Theriogenology 81 (2014) 535–544
Contents lists available at ScienceDirect
Theriogenology journal homepage: www.theriojournal.com
CDC20 downregulation impairs spindle morphology and causes reduced first polar body emission during bovine oocyte maturation W.L. Yang a, b, c, J. Li a, b, P. An a, b, A.M. Lei a, b, * a b c
College of Veterinary Medicine, Northwest A&F University, Yangling, P. R. China Shaanxi Center of Stem Cell Engineering & Technology, Yangling, P. R. China Department of Life Science and Technology, Ningxia Polytechnic, Yinchuan, P. R. China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 12 August 2013 Received in revised form 2 November 2013 Accepted 5 November 2013
The cell division cycle protein 20 (CDC20) is an essential regulator of cell division, encoded by the CDC20 gene. However, the role of CDC20 in bovine oocyte maturation is unknown. In this study, CDC20 morpholino antisense oligonucleotides (MOs) were microinjected into the cytoplasm of bovine oocytes to block the translation of CDC20 mRNA. CDC20 downregulation significantly reduced the rate of first polar body emission (PB1). Further analysis indicated that oocytes treated with CDC20 MO arrested before or at meiotic stage I with abnormal spindles. To further confirm the functions of CDC20 during oocyte meiotic division, CDC20 MOs were microinjected into oocytes together with a supplementary PB1. The results showed that newly synthesized CDC20 was not necessary at the meiosis II-toanaphase II transition. Our data suggest that CDC20 is required for spindle assembly, chromosomal segregation, and PB1 extrusion during bovine oocyte maturation. Ó 2014 Elsevier Inc. All rights reserved.
Keywords: CDC20 downregulation Spindle morphology Bovine oocyte maturation
1. Introduction Errors in the first meiotic division of oocytes can lead to chromosomal segregation errors through incorrect disjunction, resulting in formation of aneuploid gametes and early embryonic death. Cell division cycle protein 20 (CDC20) is an essential regulator (Fig. 1) of cell division [1,2], and is an activator of the E3 ubiquitin ligase anaphase-promoting complex/cyclosome (APC/C), which ubiquitinates the securing (an inhibitor of seperase) and M-phase–regulating protein cyclin B1 [3,4]. Degradation
Ethics Statement: Cattle slaughter was conducted in accordance with the Animal Welfare laws of China. The disposal of ovaries conformed to the system of Northwest A&F University: “Notice of the Rule for Experimental Animal Carcasses and Unified Waste Disposal”. This rule was implemented from early 2011 (Northwest A&F University, Experiment, 2011, 3rd). * Corresponding author. Tel.: þ86 029 87080068; fax: þ86 029 87080068. E-mail address: [email protected] (A.M. Lei). 0093-691X/$ – see front matter Ó 2014 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.theriogenology.2013.11.005
of this complex is induced by APCCDC20 through its D-box but not by APCCDH1, another activator of APC/C. CDC20 and CDH1 have distinct roles in the cell cycle [5–7]. MAD2 is an inhibitor of CDC20 [8]. The spindle assembly checkpoint (SAC) kinase BUBR1 can also bind to CDC20 and interact with MAD2 to inhibit the activity of APC/C [9–11]. Chow, et al. [12] suggested that RASSF1A might also act as an inhibitor of APC/CCDC20. The CRY-box is a second APCCDH1-dependent degron in CDC20 apart from the KEN-box [13]. A structure composed of seven WD-40 repeats exists in C-terminal domains of CDC20 protein. The main mechanism of recognition between CDC20 and its specific target proteins relies on the destruction box (D-box) residing in its target proteins. The Cdc family including CDC20 was discovered in the early 1970s in the yeast strain Saccharomyces cerevisiae by Hartwell, et al. [14]. Mutants of CDC20 could not enter anaphase and complete mitosis; this phenotype was ascribed to expression of the CDC20 gene [15]. The role and functions of CDC20 remained unclear until the APC was discovered
536
W.L. Yang et al. / Theriogenology 81 (2014) 535–544
Fig. 1. The role of cell division cycle protein 20 (CDC20) during meiosis in oocyte. The activation of CDC20 is inhibited by MAD2, and anaphase-promoting complex/cyclosome (APC/C) cannot be before CDC20 is inactive (A). CDC20 will be activated and bound to APC/C when inactivation of MAD2 (B). The APC/C, which possess function of E3 ubiquitin ligase, can be activated by CDC20 (C), the complex of CDC20–APC/C can recognize securin specifically, and ubiquitin was summoned to securin once was marked by CDC20–APC/C (D). Degradation of securing mediated by ubiquitin caused activation of separase recover from inhibition disengages (E). Later, cohesin is split open by separase. Meanwhile, CDC20 is marked by CDH1–APC/C when its task ends, and degraded by ubiquitin (F). Homologous chromosome separated from the failure of cohesion (G).
in 1995, even though the structure of CDC20 was known [16,17]. The APCCDC20 complex is present during the appropriate times in the cell cycle to regulate itself. For CDC20 to bind to APC, specific APC subunits must be phosphorylated by cyclin-dependent kinase (CDK)-1. Therefore, high activity of CDK in mitosis forces the cell to enter anaphase and exit from mitosis. The activated APCCDC20 promotes the degradation of CDKs by inactivating S/M cyclins. Degradation of CDK brings about lower rates of APC phosphorylation, and the end result of this event is a lower rate of CDC20 binding. The APCCDC20 complex inactivates itself by the end of mitosis in this way. A series of different mechanisms switches on to inhibit CDKs in G1 stage, the levels of CDK inhibitor proteins are upregulated, and cyclin gene expression is downregulated at the same time. Importantly, the level of cyclin can also be prevented by CDH1. In meiosis, the SAC seems to sense the presence of unattached chromosomes during mitosis. The SAC protein is expressed in mammalian spermatogenesis [18] as well as in oogenesis [19–21]. CDC20 is the target of SAC proteins, which collectively act as an active signal monitoring the interactions between improperly connected
kinetochores and spindle microtubules, which is maintained until all kinetochores are properly attached to the spindle. During prometaphase, CDC20 and the SAC proteins concentrate at the kinetochores before attachment to the spindle assembly. The function of SAC is to ensure anaphase proceeds, but the movement to anaphase can only be carried when the centromeres of all sister chromatids lined up on the metaphase plate are properly attached to microtubules. CDC20 is also a member of the SAC, as are MAD2, BubR1, Bub1, and Mps1 and Bub3 [22]. The various checkpoint proteins can function independently or cooperatively to block the targeting of substrates by APC/CCDC20 [9,23,24]. In fact, Mad2, BubR1, and Bub3dtogether with CDC20dlikely form the mitotic checkpoint complex that inhibits APCCDC20 so that anaphase cannot begin prematurely. Moreover, Bub1 phosphorylates and thus inhibits CDC20 directly, whereas in yeast MAD2 and MAD3, when bound to CDC20, Bub1 triggers its autoubiquitination [25]. This study used bovine oocytes as a model to investigate the function of CDC20 during meiotic division. CDC20 morpholino antisense oligonucleotides (CDC20 MOs) were synthesized and used for downregulating CDC20 expression during bovine oocyte maturation.
