Vol. 64, No. 12

JOURNAL OF VIROLOGY, Dec. 1990, p. 6341-6344

0022-538X/90/126341-04$02.00/0 Copyright © 1990, American Society for Microbiology

CD4-Independent Infection by Human Immunodeficiency Virus Type 1 after Phenotypic Mixing with Human T-Cell Leukemia Viruses PAOLO LUSSO,* FRANCO LORI, AND ROBERT C. GALLO

Laboratory of Tumor Cell Biology, National Cancer Institute, Building 37, Room 6A09, Bethesda, Maryland 20892 Received 19 June 1990/Accepted 13 September 1990

Although human immunodeficiency virus (HIV) is the causative agent of the acquired immunodeficiency syndrome and related disorders, it has been suggested that viral cofactors may accelerate the progression of the disease. We present evidence that human T lymphoid cells productively coinfected by HIV type 1 (HIV-1) and human T-cell leukemia virus type I (HTLV-I) or HTLV-II generate a progeny of phenotypically mixed viral particles that allow the penetration of HIV-1 into previously nonsusceptible CD4- human cells, including mature CD8+ T lymphocytes, B lymphoid cells, epithelial cells, and skeletal muscle cells. The infection is independent of the major HIV-1 receptor (i.e., the CD4 glycoprotein) since OKT4a, a neutralizing anti-CD4 monoclonal antibody, fails to block the penetration of HIV-1. Similarly, infection is not inhibited by monoclonal antibody M77, directed toward the neutralizing loop of the gpl20 envelope glycoprotein of HIV-1. In contrast, pretreatment of the virus stock with HTLV-I-neutralizing human serum completely abolishes the penetration of phenotypically mixed HIV-1 into CD4- cells. These results suggest that HTLV-I or HTLV-II may increase the pathogenicity of HIV-1 by broadening the spectrum of its cellular tropism and, thus, favoring its spread within the organism of coinfected hosts.

cell, as determined by limiting dilution titration on the

It is well established that human immunodeficiency virus (HIV) is the causative agent of the acquired immunodeficiency syndrome (AIDS) and related disorders (7). However, both in vitro and in vivo observations suggest that other viruses may act as cofactors accelerating the progression of the disease. For example, several DNA viruses trans activate the long terminal repeat sequences of HIV type 1 (HIV-1) (5, 8, 17, 21, 22, 32) and thereby could reactivate latent HIV-1 infection or augment the level of virus replication in vivo. Two human retroviruses that are likely to play a role in AIDS are human T-cell leukemia virus type I (HTLV-I) (26) and HTLV-II (13), both highly prevalent in some population groups at risk for infection by HIV-1 (4, 15, 30). Epidemiological data indicate a more rapid clinical evolution toward full-blown AIDS in patients coinfected by HIV-1 and HTLV-I (1, 2, 9, 24). In addition, both HTLV-I and HTLV-II can coinfect with HIV-1 individual human T cells in vitro (6, 20), and the tax protein of HTLV-I trans activates the HIV-1 long terminal repeat (33). We have investigated whether HTLV-I or HTLV-II can undergo phenotypic mixing with HIV-1, thus expanding the spectrum of its cellular host range and, possibly, its pathogenicity. Two CD4+ human T-cell lines were used to generate mixed viral phenotypes: the HTLV-I producer MT-2 (19) and the HTLV-II producer Vevll, established in our laboratory from the peripheral blood (PB) (kindly provided by M. A. Kaplan, North Shore University, Manhasset, N.Y.) of an HTLV-II+ patient. These cell lines were superinfected with HIV-1 (strain HTLV-IIIB) at a multiplicity of infection of approximately 1 (one tissue culture infectious dose per

susceptible CD4+ T-cell clone CEM50). The infection was cytopathic and simultaneously productive for both viruses, as determined by indirect immunofluorescence analysis. The release of infectious HIV-1 was paralleled by the appearance of giant multinucleated cells. Supernatants from coinfected cultures were used as a source of mixed viral phenotypes and tested on a panel of CD4- cells (Table 1) per se not susceptible to infection by HIV-1. These CD4- human cell types were incubated for 1 h at 37°C with the supernatants of HTLV/HIV-1 coinfected cells or, as a control, with equal Mg2+-dependent reverse transcriptase counts of HIV-1 produced by the HTLV- human T-cell line MOLT-3 acutely infected with the HTLV-IIIB strain. In all cases, the multiplicity of infection for HIV-1 was approximately 1. As expected, no expression of HIV-1 was detected in CD4cells exposed to HIV-1 alone, while control CD4+ cells were efficiently infected (Table 1). By contrast, when the cells were exposed to the viral progeny of HIV-1/HTLV-I or HIV-1/HTLV-II coinfected cells, productive HIV-1 infection was observed in all the CD4- cells tested (Table 1). These results were ascribed to the generation of phenotypically mixed viral particles containing the HIV-1 genome enveloped by HTLV-I [HIV-1(HTLV-I)] or HTLV-II [HIV1(HTLV-II)] external glycoproteins. Indeed, although still unknown, the membrane receptor for HTLV-I and HTLV-II is different from the HIV receptor (i.e., CD4) and its gene(s) was recently mapped to a locus on human chromosome 17

(34).

