D12,14-prostaglandin J2 acts as a general inhibitor of inflammatory responses in activated BV-2 microglial cells. Brain Res 867:115–121. Lee JH, Woo JH, Woo SU, Kim KS, Park SM, Joe EH, Jou I. 2008. The 15deoxy-delta 12,14-prostaglandin J2 suppresses monocyte chemoattractant protein-1 expression in IFN-gamma-stimulated astrocytes through induction of MAPK phosphatase-1. J Immunol 181:8642–8649. Leesnitzer LM, Parks DJ, Bledsoe RK, Cobb JE, Collins JL, Consler TG, Davis RG, Hull-Ryde EA, Lenhard JM, Patel L, Plunket KD, Shenk JL, Stimmel JB, Therapontos C, Willson TM, Blanchard SG. 2002. Functional consequences of cysteine modification in the ligand binding sites of peroxisome proliferator activated receptors by GW9662. Biochemistry 41:6640– 6650. Liu Y, Bando Y, Vargas-Lowy D, Elyaman W, Khoury SJ, Huang T, Reif K, Chitnis T. 2010. CD200R1 agonist attenuates mechanisms of chronic disease in a murine model of multiple sclerosis. J Neurosci 30:2025–2038. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)). Methods 25: 402–408.

Gresa-Arribas N, Vi eitez C, Serratosa J, Saura J, Sol a C. 2012. Modelling neuroinflammation in vitro: A tool to test the potential neuroprotective effect of anti-inflammatory agents. PLos One 7:e45227.

Luna-Medina R, Cortes-Canteli M, Alonso M, Santos A, Martınez A, PerezCastillo A. 2005. Regulation of inflammatory response in neural cells in vitro by thiadiazolidinones derivatives through peroxisome proliferator-activated receptor c activation. J Biol Chem 280:21453–21462.

Gurley C, Nichols J, Liu S, Phulwani NK, Esen N, Kielian T. 2008. Microglia and astrocyte activation by toll-like receptor ligands: Modulation by PPAR-c agonists. PPAR Res 2008:453120.

Lyons A, Downer EJ, Costello DA, Murphy N, Lynch MA. 2012. Dok2 mediates the CD200Fc attenuation of Abeta-induced changes in glia. J Neuroinflammation 9:107.

Hanisch UK, Kettenmann H. 2007. Microglia: Active sensor and versatile effector cells in the normal and pathologic brain. Nature Neurosci 10:1387– 1394.

Lyons A, Downer EJ, Crotty S, Nolan YM, Mills KH, Lynch MA. 2007. CD200 ligand-receptor interaction modulates microglial activation in vivo and in vitro: A role for IL-4. J Neurosci 27:8309–8313.

Heneka MT, Sastre M, Dumitrescu-Ozimek L, Hanke A, Dewachter I, Kuiperi C, O’Banion K, Klockgether T, Van Leuven F, Landreth GE. 2005. Acute treatment with the PPARgamma agonist pioglitazone and ibuprofen reduces glial inflammation and Abeta1–42 levels in APPV717I transgenic mice. Brain 128: 1442–1453.

Meuth SG, Simon OJ, Grimm A, Melzer N, Herrmann AM, Spitzer P, Landgraf P Wiendl H. 2008. CNS inflammation and neuronal degeneration is aggravated by impaired CD200-CD200R-mediated macrophage silencing. J Neuroimmunol 194:62–69.

Hernang omez M, Mestre L, Correa FG, Lorıa F, Mecha M, I~ nigo PM, Docagne F, Williams RO, Borrell J, Guaza C. 2012. CD200-CD200R1 interaction contributes to neuroprotective effects of anandamide on experimentally induced inflammation. Glia 60:1437–1450. Hoek RM, Ruuls SR, Murphy CA, Wright GJ, Goddard R, Zurawski SM, Blom B, Homola ME, Streit WJ, Brown MH, Barclay AN, Sedgwick JD. 2000. Downregulation of the macrophage lineage through interaction with OX2 (CD200). Science 290:1768–1771. Janabi N. 2002. Selective inhibition of cyclooxygenase-2 expression by 15deoxy-Delta(12–14)-prostaglandin J(2) in activated human astrocytes, but not in human brain macrophages. J Immunol 168:4747–4755. Kapadia R, Yi JH, Vemuganti R. 2009. Mechanisms of anti-inflammatory and neuroprotective actions of PPAR-gamma agonists. Front Biosci 13:1813– 1826. Kim SE, Lee EO, Yang JH, Kang JH, Suh YH, Chong YH. 2012. 15-deoxyD12,14 -prostaglandin J2 inhibits human immunodeficiency virus-1 tat-induced monocyte chemoattractant protein-1/CCL2 production by blocking the extracellular signal-regulated kinase-1/2 signaling pathway independently of peroxisome proliferator-activated receptor-c and heme oxygenase-1 in rat hippocampal slices. J Neurosci Res 90:1732–1742.

Natarajan C, Bright JJ. 2002. Peroxisome proliferator-activated receptor-c agonists inhibit experimental allergic encephalomyelitis by blocking IL-12 production, IL-12 signaling and Th1 differentiation. Genes Immun 3: 59–70. Park EJ, Park SY, Joe E, Jou I. 2003. 15d-PGJ2 and rosiglitazone suppress janus kinase-STAT inflammatory signalling through induction of suppressor of cytokine signalling 1 (SOCS1) and SOCS3 in glia. J Biol Chem 278:14747– 14752. Patzer A, Zhao Y, St€ ock I, Gohlke P, Herdegen T, Culman J. 2008. Peroxisome proliferator-activated receptors gamma (PPARgamma) differently modulate the interleukin-6 expression in the peri-infarct cortical tissue in the acute and delayed phases of cerebral ischaemia. Eur J Neurosci 28:1786– 1794. Petrova TV, Akama KT, Van Eldik LJ. 1999. Cyclopentenone prostaglandins suppress activation of microglia: Down regulation of inducible nitric-oxide synthase by 15-deoxy-D12,14-prostaglandin J2. Proc Natl Acad Sci USA 96: 4668–4673. Phulwani NK, Feinstein DL, Gavrilyuk V, Akar C, Kielian T. 2006. 15-deoxyDelta12,14-prostaglandin J2 (15d-PGJ2) and ciglitazone modulate Staphylococcus aureus-dependent astrocyte activation primarily through a PPARgamma-independent pathway. J Neurochem 99:1389–1402.