W.L. Yang et al. / Theriogenology 81 (2014) 535–544
2. Materials and methods 2.1. Reagents Medium 199 and Insulin-Transferrin-Selenium were from Gibco BRL (Gaithersburg, MD, USA). Sodium pyruvate, BSA, EGF, b-estradiol, L-glutamine, uracil, sodium bicarbonate, HEPES, mineral oil, ionomycin, hyaluronidase, cytochalasin B, 6-dimethylaminopurine (6-DMAP), Hoechst 33342, Triton X-100 and Tween 20 were all from Sigma-Aldrich (St Louis, MO, USA). Human menopausal gonadotropin was from LiZhu Ltd. (Shanghai, P. R. China). Anti-mouse a-tubulin antibody, Cy3-conjugated goat anti-mouse immunoglobulin (Ig)G, and antifade mounting medium were from Beyotime Institute of Biotechnology (Shanghai, P. R. China). Cleavage medium and Serum Protein Substitute were from Sage Biopharma, (Bedminster, NJ, USA). Fetal bovine serum was from Hyclone. CDC20 MOs (50 –CACTCTCGAACACGAACTGGGCCAT–30 ) and control MOs (50 –TACCGGGTCAAGCACAAGCTCTCAC–30 ) were from Gene Tools LLC (Philomath, OR, USA) using the T7 Message Machine kit (Ambion Inc., Austin, TX, USA). 2.2. Oocyte collection and culture in vitro Bovine ovaries from a local slaughterhouse were collected and transported to the laboratory in a thermos flask containing saline (0.9% NaCl, with 100 IU/mL penicillin and 100 mg/mL streptomycin) at 20 C to 24 C within 6 to 8 hours after slaughter. After three washes with the same saline solution prewarmed to 37 C, cumulus–oocyte complexes (COCs) were obtained from 2- to 8-mm diameter follicles using a 10-mL syringe and a 12-ga sterile needle. The follicular fluids were pooled in a sterile centrifuge tube and the collected COCs were dispersed in a 70-mm cell culture dish after three washes using COCs wash solution (medium 199 containing 10% NBS, 2.2 g/L sodium bicarbonate, 10 mmol/L HEPES; pH 7.2–7.4) prewarmed to 37 C. The COCs with multiple layers of cumulus cells were selected under a stereomicroscope for IVM. The COCs were cultured in 500 mL of maturation medium (medium 199 containing 10% BSA, 0.1 IU/ mL human menopausal gonadotropin, 1.0 mg/mL b-estradiol, 50 ng/mL EGF, 50 mg/mL uracil, and 10 mL/mL InsulinTransferrin-Selenium) after three washes in maturation medium at 38.5 C under a humidified atmosphere of 5% CO2 in air. The maturation medium needed to be equilibrated in a CO2 incubator for at least 2 hours before commencing maturation culture. 2.3. Efficiency of interference We cleaved pCDC20-Venus using the restriction enzyme XbaI and the linearized pCDC20-Venus plasmid was used as a template. Full-length CDC20-Venus cRNA was synthesized using a T7 Message Machine kit (Ambion Inc.). To assess the efficiency of interference, one group of oocytes was injected with CDC20 cRNA and another group was co-injected with CDC20 cRNA and CDC20 MOs. After 8 to 10 hours in culture, we captured fluorescence images using the same exposure times. The average fluorescence
537
intensity of each oocyte in each group was measured using Axio Vision Rel. 4.8 software (Carl Zeiss, Oberkochen, Germany). We calculated the average intensity of fluorescence in the two groups, and the interference efficiency of MO function was estimated from the differences between the two groups. 2.4. Microinjection of CDC20/control MOs Some COCs were cultured for 8 to 10 hours in maturation medium (meiosis I oocytes), and the cumulus cells were removed by gentle pipetting in 0.3% hyaluronidase. After 20 minutes in the operating solution (medium 199 containing 10% fetal bovine serum and 7.5 mg/L cytochalasin B), denuded oocytes were moved to 20-mL droplets of operating solution covered with sterile mineral oil. Then, 2 mmol/L of CDC20 MOs were microinjected into the cytoplasm of oocytes with the aim of knocking down CDC20 expression (MO group), The same amounts of control morpholino oligonucleotides were injected into another group of oocytes as control (MO Control group). Another group of oocytes without any injection was used as the negative control (negative control group). After microinjection, the oocytes were removed to fresh operating solution for 20 minutes, and then washed three times in fresh maturation medium. Finally, the oocytes were cultured in fresh maturation medium for next 10 hours. This group of oocytes was used to study the effects of CDC20 downregulation on meiosis I. The other COCs were cultured for 19 to 20 hours, and the cumulus cells were also removed. Oocytes with PB1 were treated the same as the Meiosis I oocytes, including an MO group, an MO control group, and a negative control group. The treated oocytes were cultured in operating solution containing 5 mmol/L ionomycin for 5 minutes at 28 hours. After three washes with fresh solution, the oocytes were moved to 2.5 mmol/L 6-DMAP for 4 hours. Finally, oocytes were cultured in cleavage medium under mineral oil at 38.5 C for 72 hours. The CDC20 MOs were injected using a micropipette with a 5-mm inner diameter. Microinjections were performed using a Leica micromanipulation system (Leica Camera AG, Solms, Germany) and an Eppendorf FemtoJet microinjection system (Hamburg, Germany). These oocytes were used to study the effects of CDC20 downregulation on meiosis II. 2.5. Immunofluorescence staining At the end of each experiment, oocytes were fixed in PBS (pH 7.4) containing 4% paraformaldehyde for at least 30 minutes at room temperature. After being permeabilized with PBS supplemented with 0.5% Triton X-100 at room temperature for 20 minutes, oocytes were blocked in PBS with 1% BSA for 1 hour at room temperature. Oocytes were then incubated with anti-mouse a-tubulin antibody (1:500) overnight at 4 C. After three washes with wash solution (PBS containing 0.1% Tween 20 and 0.01% Triton X-100) for 15 minutes each time, the oocytes were labeled with Cy3-conjugated goat anti-mouse IgG (1:500) for 1 hour at 37 C. After another three washes with wash solution, oocytes were costained with Hoechst 33342 (10 mg/mL)
538
W.L. Yang et al. / Theriogenology 81 (2014) 535–544
for 5 minutes. After three washes with wash solution for 5 minutes each time, the oocytes were mounted on glass slides and examined with a scanning fluorescence microscope (Axiocam MRm; Carl Zeiss, Shanghai, P. R. China). 2.6. Statistical analysis Data from at least three replicates per experiment were analyzed using chi-squared tests. Differences at P < 0.05 (*) and P < 0.01 (**) were considered significant and extremely significant, respectively. 3. Results 3.1. Efficacy of CDC20 MOs in downregulating CDC20 expression Using imaging, we measured the fluorescence intensity at each crossing point of reference lines on the images (Fig. 2). Fluorescence intensities in the CDC20 cRNA injection group and CDC20 MO co-injection group were 178.81 and 34.43, respectively (Fig. 2). The intensity in the cRNA-CDC20 MO co-injection group was 19.26% of the control CDC20 cRNA group, so the efficiency of interference by CDC20 MO microinjection was 80.74%. 3.2. Effect of CDC20 downregulation on first polar body extrusion (PB1E) in bovine oocytes The rates of PB1E in the CDC20 MO, control MO and negative control groups were 11.4% (15/131), 58.2% (64/ 110), and 66.9% (93/139), respectively, after another 14 to 16 hours’ culture in maturation medium (Fig. 3). No more oocytes showed PB1E during subsequent monitoring in the CDC20 MO group. In contrast with the control MO and negative control groups, CDC20 downregulation significantly reduced the rate of PB1E. The PB1E rate of oocytes in the control MO group was lower than in control oocytes but this was not significant. Thus, the mechanical effects of microinjection per se can reduce the rate of PB1E.
Fig. 3. Percentage of the first polar body (PB1) in three groups. Oocytes were microinjected with cell division cycle protein 20 (CDC20) morpholino antisense oligonucleotides (MOs), control MOs, or not at all (negative control group). The percentages of PB1 extrusion (PB1E) in the CDC20 MO, control MO, and negative control groups are shown in the histogram. Data are presented as mean values standard error of the mean. * P < 0.05; ** P < 0.01.
3.3. Abnormal spindles in the CDC20 MO group Immunofluorescence staining showed that oocytes without a PB1 in the CDC20 MO group displayed abnormal spindles (Fig. 4). Many types of abnormal spindles could be seen in oocytes with and without a supplementary PB1. In terms of the oocytes without PB1, the spindles in oocytes were deformed or incomplete compared with the control MO group (Fig. 5A) and negative control group (Fig. 5B). During telophase I, the spindles were dispersed in the CDC20 MO group (Fig. 6A); the DNA was also dispersed (Fig. 6A). Both spindles and DNA distribution showed normal morphologies in oocytes with control MO microinjection (Fig. 6B) and no microinjection (Fig. 6C). 3.4. Oocytes were arrested at the metaphase I stage after CDC20 MO microinjection After microinjection of CDC20 MOs, oocytes were removed to fresh maturation medium for another 14 to 16
Fig. 2. Fluorescence intensity after injection. Fluorescence intensity of oocytes was measured after injection. (A) Oocytes in the cell division cycle protein 20 (CDC20) cRNA injection group and cell division cycle protein 20 (CDC20) cRNA-CDC20 morpholino antisense oligonucleotide (MO) co-injection group under fluorescence microscopy. (B) Oocytes in the CDC20 cRNA-CDC20 MO co-injection group under fluorescence microscopy. (C) This histogram shows the efficiency of interference based on the difference between measurements from A and B.
W.L. Yang et al. / Theriogenology 81 (2014) 535–544
539
Fig. 4. Abnormal spindles in oocytes without the first polar body (PB1) in the cell division cycle protein 20 (CDC20) morpholino antisense oligonucleotide (MO) group. Different shapes of abnormal spindles can be seen in oocytes without PB1 in the CDC20 MO group. Hoechst 33342 staining for DNA suggested that the oocytes were arrested at prometaphase or metaphase I (MI). Some typical deformed spindles and incomplete spindles are shown. Bar ¼ 100 mm.
hours in culture and oocytes with and without a PB1 were distinguished by immunofluorescence staining. Immunofluorescence analysis indicated that most oocytes in the CDC20 MO group were arrested at or just before metaphase I (MI; Fig. 4). Oocytes in the control MO group (Fig. 5A) and negative control group (Fig. 5B) were arrested at MI.