The kinetics of p24 antigen release from two representative CD4- cell lines (HSB-2 and HeLa) are illustrated in Fig. 1. HIV-1 p24 antigen release was detectable 3 days postinfection and subsequently reached a plateau, after which it progressively declined, probably reflecting the

* Corresponding author. 6341

6342

J. VIROL.

NOTES

TABLE 1. HIV-1 infection of human CD4- cells of diverse lineage origin through phenotypically mixed viral particles generated by human CD4+ T cells coinfected with HIV-1 and HTLV-I [HIV-1(HTLV-I)] or

HTLV-II [HIV-1(HTLV-II)] Cell typea

400-

C4

C.

300-

Raji HSB-2 A-204 HeLa CD8+ T-cell population CD8+ T-cell clones MOLT-3

200-

100-

Al

Lineage origin

Amt of antigen released (pg/ml) after infection withb:

HIV- HIV-1 HIV-1 1 (HTLV-I) (HTLV-II)

B lymphoid cells 500

156 348 NTC NT NT

472

280

>500

>500

A

0

5

The cell lines used were Raji (ATCC CCL 86), HSB-2 (ATCC CCL 120.1), A-204 (ATCC HTB 82), HeLa (ATCC CCL 2), and MOLT-3 (ATCC CRL 1552). The CD8+ normal human T-cell populations were obtained from adult PB by negative selection of CD4-CD14-CD19-CD56-cells by a doublerosetting procedure with immunomagnetic beads, as described previously (18). The MAbs used for selection were OKT4a (Ortho Diagnostics, Raritan, N.J.) and Leu M3, Leu 12, and Leu 19 (Becton Dickinson, Mountain View, Calif.). Two different CD3+CD4-CD8+ T-cell clones were established by the limiting dilution technique from adult human PB in the presence of purified phytohemagglutinin and feeder layers of irradiated (3,000 rad) allogeneic PB mononuclear cells. The cells were grown in interleukin-2 (100 U/ml) and periodically restimulated with irradiated feeder layers. b Phenotypically mixed viral progenies were generated by superinfecting with HIV-1 (strain HTLV-IIIB) the HTLV-I+ CD4+ T-cell line MT-2 or the HTLV-II+ CD4+ T-cell line VevII at a multiplicity of infection of approximately 1 (i.e., one tissue culture infectious dose per cell). Control HIV-1 was produced by acutely infecting the HTLV- T-cell line MOLT-3. Supematants were harvested at various time points postinfection, filtered through a 0.4-p.m (pore size) membrane, and frozen at -80°C. For infection, CD4- cells were incubated for 1 h at 37°C with the different virus-rich supernatants containing equal counts of Mg2+-dependent reverse transcriptase (105/ml). The cells were then washed repeatedly and recultured at 106/ml. The level of HIV-1 p24 antigen was determined by using an enzyme-linked immunosorbent assay kit (Organon Technika, Durham, N.C.). The data show the amounts of HIV-1 p24 antigen released into the supernatant fluid of the cultures at day 4 postinfection. The results represent the averaged means from three separate experiments. cNT, Not tested. a

10

Days Post-infection FIG. 1. Kinetics of HIV-1 expression in human CD4- cells infected with HIV-1 (closed symbols) or HIV-1(HTLV-I) (open symbols): time course of HIV-1 p24 antigen (Ag) release into the

supernatant fluids of the cell lines HSB-2 (circles) and HeLa (triangles). For details concerning the infection procedure, virus stocks, and infection monitoring, see footnote b to Table 1.

inability of HIV-1 to spread within these CD4- cultures. This finding may be explained by the lack of de novo generation of phenotypically mixed virions in CD4- cultures, likely due to inefficient transmission of HTLV, along with HIV-1, when cell-free supernatants from coinfected MT-2 or Vevll cells were used (see below). To further confirm the observation that phenotypically mixed HIV-1 was able to penetrate and reverse transcribe in CD4- cells, molecular analysis was performed by the polymerase chain reaction (PCR) on DNA extracted from HSB-2 cells 5 days postinfection. As shown in Fig. 2, HIV-1 DNA was identified in cells exposed to HIV-1(HTLV-II) and HIV-1(HTLV-I) (lanes A and B, respectively) but not in cells exposed to control HIV-1 (lane C). In contrast to HIV-1 DNA, specific HTLV-I or HTLV-II DNA could not be documented by PCR in cultures exposed to these phenotypically mixed viral progenies (data not shown). This apparently puzzling observation is nonetheless consistent with the poorly efficient cell-free transmission previously reported for the HTLVs (27). However, these viruses can infect a broad range of cells through direct cell-to-cell contact (10, 23). To conclusively demonstrate that the mechanism of entry of HIV-1 into previously nonsusceptible CD4- cells was phenotypic mixing and, therefore, that it occurred independently of the major HIV receptor (i.e., CD4), blocking experiments were performed using the following antisera: a neutralizing HTLV-I+ human serum (RL), anti-CD4 monoclonal antibody (MAb) OKT4a, and anti-HIV-1 env MAb M77. The latter MAb (R. Pal, F. di Marzo Veronese, B. C. Nair, R. Rahman, G. Hoke, S. W. Mumbauer, and M. G. Sarngadharam, Intervirology, in press) is directed toward an HTLV-IIIB type-specific epitope of the gpl20 neutralizing loop, a structure known to play a critical role in the HIV-1 entry pathway (31). As expected, both OKT4a and M77 completely abrogated infection by HIV-1 in control CD4+ MOLT-3 cells (Table 2). However, neither MAb was able to inhibit HIV-1 entry when HIV-1(HTLV-I) was used for the infection of both CD4+ and CD4- human cells. By contrast,