Koning N, B€ o L, Hoek RM, Huitinga I. 2007. Downregulation of macrophage inhibitory molecules in multiple sclerosis lesions. Ann Neurol 62:504–514.

Ransohoff RM, Cardona AE. 2010. The myeloid cells of the central nervous system parenchyma. Nature 468:253–262.

Koning N, Swaab DF, Hoek RM, Huitinga I. 2009. Distribution of the immune inhibitory molecules CD200 and CD200R in the normal central nervous sys-

Ricote M, Glass CK. 2007. PPARs and molecular mechanisms of transrepression. Biochim Biophys Acta 1771:926–935.

16

Volume 00, No. 00

Dentesano et al.: PPAR-g Modulation of CD200R1-CD200 Expression Saura J, Tusell JM, Serratosa J. 2003. High-yield isolation of murine microglia by mild trypsinization. Glia 44:183–189. Schintu N, Frau L, Ibba M, Caboni P, Garau A, Carboni E, Carta AR. 2009. PPAR-gamma-mediated neuroprotection in a chronic mouse model of Parkinson’s disease. Eur J Neurosci 29:954–63. Sch€ utz B, Reimann J, Dumitrescu-Ozimek L, Kappes-Horn K, Landreth GE, Sch€ urmann B, Zimmer A, Heneka MT. 2005. The oral antidiabetic pioglitazone protects from neurodegeneration and amyotrophic lateral sclerosis-like symptoms in superoxide dismutase-G93A transgenic mice. J Neurosci 25: 7805–7812. Storer PD, Xu J, Chavis J, Drew PD. 2005. Peroxisome-proliferator-activated receptor-gamma agonists inhibit the activation of microglia and astocytes: Implications for multiple sclerosis. J Neuroimmunol 161:113–122. Tian L, Rauvala H, Gahmberg CG. 2009. Neuronal regulation of immune responses in the central nervous system. Trends Immunol 30:91–99. Tureyen K, Kapadia R, Bowen KK, Satriotomo I, Liang J, Feinstein DL, Vemuganti R. 2007. Peroxisome proliferator-activated receptor-gamma agonists induce neuroprotection following transient focal ischemia in normotensive, normoglycemic as well as hypertensive and type-2 diabetic rodents. J Neurochem 101:41–56. Walker DG, Dalsing-Hernandez JE, Campbell NA, Lue L-F. 2009. Decreased expression of CD200 and CD200 receptor in Alzheimer’s disease: A potential mechanism leading to chronic inflammation. Exp Neurol 215:5–19. Wang XJ, Ye M, Zhang YH, Chen SD. 2007. CD200-CD200R regulation of microglia activation in the pathogenesis of Parkinson’s disease. J Neuroimmune Pharmacol 2:259–264.

Month 2014

Wang XJ, Zhang S, Yan ZQ, Zhao YX, Zhou HY, Wang Y, Lu GQ, Zhang JD. 2011. Impaired CD200-CD200R-mediated microglia silencing enhances midbrain dopaminergic neurodegeneration: Roles of aging, superoxide, NADPH oxidase and p38 MAPK. Free Radic Biol Med 50:1094–1106. Welch JS, Ricote M, Akiyama TE, Gonzalez FJ, Glass CK. 2003. PPARc and PPARd negatively regulate specific subsets of lipopolysaccharide and IFN-c target genes in macrophages. Proc Natl Acad Sci USA 100:6712– 6717. Wright HM, Clish CB, Mikami T, Hauser S, Yanagi K, Hiramatsu R, Serhan CN, Spiegelman BM. 2000a. A synthetic sntagonist for the peroxisome proliferator-activated receptor c inhibits adipocyte differentiation. J Biol Chem 275:1873–1877. Wright GJ, Puklavec MJ, Willis AC, Hoek RM, Sedgwick JD, Brown MH, Barclay AM. 2000b. Lymphoid/neuronal cell surface glycoprotein recognizes a novel receptor on macrophages implicated in the control of their function. Immunity 13:233–242. Xing B, Xin T, Hunter RL, Bing G. 2008. Pioglitazone inhibition of lipopolysaccharide-induced nitric oxide synthase is associated with altered activity of p38 MAP kinase and PI3K/Akt. J Neuroinflammation 5:4. Xu J, Drew PD. 2007. Peroxisome proliferator-activated receptor-gamma agonists suppress the production of IL-12 family cytokines by activated glia. J Immunol 178:1904–1913. Zhang S, Wang XJ, Tian LP, Pan J, Lu GQ, Zhang YJ, Ding JQ, Chen SD. 2011. CD200-CD200R dysfunction exacerbates microglial activation and dopaminergic neurodegeneration in a rat model of Parkinson’s disease. J Neuroinflammation 8:154.

17

CD200R1 and CD200 expression are regulated by PPAR-γ in activated glial cells.

The mechanisms that control microglial activation are of interest, since neuroinflammation, which involves reactive microglia, may be an additional ta...
1MB Sizes 0 Downloads 3 Views