3.5. CDC20 downregulation had no effect on the second meiotic division Oocytes cultured for 19 to 20 hours with an additional PB1 were microinjected with 2 mmol/L CDC20 MOs or control MOs. After stimulating parthenogenetic division,
540
W.L. Yang et al. / Theriogenology 81 (2014) 535–544
Fig. 5. Normal spindles in oocytes without the first polar body (PB1) in the cell division cycle protein 20 (CDC20) morpholino antisense oligonucleotide (MO) group. (A) These oocytes were microinjected with 2 mmol/L of control MOs. (B) Negative control oocytes were not microinjected with anything. The spindles and DNA are illustrated by immunofluorescence and Hoechst 33342 staining, respectively. Both the spindles and DNA were regular in appearance and showed the typical features of MI in A and B. The oocytes were arrested at MI. Bar ¼ 100 mm.
embryos were moved to cleavage medium for 72 hours culture. The cleavage rates in the CDC20 MO, control MO, and negative control groups were 73% (64/88), 86.8% (99/ 114), and 86% (86/100), respectively (Fig. 7). There were no anomalous divisions (Fig. 8). 4. Discussion During oocyte maturation, a decrease in APC/CCDH1 activity through an increase in maturation promotion factor, and a reduction in CDH1 allows the resynthesis of CDC20. Then APC/CCDC20 starts the degradation of securin and cyclin B1, thus allowing homologous chromosomal segregation during oocyte maturation [3]. Functional defects in the SAC system can lead to missegregation of chromosomes, generating aneuploidy. Mutations and deregulated expression of many SAC genes have been found in cancer tissues [26–28]. Thus, CDC20 overexpression has been observed in various cancer tissues [29] and is reported to cause aneuploidy by premature anaphase onset in cancer cells [30]. CDC20 hypomorphic female mice are infertile or subfertile despite showing normal oogenesis, and their embryos fail to develop into blastocysts because the oocytes and embryos are aneuploid [31]. Expression of MAD2 binding-deficient and thereby SAC-defective mutant CDC20 promotes tumor formation in mice [32]. These findings suggest that proper function of CDC20 is crucial for the orderly execution of cell division. The CDC20 family of conserved proteins is essential for the activation of APC/C [33].The role of CDC20 in recruiting
substrates to APC/C through their C-terminal WD40 domain is well-established [25]. In addition to substrate recruitment, the N-terminal C box of CDC20 was also found to trigger substrate ubiquitination by APC/C [34,35]. Moreover, in a genome-wide silencing (si)RNA screening, CDC20 knockdown resulted in mitotic defects [36]. The resumption of meiotic division correlates to genitor-hormones tightly, previous study suggested that genitor-hormones and growth factors such as FSH, LH, and EGF can lead to resumption of meiotic division [37,38]. We assumed that these matters may induce CDC20 mRNA transcription or priming some meiotic division signal pathways. Finally, it caused activation of CDC20. In one’s whole life, meiotic division is merely a phenomenon of effect generated by these matters. Furthermore, it includes a series of reactions: empathema, pregnancy, parturition, lactation, and so on. 4.1. CDC20 downregulation in bovine oocytes decreased the rate of PB1E In contrast with the control MO and negative control groups, CDC20 downregulation significantly impaired the PB1E rate Thus, CDC20 knockdown specifically blocked PB1E; this result is similar to the results of Reis, et al. [3] but not to those of Yin, et al. [39]. We presume that once CDC20 was absent, low APC/CCDC20 activation could not trigger securin degradation, so the inactivated separase was unable to break down cohesin and this prevented normal chromosomal segregation.
W.L. Yang et al. / Theriogenology 81 (2014) 535–544
541
Fig. 6. Irregular spindles in the oocytes during telophase I. Irregular spindles appeared in the oocytes during telophase I in the cell division cycle protein 20 (CDC20) morpholino antisense oligonucleotide (MO) group (A) but not in the control MO group (B) or negative control group (C). In contrast with the CDC20 MO group, spindles appearing in the microinjected first polar body (PB1) in control MO group and negative control group were regular in morphology. The DNA profiles were regular in secondary oocytes in all groups but DNA was dispersed in the PB1 only in the CDC20 MO group. Bar ¼ 100 mm.
4.2. Oocytes arrested before or at MI after CDC20 MO microinjection Our results suggest that CDC20 plays an important role during bovine oocyte meiotic maturation and indicates
Fig. 7. Percentage of the first polar body extrusion (PB1E) in three groups. This histogram shows the oocyte cleavage rates in the cell division cycle protein 20 (CDC20) morpholino antisense oligonucleotide (MO), control MO and negative control groups after 72 hours in culture.
that CDC20 is essential for spindle assembly and the MI–TI transition. When the maturation promotion factor activity rises during meiosis I, APC/CCDH1 activity is switched off, CDC20 levels start to rise and this causes both securin and cyclin B degradation, finally leading to chromosome separation and the onset of anaphase [3,40,41]. Why were the oocytes in our study arrested at prometaphase or MI with abnormal spindles after injecting CDC20 MOs? There might be a pathway between spindle assembly and chromosome activity for such communication. Because CDC20 is a member of this system, we surmise that its depletion interrupted the pathway and caused the spindle to fail to attach to the chromosomes. At the same time, failed attachment between chromosome kinetochores and the spindle might activate the SAC, so the cell cycle would have arrested at MI. Mice lacking CDC20 showed failed embryogenesis: the embryos were arrested in metaphase at the two-cell stage with high levels of cyclin B1 [42]. In budding yeast, the deletion of CDC20 causes metaphase arrest [43]. CDC20 hypomorphism prolongs metaphase I [31] and delays the onset of anaphase [44]. CDC20 antisense RNA causes
542
W.L. Yang et al. / Theriogenology 81 (2014) 535–544
Fig. 8. Cleavaged oocytes after 24 hours in culture. Oocytes in (A) the cell division cycle protein 20 (CDC20) morpholino antisense oligonucleotide (MO) group, (B) the control MO group, and (C) the negative control group after 24 hours in culture. Oocytes with a supplementary first polar body (PB1) were microinjected with CDC20 MOs or control MOs; oocytes in the negative control group were not microinjected with anything. Oocytes were cultured in cleavage medium for 24 hours after the induction of parthenogenesis, corresponding with the two-cell stage in normal embryos. Nuclear and cytoplasmic divisions were synchronous in all groups and no anomalous division appeared. Bar ¼ 100 mm.
mitotic arrest in human cells [45]. CDC20-null mouse embryos die at the two-cell stage because of permanent metaphase arrest [46]. During prometaphase, kinetochores that detach from the spindle microtubules generate a waiting signal to spur the formation of protein complexes including CDC20, MAD2, MAD3, and Bub3, acting to inhibit the APC. As a consequence, securin cannot be hydrolyzed, separase cannot be activated, and the sister chromatids cannot separate [41,47]. When spindle assembly is impaired, chromosomal movement is halted. Thus, after oocytes were injected with CDC20 MOs, no spindle microtubules could attach to the waiting chromosomes and the oocytes arrested at prometaphase or MI. 4.3. CDC20 downregulation caused impairment of spindle assembly Our results indicate that CDC20 participates in spindle formation. Its deletion caused severe impairment of spindle assembly and a variety of abnormal spindles could be seen in oocytes injected with CDC20 MOs (Fig. 4). Cytoskeletal elements including microtubules and microfilaments are widely involved in many events during
oocyte polarization [48]. We propose that, during chromosomal feedback of information regarding spindle assembly and in the absence of CDC20, the signal pathway discontinues and spindle assembly is stopped. Both the segregation of homologous chromosomes and sister chromatids rely on the pulling forces generated by microtubules attached to centromeric chromatin at kinetochores. Once the spindle is impaired, it prevents normal segregation of homologous chromosomes and sister chromatids. A previous study showed that the enzyme Aurora A regulates both centrosome maturation and bipolar spindle assembly [49]. Aurora A degradation is delayed after injection of siRNA for CDC20 downregulation, the reasons for which are not clear [50]. How is information exchanged between CDC20 downregulation and Aurora A degradation? This may help to answer why CDC20 downregulation caused impairment of spindle assembly. 4.4. CDC20 only plays its role in the first, but not the second meiotic division When the same amounts of CDC20 MOs were microinjected into MII oocytes together with an additional PB1,
W.L. Yang et al. / Theriogenology 81 (2014) 535–544
the rates of PN formation and first cleavage were no different from the control MO and negative control groups. This result suggests that CDC20 plays its role in the first but not the second meiotic division. It also means that MI is more sensitive to CDC20. The segregation of homologous chromosomes and sister chromatids are different and involve different mechanisms. In contrast with the second meiotic division (meiosis II), the first meiotic division (meiosis I) is more important in mammalian oocytes. Knockdown of CDC20 in primary oocytes suggests that APC/CCDC20 is active in late meiosis I and drives oocytes into anaphase [51]. Thus, the role of CDC20 is different during meiosis I and II. 5. Conclusions Our data suggest that CDC20 is required for spindle assembly, chromosomal segregation, and PB1 extrusion during meiosis I of bovine oocyte maturation, but when the same amounts of CDC20 MOs were microinjected into MII oocytes with a supplementary PB1, the rates of PN formation and first cleavage were no different from the control MO and negative control groups. Thus, the role of CDC20 differs between meiosis I and II.
Acknowledgments This study was supported by the National Natural Science Foundation of China (31172280). The funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. Image manipulation: Blotches in images were manipulated by Photoshop in purpose of clarity and beauty, and then combined corresponding images together.