infection of CD4- cells by HIV-1(HTLV-I) was specifically inhibited by pretreatment of the virus with the HTLV-Ineutralizing serum RL, thus indicating that envelope components of HTLV-I were critical for the entry of HIV-1 into these CD4- cells. Our data suggest that, by phenotypic mixing, HTLV-I and HTLV-II could favor the spread of HIV-1 throughout the organism of dually infected patients. It is noteworthy that such a phenomenon enables HIV-1 to infect CD8+ T lymphocytes and B cells, two key elements of the immune system besides the classical HIV-1 target cells, i.e., CD4+ T lymphocytes and mononuclear phagocytes. Phenotypic mixing, a well-documented phenomenon between enveloped viruses coinfecting the same target cell (11, 12, 29, 36), has been recently demonstrated between the HTLVs and vesicular stomatitis virus (3) as well as between HIV-1 and murine leukemia virus-related murine retroviruses (16, 35), vesicular stomatitis virus (37), or herpes simplex virus (37). A role for phenotypic mixing in vivo was suggested by observations in cats coinfected by feline immunodeficiency virus and feline leukemia virus. Compared with animals infected by feline immunodeficiency virus alone, these cats demonstrate a significantly accelerated disease progression, paralleled by a considerably wider tissue distribution of feline immunode-

NOTES

VOL. 64, 1990

6343

ficiency virus (25). In light of these findings, we are currently investigating the tissue tropism of HIV-1 in humans coinfected with HTLV-I or HTLV-II. We thank Mark Kaplan for blood from a patient, Fulvia di Marzo Veronese for the M77 MAb, Antoine Gessain for the HTLV-I+ human serum, and Susan DeRocco and Patrick Pang for technical assistance.

115 bp

VW

C A B FIG. 2. HIV-1 infection of CD4- human cells through phenotypically mixed viral particles: detection of HIV-1 DNA by PCR in the CD4- HSB-2 cell line 5 days postinfection with HIV-1(HTLV-II) (A), HIV-1(HTLV-I) (B), or HIV-1 as a control (C). The presence of the specific PCR product of- 115 bp documented the efficient viral penetration and reverse transcription within these HIV-1 nonsusceptible cells. For PCR analysis, 106 cells were lysed as previously described (28), and the lysate was stored at -70°C until use. The amplifications by PCR were performed as follows. A 100-,ul reaction mixture, containing 50 ,ul of cell lysate, 10 mM Tris (pH 8.3), 50 mM KCI, 1.5 mM MgCl2, 200 ,uM each deoxynucleoside triphosphate (dATP, dCTP, dGTP, and dTTP), 10 pmol of each primer (SK38 and SK39 gag), and 2.5 U of Taq polymerase (Beckman), was used. Thirty cycles were run, comprising three steps of 2 min each at 94, 55, and 72°C, respectively. The extension step at 72°C was prolonged 7 min after the last cycle. Twenty samples, one of each, were loaded onto a 10% polyacrylamide gel, run at 70 V for 3 h in TBE (1 x TBE is 0.089 M Tris [pH 8.3], 0.089 M boric acid, 2.5 M EDTA) buffer, and electroblotted in the same buffer at 20 V overnight on a nylon membrane. The membrane was prehybridized for 1 h at room temperature in 6x SSC (lx SSC is 0.15 M NaCl plus 0.015 M sodium citrate)-0. 1% sodium dodecylsulfate, hybridized in the same buffer at room temperature overnight using SK19 gag as a probe, and washed three times for 20 min each time at room temperature in 6x SSC. The autoradiogram was exposed overnight at -70°C. The synthetic oligonucleotide sequences used were ATAATCCACCTA TCCCAGTAGGAGAAAT (SK38), TTTGGTCCTTGTCTTATGTC CAGAATGC (SK39), and ATCCTGGGATTAAATAAAATAGTA AGAATGTATAGCCCTAC (SK19) (14). TABLE 2. Blocking of infection by HIV-1 or HIV-1(HTLV-I) with HIV-1- or HTLV-I-neutralizing antiserum Cell

line

Amt of antigen released (pg/ml) after infection witha: HIV-1 HIV-1(HTLV-I)

________________ C

HSB-2 HeLa