References [1] Weinstein J, Jacobsen FW, Hsu-Chen J, Wu T, Baum LG. A novel mammalian protein, p55CDC, present in dividing cells is associated with protein kinase activity and has homology to the Saccharomyces cerevisiae cell division cycle proteins Cdc20 and Cdc4. Mol Cell Biol 1994;14:3350–63. [2] Weinstein J. Cell cycle-regulated expression, phosphorylation, and degradation of p55Cdc. A mammalian homolog of CDC20/Fizzy/slp1. J Biol Chem 1997;272:28501–11. [3] Reis A, Madgwick S, Chang HY, Nabti I, Levasseur M, Jones KT. Prometaphase APCcdh1 activity prevents non-disjunction in mammalian oocytes. Nat Cell Biol 2007;9:1192–8. [4] Santaguida S, Musacchio A. The life and miracles of kinetochores. EMBO J 2009;28:2511–31. [5] Peters JM. The anaphase promoting complex/cyclosome: a machine designed to destroy. Nat Rev Mol Cell Biol 2006;7:644–56. [6] Prinz S, Hwang ES, Visintin R, Amon A. The regulation of Cdc20 proteolysis reveals a role for APC components Cdc23 and Cdc27 during S phase and early mitosis. Curr Biol 1998;8:750–60. [7] Visintin R, Prinz S, Amon A. CDC20 and CDH1: a family of substratespecific activators of APC-dependent proteolysis. Science 1997;278: 460–3. [8] Fang G, Yu H, Kirschner MW. The checkpoint protein MAD2 and the mitotic regulator CDC20 form a ternary complex with the anaphasepromoting complex to control anaphase initiation. Genes Dev 1998; 12:1871–83. [9] Fang G. Checkpoint protein BubR1 acts synergistically with Mad2 to inhibit anaphase-promoting complex. Mol Biol Cell 2002;13:755– 66.
543
[10] Mao Y, Abrieu A, Cleveland DW. Activating and silencing the mitotic checkpoint through CENP-E-dependent activation/inactivation of BubR1. Cell 2003;114:87–98. [11] Zhou J, Yao J, Joshi HC. Attachment and tension in the spindle assembly checkpoint. J Cell Sci 2002;115:3547–55. [12] Chow C, Wong N, Pagano M, Lun SW, Nakayama KI, Nakayama K, et al. Regulation of APC/C(Cdc20) activity by RASSF1A-APC/C(Cdc20) circuitry. Oncogene 2012;31:1975–87. [13] Reis A, Levasseur M, Chang HY, Elliott DJ, Jones KT. The CRY box: a second APCcdh1-dependent degron in mammalian cdc20. EMBO Rep 2006;7:1040–5. [14] Hartwell LH, Culotti J, Reid B. Genetic control of the cell-division cycle in yeast. I. Detection of mutants. Proc Natl Acad Sci USA 1970;66:352–9. [15] Hartwell LH, Mortimer RK, Culotti J, Culotti M. Genetic control of the cell division cycle in yeast: V. Genetic analysis of cdc mutants. Genetics 1973;74:267–86. [16] King RW, Peters JM, Tugendreich S, Rolfe M, Hieter P, Kirschner MW. A 20S complex containing CDC27 and CDC16 catalyzes the mitosis-specific conjugation of ubiquitin to cyclin B. Cell 1995;81:279–88. [17] Sudakin V, Ganoth D, Dahan A, Heller H, Hershko J, Luca FC, et al. The cyclosome, a large complex containing cyclin-selective ubiquitin ligase activity, targets cyclins for destruction at the end of mitosis. Mol Biol Cell 1995;6:185–97. [18] de Rooij DG, de Boer P. Specific arrests of spermatogenesis in genetically modified and mutant mice. Cytogenet Genome Res 2003;103:267–76. [19] Brunet S, Pahlavan G, Taylor S, Maro B. Functionality of the spindle checkpoint during the first meiotic division of mammalian oocytes. Reproduction 2003;126:443–50. [20] Homer HA, McDougall A, Levasseur M, Murdoch AP, Herbert M. RNA interference in meiosis I human oocytes: towards an understanding of human aneuploidy. Mol Hum Reprod 2005;11:397–404. [21] Wassmann K, Niault T, Maro B. Metaphase I arrest upon activation of the Mad2-dependent spindle checkpoint in mouse oocytes. Curr Biol 2003;13:1596–608. [22] Decordier I, Cundari E, Kirsch-Volders M. Mitotic checkpoints and the maintenance of the chromosome karyotype. Mutat Res 2008; 651:3–13. [23] Sudakin V, Chan GK, Yen TJ. Checkpoint inhibition of the APC/C in HeLa cells is mediated by a complex of BUBR1, BUB3, CDC20, and MAD2. J Cell Biol 2001;154:925–36. [24] Tang Z, Bharadwaj R, Li B, Yu H. Mad2-Independent inhibition of APCCdc20 by the mitotic checkpoint protein BubR1. Dev Cell 2001; 1:227–37. [25] Yu H. Cdc20: a WD40 activator for a cell cycle degradation machine. Mol Cell 2007;27:3–16. [26] Weaver BA, Cleveland DW. Does aneuploidy cause cancer? Curr Opin Cell Biol 2006;18:658–67. [27] Yuan B, Xu Y, Woo JH, Wang Y, Bae YK, Yoon DS, et al. Increased expression of mitotic checkpoint genes in breast cancer cells with chromosomal instability. Clin Cancer Res 2006;12:405–10. [28] Yuen KW, Montpetit B, Hieter P. The kinetochore and cancer: what’s the connection? Curr Opin Cell Biol 2005;17:576–82. [29] Rhodes DR, Yu J, Shanker K, Deshpande N, Varambally R, Ghosh D, et al. Large-scale meta-analysis of cancer microarray data identifies common transcriptional profiles of neoplastic transformation and progression. Proc Natl Acad Sci USA 2004;101:9309–14. [30] Mondal G, Sengupta S, Panda CK, Gollin SM, Saunders WS, Roychoudhury S. Overexpression of Cdc20 leads to impairment of the spindle assembly checkpoint and aneuploidization in oral cancer. Carcinogenesis 2007;28:81–92. [31] Jin F, Hamada M, Malureanu L, Jeganathan KB, Zhou W, Morbeck DE, et al. Cdc20 is critical for meiosis I and fertility of female mice. PLoS Genet 2010;6. [32] Li M, Fang X, Wei Z, York JP, Zhang P. Loss of spindle assembly checkpoint-mediated inhibition of Cdc20 promotes tumorigenesis in mice. J Cell Biol 2009;185:983–94. [33] Pesin JA, Orr-Weaver TL. Regulation of APC/C activators in mitosis and meiosis. Annu Rev Cell Dev Biol 2008;24:475–99. [34] Benanti JA, Toczyski DP. Cdc20, an activator at last. Mol Cell 2008; 32:460–1. [35] Kimata Y, Baxter JE, Fry AM, Yamano H. A role for the Fizzy/Cdc20 family of proteins in activation of the APC/C distinct from substrate recruitment. Mol Cell 2008;32:576–83. [36] Neumann B, Walter T, Heriche JK, Bulkescher J, Erfle H, Conrad C, et al. Phenotypic profiling of the human genome by time-lapse microscopy reveals cell division genes. Nature 2010;464:721–7.
544
W.L. Yang et al. / Theriogenology 81 (2014) 535–544
[37] Yang J, Fu M, Wang S, Chen X, Ning G, Xu B, et al. An antisense oligodeoxynucleotide to the LH receptor attenuates FSH-induced oocyte maturation in mice. Asian-Aust J Anim Sci 2008;21:8. [38] Chen X, Zhou B, Yan J, Xu B, Tai P, Li J, et al. Epidermal growth factor receptor activation by protein kinase C is necessary for FSH-induced meiotic resumption in porcine cumulus-oocyte complexes. J Endocrinol 2008;197:409–19. [39] Yin S, Liu JH, Ai JS, Xiong B, Wang Q, Hou Y, et al. Cdc20 is required for the anaphase onset of the first meiosis but not the second meiosis in mouse oocytes. Cell Cycle 2007;6:2990–2. [40] Holt JE, Jones KT. Control of homologous chromosome division in the mammalian oocyte. Mol Hum Reprod 2009;15:139–47. [41] Yu H. Regulation of APC-Cdc20 by the spindle checkpoint. Curr Opin Cell Biol 2002;14:706–14. [42] Li M, York JP, Zhang P. Loss of Cdc20 causes a securin-dependent metaphase arrest in two-cell mouse embryos. Mol Cell Biol 2007; 27:3481–8. [43] Lim HH, Goh PY, Surana U. Cdc20 is essential for the cyclosomemediated proteolysis of both Pds1 and Clb2 during M phase in budding yeast. Curr Biol 1998;8:231–4. [44] Malureanu L, Jeganathan KB, Jin F, Baker DJ, van Ree JH, Gullon O, et al. Cdc20 hypomorphic mice fail to counteract de novo synthesis of cyclin B1 in mitosis. J Cell Biol 2010;191:313–29.
[45] Qi W, Yu H. KEN-box-dependent degradation of the Bub1 spindle checkpoint kinase by the anaphase-promoting complex/cyclosome. J Biol Chem 2007;282:3672–9. [46] Li M, Shin YH, Hou L, Huang X, Wei Z, Klann E, et al. The adaptor protein of the anaphase promoting complex Cdh1 is essential in maintaining replicative lifespan and in learning and memory. Nat Cell Biol 2008;10:1083–9. [47] Skoufias DA, Andreassen PR, Lacroix FB, Wilson L, Margolis RL. Mammalian mad2 and bub1/bubR1 recognize distinct spindleattachment and kinetochore-tension checkpoints. Proc Natl Acad Sci USA 2001;98:4492–7. [48] Brunet S, Verlhac MH. Positioning to get out of meiosis: the asymmetry of division. Hum Reprod Update 2011;17 :68–75. [49] Ducat D, Zheng Y. Aurora kinases in spindle assembly and chromosome segregation. Exp Cell Res 2004;301:60–7. [50] Gurden MD, Holland AJ, van Zon W, Tighe A, Vergnolle MA, Andres DA, et al. Cdc20 is required for the post-anaphase, KENdependent degradation of centromere protein F. J Cell Sci 2010; 123:321–30. [51] Homer H, Gui L, Carroll J. A spindle assembly checkpoint protein functions in prophase I arrest and prometaphase progression. Science 2009;326:991–4.
Contents lists available at ScienceDirect
Theriogenology journal homepage: www.theriojournal.com
CDC20 downregulation impairs spindle morphology and causes reduced first polar body emission during bovine oocyte maturation W.L. Yang a, b, c, J. Li a, b, P. An a, b, A.M. Lei a, b, * a b c
College of Veterinary Medicine, Northwest A&F University, Yangling, P. R. China Shaanxi Center of Stem Cell Engineering & Technology, Yangling, P. R. China Department of Life Science and Technology, Ningxia Polytechnic, Yinchuan, P. R. China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 12 August 2013 Received in revised form 2 November 2013 Accepted 5 November 2013
The cell division cycle protein 20 (CDC20) is an essential regulator of cell division, encoded by the CDC20 gene. However, the role of CDC20 in bovine oocyte maturation is unknown. In this study, CDC20 morpholino antisense oligonucleotides (MOs) were microinjected into the cytoplasm of bovine oocytes to block the translation of CDC20 mRNA. CDC20 downregulation significantly reduced the rate of first polar body emission (PB1). Further analysis indicated that oocytes treated with CDC20 MO arrested before or at meiotic stage I with abnormal spindles. To further confirm the functions of CDC20 during oocyte meiotic division, CDC20 MOs were microinjected into oocytes together with a supplementary PB1. The results showed that newly synthesized CDC20 was not necessary at the meiosis II-toanaphase II transition. Our data suggest that CDC20 is required for spindle assembly, chromosomal segregation, and PB1 extrusion during bovine oocyte maturation. Ó 2014 Elsevier Inc. All rights reserved.
Keywords: CDC20 downregulation Spindle morphology Bovine oocyte maturation
1. Introduction Errors in the first meiotic division of oocytes can lead to chromosomal segregation errors through incorrect disjunction, resulting in formation of aneuploid gametes and early embryonic death. Cell division cycle protein 20 (CDC20) is an essential regulator (Fig. 1) of cell division [1,2], and is an activator of the E3 ubiquitin ligase anaphase-promoting complex/cyclosome (APC/C), which ubiquitinates the securing (an inhibitor of seperase) and M-phase–regulating protein cyclin B1 [3,4]. Degradation
Ethics Statement: Cattle slaughter was conducted in accordance with the Animal Welfare laws of China. The disposal of ovaries conformed to the system of Northwest A&F University: “Notice of the Rule for Experimental Animal Carcasses and Unified Waste Disposal”. This rule was implemented from early 2011 (Northwest A&F University, Experiment, 2011, 3rd). * Corresponding author. Tel.: þ86 029 87080068; fax: þ86 029 87080068. E-mail address: [email protected] (A.M. Lei). 0093-691X/$ – see front matter Ó 2014 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.theriogenology.2013.11.005
of this complex is induced by APCCDC20 through its D-box but not by APCCDH1, another activator of APC/C. CDC20 and CDH1 have distinct roles in the cell cycle [5–7]. MAD2 is an inhibitor of CDC20 [8]. The spindle assembly checkpoint (SAC) kinase BUBR1 can also bind to CDC20 and interact with MAD2 to inhibit the activity of APC/C [9–11]. Chow, et al. [12] suggested that RASSF1A might also act as an inhibitor of APC/CCDC20. The CRY-box is a second APCCDH1-dependent degron in CDC20 apart from the KEN-box [13]. A structure composed of seven WD-40 repeats exists in C-terminal domains of CDC20 protein. The main mechanism of recognition between CDC20 and its specific target proteins relies on the destruction box (D-box) residing in its target proteins. The Cdc family including CDC20 was discovered in the early 1970s in the yeast strain Saccharomyces cerevisiae by Hartwell, et al. [14]. Mutants of CDC20 could not enter anaphase and complete mitosis; this phenotype was ascribed to expression of the CDC20 gene [15]. The role and functions of CDC20 remained unclear until the APC was discovered
536
W.L. Yang et al. / Theriogenology 81 (2014) 535–544
Fig. 1. The role of cell division cycle protein 20 (CDC20) during meiosis in oocyte. The activation of CDC20 is inhibited by MAD2, and anaphase-promoting complex/cyclosome (APC/C) cannot be before CDC20 is inactive (A). CDC20 will be activated and bound to APC/C when inactivation of MAD2 (B). The APC/C, which possess function of E3 ubiquitin ligase, can be activated by CDC20 (C), the complex of CDC20–APC/C can recognize securin specifically, and ubiquitin was summoned to securin once was marked by CDC20–APC/C (D). Degradation of securing mediated by ubiquitin caused activation of separase recover from inhibition disengages (E). Later, cohesin is split open by separase. Meanwhile, CDC20 is marked by CDH1–APC/C when its task ends, and degraded by ubiquitin (F). Homologous chromosome separated from the failure of cohesion (G).
in 1995, even though the structure of CDC20 was known [16,17]. The APCCDC20 complex is present during the appropriate times in the cell cycle to regulate itself. For CDC20 to bind to APC, specific APC subunits must be phosphorylated by cyclin-dependent kinase (CDK)-1. Therefore, high activity of CDK in mitosis forces the cell to enter anaphase and exit from mitosis. The activated APCCDC20 promotes the degradation of CDKs by inactivating S/M cyclins. Degradation of CDK brings about lower rates of APC phosphorylation, and the end result of this event is a lower rate of CDC20 binding. The APCCDC20 complex inactivates itself by the end of mitosis in this way. A series of different mechanisms switches on to inhibit CDKs in G1 stage, the levels of CDK inhibitor proteins are upregulated, and cyclin gene expression is downregulated at the same time. Importantly, the level of cyclin can also be prevented by CDH1. In meiosis, the SAC seems to sense the presence of unattached chromosomes during mitosis. The SAC protein is expressed in mammalian spermatogenesis [18] as well as in oogenesis [19–21]. CDC20 is the target of SAC proteins, which collectively act as an active signal monitoring the interactions between improperly connected
kinetochores and spindle microtubules, which is maintained until all kinetochores are properly attached to the spindle. During prometaphase, CDC20 and the SAC proteins concentrate at the kinetochores before attachment to the spindle assembly. The function of SAC is to ensure anaphase proceeds, but the movement to anaphase can only be carried when the centromeres of all sister chromatids lined up on the metaphase plate are properly attached to microtubules. CDC20 is also a member of the SAC, as are MAD2, BubR1, Bub1, and Mps1 and Bub3 [22]. The various checkpoint proteins can function independently or cooperatively to block the targeting of substrates by APC/CCDC20 [9,23,24]. In fact, Mad2, BubR1, and Bub3dtogether with CDC20dlikely form the mitotic checkpoint complex that inhibits APCCDC20 so that anaphase cannot begin prematurely. Moreover, Bub1 phosphorylates and thus inhibits CDC20 directly, whereas in yeast MAD2 and MAD3, when bound to CDC20, Bub1 triggers its autoubiquitination [25]. This study used bovine oocytes as a model to investigate the function of CDC20 during meiotic division. CDC20 morpholino antisense oligonucleotides (CDC20 MOs) were synthesized and used for downregulating CDC20 expression during bovine oocyte maturation.
W.L. Yang et al. / Theriogenology 81 (2014) 535–544
2. Materials and methods 2.1. Reagents Medium 199 and Insulin-Transferrin-Selenium were from Gibco BRL (Gaithersburg, MD, USA). Sodium pyruvate, BSA, EGF, b-estradiol, L-glutamine, uracil, sodium bicarbonate, HEPES, mineral oil, ionomycin, hyaluronidase, cytochalasin B, 6-dimethylaminopurine (6-DMAP), Hoechst 33342, Triton X-100 and Tween 20 were all from Sigma-Aldrich (St Louis, MO, USA). Human menopausal gonadotropin was from LiZhu Ltd. (Shanghai, P. R. China). Anti-mouse a-tubulin antibody, Cy3-conjugated goat anti-mouse immunoglobulin (Ig)G, and antifade mounting medium were from Beyotime Institute of Biotechnology (Shanghai, P. R. China). Cleavage medium and Serum Protein Substitute were from Sage Biopharma, (Bedminster, NJ, USA). Fetal bovine serum was from Hyclone. CDC20 MOs (50 –CACTCTCGAACACGAACTGGGCCAT–30 ) and control MOs (50 –TACCGGGTCAAGCACAAGCTCTCAC–30 ) were from Gene Tools LLC (Philomath, OR, USA) using the T7 Message Machine kit (Ambion Inc., Austin, TX, USA). 2.2. Oocyte collection and culture in vitro Bovine ovaries from a local slaughterhouse were collected and transported to the laboratory in a thermos flask containing saline (0.9% NaCl, with 100 IU/mL penicillin and 100 mg/mL streptomycin) at 20 C to 24 C within 6 to 8 hours after slaughter. After three washes with the same saline solution prewarmed to 37 C, cumulus–oocyte complexes (COCs) were obtained from 2- to 8-mm diameter follicles using a 10-mL syringe and a 12-ga sterile needle. The follicular fluids were pooled in a sterile centrifuge tube and the collected COCs were dispersed in a 70-mm cell culture dish after three washes using COCs wash solution (medium 199 containing 10% NBS, 2.2 g/L sodium bicarbonate, 10 mmol/L HEPES; pH 7.2–7.4) prewarmed to 37 C. The COCs with multiple layers of cumulus cells were selected under a stereomicroscope for IVM. The COCs were cultured in 500 mL of maturation medium (medium 199 containing 10% BSA, 0.1 IU/ mL human menopausal gonadotropin, 1.0 mg/mL b-estradiol, 50 ng/mL EGF, 50 mg/mL uracil, and 10 mL/mL InsulinTransferrin-Selenium) after three washes in maturation medium at 38.5 C under a humidified atmosphere of 5% CO2 in air. The maturation medium needed to be equilibrated in a CO2 incubator for at least 2 hours before commencing maturation culture. 2.3. Efficiency of interference We cleaved pCDC20-Venus using the restriction enzyme XbaI and the linearized pCDC20-Venus plasmid was used as a template. Full-length CDC20-Venus cRNA was synthesized using a T7 Message Machine kit (Ambion Inc.). To assess the efficiency of interference, one group of oocytes was injected with CDC20 cRNA and another group was co-injected with CDC20 cRNA and CDC20 MOs. After 8 to 10 hours in culture, we captured fluorescence images using the same exposure times. The average fluorescence
537
intensity of each oocyte in each group was measured using Axio Vision Rel. 4.8 software (Carl Zeiss, Oberkochen, Germany). We calculated the average intensity of fluorescence in the two groups, and the interference efficiency of MO function was estimated from the differences between the two groups. 2.4. Microinjection of CDC20/control MOs Some COCs were cultured for 8 to 10 hours in maturation medium (meiosis I oocytes), and the cumulus cells were removed by gentle pipetting in 0.3% hyaluronidase. After 20 minutes in the operating solution (medium 199 containing 10% fetal bovine serum and 7.5 mg/L cytochalasin B), denuded oocytes were moved to 20-mL droplets of operating solution covered with sterile mineral oil. Then, 2 mmol/L of CDC20 MOs were microinjected into the cytoplasm of oocytes with the aim of knocking down CDC20 expression (MO group), The same amounts of control morpholino oligonucleotides were injected into another group of oocytes as control (MO Control group). Another group of oocytes without any injection was used as the negative control (negative control group). After microinjection, the oocytes were removed to fresh operating solution for 20 minutes, and then washed three times in fresh maturation medium. Finally, the oocytes were cultured in fresh maturation medium for next 10 hours. This group of oocytes was used to study the effects of CDC20 downregulation on meiosis I. The other COCs were cultured for 19 to 20 hours, and the cumulus cells were also removed. Oocytes with PB1 were treated the same as the Meiosis I oocytes, including an MO group, an MO control group, and a negative control group. The treated oocytes were cultured in operating solution containing 5 mmol/L ionomycin for 5 minutes at 28 hours. After three washes with fresh solution, the oocytes were moved to 2.5 mmol/L 6-DMAP for 4 hours. Finally, oocytes were cultured in cleavage medium under mineral oil at 38.5 C for 72 hours. The CDC20 MOs were injected using a micropipette with a 5-mm inner diameter. Microinjections were performed using a Leica micromanipulation system (Leica Camera AG, Solms, Germany) and an Eppendorf FemtoJet microinjection system (Hamburg, Germany). These oocytes were used to study the effects of CDC20 downregulation on meiosis II. 2.5. Immunofluorescence staining At the end of each experiment, oocytes were fixed in PBS (pH 7.4) containing 4% paraformaldehyde for at least 30 minutes at room temperature. After being permeabilized with PBS supplemented with 0.5% Triton X-100 at room temperature for 20 minutes, oocytes were blocked in PBS with 1% BSA for 1 hour at room temperature. Oocytes were then incubated with anti-mouse a-tubulin antibody (1:500) overnight at 4 C. After three washes with wash solution (PBS containing 0.1% Tween 20 and 0.01% Triton X-100) for 15 minutes each time, the oocytes were labeled with Cy3-conjugated goat anti-mouse IgG (1:500) for 1 hour at 37 C. After another three washes with wash solution, oocytes were costained with Hoechst 33342 (10 mg/mL)
538
W.L. Yang et al. / Theriogenology 81 (2014) 535–544
for 5 minutes. After three washes with wash solution for 5 minutes each time, the oocytes were mounted on glass slides and examined with a scanning fluorescence microscope (Axiocam MRm; Carl Zeiss, Shanghai, P. R. China). 2.6. Statistical analysis Data from at least three replicates per experiment were analyzed using chi-squared tests. Differences at P < 0.05 (*) and P < 0.01 (**) were considered significant and extremely significant, respectively. 3. Results 3.1. Efficacy of CDC20 MOs in downregulating CDC20 expression Using imaging, we measured the fluorescence intensity at each crossing point of reference lines on the images (Fig. 2). Fluorescence intensities in the CDC20 cRNA injection group and CDC20 MO co-injection group were 178.81 and 34.43, respectively (Fig. 2). The intensity in the cRNA-CDC20 MO co-injection group was 19.26% of the control CDC20 cRNA group, so the efficiency of interference by CDC20 MO microinjection was 80.74%. 3.2. Effect of CDC20 downregulation on first polar body extrusion (PB1E) in bovine oocytes The rates of PB1E in the CDC20 MO, control MO and negative control groups were 11.4% (15/131), 58.2% (64/ 110), and 66.9% (93/139), respectively, after another 14 to 16 hours’ culture in maturation medium (Fig. 3). No more oocytes showed PB1E during subsequent monitoring in the CDC20 MO group. In contrast with the control MO and negative control groups, CDC20 downregulation significantly reduced the rate of PB1E. The PB1E rate of oocytes in the control MO group was lower than in control oocytes but this was not significant. Thus, the mechanical effects of microinjection per se can reduce the rate of PB1E.
Fig. 3. Percentage of the first polar body (PB1) in three groups. Oocytes were microinjected with cell division cycle protein 20 (CDC20) morpholino antisense oligonucleotides (MOs), control MOs, or not at all (negative control group). The percentages of PB1 extrusion (PB1E) in the CDC20 MO, control MO, and negative control groups are shown in the histogram. Data are presented as mean values standard error of the mean. * P < 0.05; ** P < 0.01.
3.3. Abnormal spindles in the CDC20 MO group Immunofluorescence staining showed that oocytes without a PB1 in the CDC20 MO group displayed abnormal spindles (Fig. 4). Many types of abnormal spindles could be seen in oocytes with and without a supplementary PB1. In terms of the oocytes without PB1, the spindles in oocytes were deformed or incomplete compared with the control MO group (Fig. 5A) and negative control group (Fig. 5B). During telophase I, the spindles were dispersed in the CDC20 MO group (Fig. 6A); the DNA was also dispersed (Fig. 6A). Both spindles and DNA distribution showed normal morphologies in oocytes with control MO microinjection (Fig. 6B) and no microinjection (Fig. 6C). 3.4. Oocytes were arrested at the metaphase I stage after CDC20 MO microinjection After microinjection of CDC20 MOs, oocytes were removed to fresh maturation medium for another 14 to 16
Fig. 2. Fluorescence intensity after injection. Fluorescence intensity of oocytes was measured after injection. (A) Oocytes in the cell division cycle protein 20 (CDC20) cRNA injection group and cell division cycle protein 20 (CDC20) cRNA-CDC20 morpholino antisense oligonucleotide (MO) co-injection group under fluorescence microscopy. (B) Oocytes in the CDC20 cRNA-CDC20 MO co-injection group under fluorescence microscopy. (C) This histogram shows the efficiency of interference based on the difference between measurements from A and B.
W.L. Yang et al. / Theriogenology 81 (2014) 535–544
539
Fig. 4. Abnormal spindles in oocytes without the first polar body (PB1) in the cell division cycle protein 20 (CDC20) morpholino antisense oligonucleotide (MO) group. Different shapes of abnormal spindles can be seen in oocytes without PB1 in the CDC20 MO group. Hoechst 33342 staining for DNA suggested that the oocytes were arrested at prometaphase or metaphase I (MI). Some typical deformed spindles and incomplete spindles are shown. Bar ¼ 100 mm.
hours in culture and oocytes with and without a PB1 were distinguished by immunofluorescence staining. Immunofluorescence analysis indicated that most oocytes in the CDC20 MO group were arrested at or just before metaphase I (MI; Fig. 4). Oocytes in the control MO group (Fig. 5A) and negative control group (Fig. 5B) were arrested at MI.
3.5. CDC20 downregulation had no effect on the second meiotic division Oocytes cultured for 19 to 20 hours with an additional PB1 were microinjected with 2 mmol/L CDC20 MOs or control MOs. After stimulating parthenogenetic division,
540
W.L. Yang et al. / Theriogenology 81 (2014) 535–544
Fig. 5. Normal spindles in oocytes without the first polar body (PB1) in the cell division cycle protein 20 (CDC20) morpholino antisense oligonucleotide (MO) group. (A) These oocytes were microinjected with 2 mmol/L of control MOs. (B) Negative control oocytes were not microinjected with anything. The spindles and DNA are illustrated by immunofluorescence and Hoechst 33342 staining, respectively. Both the spindles and DNA were regular in appearance and showed the typical features of MI in A and B. The oocytes were arrested at MI. Bar ¼ 100 mm.
embryos were moved to cleavage medium for 72 hours culture. The cleavage rates in the CDC20 MO, control MO, and negative control groups were 73% (64/88), 86.8% (99/ 114), and 86% (86/100), respectively (Fig. 7). There were no anomalous divisions (Fig. 8). 4. Discussion During oocyte maturation, a decrease in APC/CCDH1 activity through an increase in maturation promotion factor, and a reduction in CDH1 allows the resynthesis of CDC20. Then APC/CCDC20 starts the degradation of securin and cyclin B1, thus allowing homologous chromosomal segregation during oocyte maturation [3]. Functional defects in the SAC system can lead to missegregation of chromosomes, generating aneuploidy. Mutations and deregulated expression of many SAC genes have been found in cancer tissues [26–28]. Thus, CDC20 overexpression has been observed in various cancer tissues [29] and is reported to cause aneuploidy by premature anaphase onset in cancer cells [30]. CDC20 hypomorphic female mice are infertile or subfertile despite showing normal oogenesis, and their embryos fail to develop into blastocysts because the oocytes and embryos are aneuploid [31]. Expression of MAD2 binding-deficient and thereby SAC-defective mutant CDC20 promotes tumor formation in mice [32]. These findings suggest that proper function of CDC20 is crucial for the orderly execution of cell division. The CDC20 family of conserved proteins is essential for the activation of APC/C [33].The role of CDC20 in recruiting
substrates to APC/C through their C-terminal WD40 domain is well-established [25]. In addition to substrate recruitment, the N-terminal C box of CDC20 was also found to trigger substrate ubiquitination by APC/C [34,35]. Moreover, in a genome-wide silencing (si)RNA screening, CDC20 knockdown resulted in mitotic defects [36]. The resumption of meiotic division correlates to genitor-hormones tightly, previous study suggested that genitor-hormones and growth factors such as FSH, LH, and EGF can lead to resumption of meiotic division [37,38]. We assumed that these matters may induce CDC20 mRNA transcription or priming some meiotic division signal pathways. Finally, it caused activation of CDC20. In one’s whole life, meiotic division is merely a phenomenon of effect generated by these matters. Furthermore, it includes a series of reactions: empathema, pregnancy, parturition, lactation, and so on. 4.1. CDC20 downregulation in bovine oocytes decreased the rate of PB1E In contrast with the control MO and negative control groups, CDC20 downregulation significantly impaired the PB1E rate Thus, CDC20 knockdown specifically blocked PB1E; this result is similar to the results of Reis, et al. [3] but not to those of Yin, et al. [39]. We presume that once CDC20 was absent, low APC/CCDC20 activation could not trigger securin degradation, so the inactivated separase was unable to break down cohesin and this prevented normal chromosomal segregation.
W.L. Yang et al. / Theriogenology 81 (2014) 535–544
541
Fig. 6. Irregular spindles in the oocytes during telophase I. Irregular spindles appeared in the oocytes during telophase I in the cell division cycle protein 20 (CDC20) morpholino antisense oligonucleotide (MO) group (A) but not in the control MO group (B) or negative control group (C). In contrast with the CDC20 MO group, spindles appearing in the microinjected first polar body (PB1) in control MO group and negative control group were regular in morphology. The DNA profiles were regular in secondary oocytes in all groups but DNA was dispersed in the PB1 only in the CDC20 MO group. Bar ¼ 100 mm.
4.2. Oocytes arrested before or at MI after CDC20 MO microinjection Our results suggest that CDC20 plays an important role during bovine oocyte meiotic maturation and indicates
Fig. 7. Percentage of the first polar body extrusion (PB1E) in three groups. This histogram shows the oocyte cleavage rates in the cell division cycle protein 20 (CDC20) morpholino antisense oligonucleotide (MO), control MO and negative control groups after 72 hours in culture.
that CDC20 is essential for spindle assembly and the MI–TI transition. When the maturation promotion factor activity rises during meiosis I, APC/CCDH1 activity is switched off, CDC20 levels start to rise and this causes both securin and cyclin B degradation, finally leading to chromosome separation and the onset of anaphase [3,40,41]. Why were the oocytes in our study arrested at prometaphase or MI with abnormal spindles after injecting CDC20 MOs? There might be a pathway between spindle assembly and chromosome activity for such communication. Because CDC20 is a member of this system, we surmise that its depletion interrupted the pathway and caused the spindle to fail to attach to the chromosomes. At the same time, failed attachment between chromosome kinetochores and the spindle might activate the SAC, so the cell cycle would have arrested at MI. Mice lacking CDC20 showed failed embryogenesis: the embryos were arrested in metaphase at the two-cell stage with high levels of cyclin B1 [42]. In budding yeast, the deletion of CDC20 causes metaphase arrest [43]. CDC20 hypomorphism prolongs metaphase I [31] and delays the onset of anaphase [44]. CDC20 antisense RNA causes
542
W.L. Yang et al. / Theriogenology 81 (2014) 535–544
Fig. 8. Cleavaged oocytes after 24 hours in culture. Oocytes in (A) the cell division cycle protein 20 (CDC20) morpholino antisense oligonucleotide (MO) group, (B) the control MO group, and (C) the negative control group after 24 hours in culture. Oocytes with a supplementary first polar body (PB1) were microinjected with CDC20 MOs or control MOs; oocytes in the negative control group were not microinjected with anything. Oocytes were cultured in cleavage medium for 24 hours after the induction of parthenogenesis, corresponding with the two-cell stage in normal embryos. Nuclear and cytoplasmic divisions were synchronous in all groups and no anomalous division appeared. Bar ¼ 100 mm.
mitotic arrest in human cells [45]. CDC20-null mouse embryos die at the two-cell stage because of permanent metaphase arrest [46]. During prometaphase, kinetochores that detach from the spindle microtubules generate a waiting signal to spur the formation of protein complexes including CDC20, MAD2, MAD3, and Bub3, acting to inhibit the APC. As a consequence, securin cannot be hydrolyzed, separase cannot be activated, and the sister chromatids cannot separate [41,47]. When spindle assembly is impaired, chromosomal movement is halted. Thus, after oocytes were injected with CDC20 MOs, no spindle microtubules could attach to the waiting chromosomes and the oocytes arrested at prometaphase or MI. 4.3. CDC20 downregulation caused impairment of spindle assembly Our results indicate that CDC20 participates in spindle formation. Its deletion caused severe impairment of spindle assembly and a variety of abnormal spindles could be seen in oocytes injected with CDC20 MOs (Fig. 4). Cytoskeletal elements including microtubules and microfilaments are widely involved in many events during
oocyte polarization [48]. We propose that, during chromosomal feedback of information regarding spindle assembly and in the absence of CDC20, the signal pathway discontinues and spindle assembly is stopped. Both the segregation of homologous chromosomes and sister chromatids rely on the pulling forces generated by microtubules attached to centromeric chromatin at kinetochores. Once the spindle is impaired, it prevents normal segregation of homologous chromosomes and sister chromatids. A previous study showed that the enzyme Aurora A regulates both centrosome maturation and bipolar spindle assembly [49]. Aurora A degradation is delayed after injection of siRNA for CDC20 downregulation, the reasons for which are not clear [50]. How is information exchanged between CDC20 downregulation and Aurora A degradation? This may help to answer why CDC20 downregulation caused impairment of spindle assembly. 4.4. CDC20 only plays its role in the first, but not the second meiotic division When the same amounts of CDC20 MOs were microinjected into MII oocytes together with an additional PB1,
W.L. Yang et al. / Theriogenology 81 (2014) 535–544
the rates of PN formation and first cleavage were no different from the control MO and negative control groups. This result suggests that CDC20 plays its role in the first but not the second meiotic division. It also means that MI is more sensitive to CDC20. The segregation of homologous chromosomes and sister chromatids are different and involve different mechanisms. In contrast with the second meiotic division (meiosis II), the first meiotic division (meiosis I) is more important in mammalian oocytes. Knockdown of CDC20 in primary oocytes suggests that APC/CCDC20 is active in late meiosis I and drives oocytes into anaphase [51]. Thus, the role of CDC20 is different during meiosis I and II. 5. Conclusions Our data suggest that CDC20 is required for spindle assembly, chromosomal segregation, and PB1 extrusion during meiosis I of bovine oocyte maturation, but when the same amounts of CDC20 MOs were microinjected into MII oocytes with a supplementary PB1, the rates of PN formation and first cleavage were no different from the control MO and negative control groups. Thus, the role of CDC20 differs between meiosis I and II.
Acknowledgments This study was supported by the National Natural Science Foundation of China (31172280). The funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. Image manipulation: Blotches in images were manipulated by Photoshop in purpose of clarity and beauty, and then combined corresponding images together.
References [1] Weinstein J, Jacobsen FW, Hsu-Chen J, Wu T, Baum LG. A novel mammalian protein, p55CDC, present in dividing cells is associated with protein kinase activity and has homology to the Saccharomyces cerevisiae cell division cycle proteins Cdc20 and Cdc4. Mol Cell Biol 1994;14:3350–63. [2] Weinstein J. Cell cycle-regulated expression, phosphorylation, and degradation of p55Cdc. A mammalian homolog of CDC20/Fizzy/slp1. J Biol Chem 1997;272:28501–11. [3] Reis A, Madgwick S, Chang HY, Nabti I, Levasseur M, Jones KT. Prometaphase APCcdh1 activity prevents non-disjunction in mammalian oocytes. Nat Cell Biol 2007;9:1192–8. [4] Santaguida S, Musacchio A. The life and miracles of kinetochores. EMBO J 2009;28:2511–31. [5] Peters JM. The anaphase promoting complex/cyclosome: a machine designed to destroy. Nat Rev Mol Cell Biol 2006;7:644–56. [6] Prinz S, Hwang ES, Visintin R, Amon A. The regulation of Cdc20 proteolysis reveals a role for APC components Cdc23 and Cdc27 during S phase and early mitosis. Curr Biol 1998;8:750–60. [7] Visintin R, Prinz S, Amon A. CDC20 and CDH1: a family of substratespecific activators of APC-dependent proteolysis. Science 1997;278: 460–3. [8] Fang G, Yu H, Kirschner MW. The checkpoint protein MAD2 and the mitotic regulator CDC20 form a ternary complex with the anaphasepromoting complex to control anaphase initiation. Genes Dev 1998; 12:1871–83. [9] Fang G. Checkpoint protein BubR1 acts synergistically with Mad2 to inhibit anaphase-promoting complex. Mol Biol Cell 2002;13:755– 66.
543
[10] Mao Y, Abrieu A, Cleveland DW. Activating and silencing the mitotic checkpoint through CENP-E-dependent activation/inactivation of BubR1. Cell 2003;114:87–98. [11] Zhou J, Yao J, Joshi HC. Attachment and tension in the spindle assembly checkpoint. J Cell Sci 2002;115:3547–55. [12] Chow C, Wong N, Pagano M, Lun SW, Nakayama KI, Nakayama K, et al. Regulation of APC/C(Cdc20) activity by RASSF1A-APC/C(Cdc20) circuitry. Oncogene 2012;31:1975–87. [13] Reis A, Levasseur M, Chang HY, Elliott DJ, Jones KT. The CRY box: a second APCcdh1-dependent degron in mammalian cdc20. EMBO Rep 2006;7:1040–5. [14] Hartwell LH, Culotti J, Reid B. Genetic control of the cell-division cycle in yeast. I. Detection of mutants. Proc Natl Acad Sci USA 1970;66:352–9. [15] Hartwell LH, Mortimer RK, Culotti J, Culotti M. Genetic control of the cell division cycle in yeast: V. Genetic analysis of cdc mutants. Genetics 1973;74:267–86. [16] King RW, Peters JM, Tugendreich S, Rolfe M, Hieter P, Kirschner MW. A 20S complex containing CDC27 and CDC16 catalyzes the mitosis-specific conjugation of ubiquitin to cyclin B. Cell 1995;81:279–88. [17] Sudakin V, Ganoth D, Dahan A, Heller H, Hershko J, Luca FC, et al. The cyclosome, a large complex containing cyclin-selective ubiquitin ligase activity, targets cyclins for destruction at the end of mitosis. Mol Biol Cell 1995;6:185–97. [18] de Rooij DG, de Boer P. Specific arrests of spermatogenesis in genetically modified and mutant mice. Cytogenet Genome Res 2003;103:267–76. [19] Brunet S, Pahlavan G, Taylor S, Maro B. Functionality of the spindle checkpoint during the first meiotic division of mammalian oocytes. Reproduction 2003;126:443–50. [20] Homer HA, McDougall A, Levasseur M, Murdoch AP, Herbert M. RNA interference in meiosis I human oocytes: towards an understanding of human aneuploidy. Mol Hum Reprod 2005;11:397–404. [21] Wassmann K, Niault T, Maro B. Metaphase I arrest upon activation of the Mad2-dependent spindle checkpoint in mouse oocytes. Curr Biol 2003;13:1596–608. [22] Decordier I, Cundari E, Kirsch-Volders M. Mitotic checkpoints and the maintenance of the chromosome karyotype. Mutat Res 2008; 651:3–13. [23] Sudakin V, Chan GK, Yen TJ. Checkpoint inhibition of the APC/C in HeLa cells is mediated by a complex of BUBR1, BUB3, CDC20, and MAD2. J Cell Biol 2001;154:925–36. [24] Tang Z, Bharadwaj R, Li B, Yu H. Mad2-Independent inhibition of APCCdc20 by the mitotic checkpoint protein BubR1. Dev Cell 2001; 1:227–37. [25] Yu H. Cdc20: a WD40 activator for a cell cycle degradation machine. Mol Cell 2007;27:3–16. [26] Weaver BA, Cleveland DW. Does aneuploidy cause cancer? Curr Opin Cell Biol 2006;18:658–67. [27] Yuan B, Xu Y, Woo JH, Wang Y, Bae YK, Yoon DS, et al. Increased expression of mitotic checkpoint genes in breast cancer cells with chromosomal instability. Clin Cancer Res 2006;12:405–10. [28] Yuen KW, Montpetit B, Hieter P. The kinetochore and cancer: what’s the connection? Curr Opin Cell Biol 2005;17:576–82. [29] Rhodes DR, Yu J, Shanker K, Deshpande N, Varambally R, Ghosh D, et al. Large-scale meta-analysis of cancer microarray data identifies common transcriptional profiles of neoplastic transformation and progression. Proc Natl Acad Sci USA 2004;101:9309–14. [30] Mondal G, Sengupta S, Panda CK, Gollin SM, Saunders WS, Roychoudhury S. Overexpression of Cdc20 leads to impairment of the spindle assembly checkpoint and aneuploidization in oral cancer. Carcinogenesis 2007;28:81–92. [31] Jin F, Hamada M, Malureanu L, Jeganathan KB, Zhou W, Morbeck DE, et al. Cdc20 is critical for meiosis I and fertility of female mice. PLoS Genet 2010;6. [32] Li M, Fang X, Wei Z, York JP, Zhang P. Loss of spindle assembly checkpoint-mediated inhibition of Cdc20 promotes tumorigenesis in mice. J Cell Biol 2009;185:983–94. [33] Pesin JA, Orr-Weaver TL. Regulation of APC/C activators in mitosis and meiosis. Annu Rev Cell Dev Biol 2008;24:475–99. [34] Benanti JA, Toczyski DP. Cdc20, an activator at last. Mol Cell 2008; 32:460–1. [35] Kimata Y, Baxter JE, Fry AM, Yamano H. A role for the Fizzy/Cdc20 family of proteins in activation of the APC/C distinct from substrate recruitment. Mol Cell 2008;32:576–83. [36] Neumann B, Walter T, Heriche JK, Bulkescher J, Erfle H, Conrad C, et al. Phenotypic profiling of the human genome by time-lapse microscopy reveals cell division genes. Nature 2010;464:721–7.
544
W.L. Yang et al. / Theriogenology 81 (2014) 535–544
[37] Yang J, Fu M, Wang S, Chen X, Ning G, Xu B, et al. An antisense oligodeoxynucleotide to the LH receptor attenuates FSH-induced oocyte maturation in mice. Asian-Aust J Anim Sci 2008;21:8. [38] Chen X, Zhou B, Yan J, Xu B, Tai P, Li J, et al. Epidermal growth factor receptor activation by protein kinase C is necessary for FSH-induced meiotic resumption in porcine cumulus-oocyte complexes. J Endocrinol 2008;197:409–19. [39] Yin S, Liu JH, Ai JS, Xiong B, Wang Q, Hou Y, et al. Cdc20 is required for the anaphase onset of the first meiosis but not the second meiosis in mouse oocytes. Cell Cycle 2007;6:2990–2. [40] Holt JE, Jones KT. Control of homologous chromosome division in the mammalian oocyte. Mol Hum Reprod 2009;15:139–47. [41] Yu H. Regulation of APC-Cdc20 by the spindle checkpoint. Curr Opin Cell Biol 2002;14:706–14. [42] Li M, York JP, Zhang P. Loss of Cdc20 causes a securin-dependent metaphase arrest in two-cell mouse embryos. Mol Cell Biol 2007; 27:3481–8. [43] Lim HH, Goh PY, Surana U. Cdc20 is essential for the cyclosomemediated proteolysis of both Pds1 and Clb2 during M phase in budding yeast. Curr Biol 1998;8:231–4. [44] Malureanu L, Jeganathan KB, Jin F, Baker DJ, van Ree JH, Gullon O, et al. Cdc20 hypomorphic mice fail to counteract de novo synthesis of cyclin B1 in mitosis. J Cell Biol 2010;191:313–29.
[45] Qi W, Yu H. KEN-box-dependent degradation of the Bub1 spindle checkpoint kinase by the anaphase-promoting complex/cyclosome. J Biol Chem 2007;282:3672–9. [46] Li M, Shin YH, Hou L, Huang X, Wei Z, Klann E, et al. The adaptor protein of the anaphase promoting complex Cdh1 is essential in maintaining replicative lifespan and in learning and memory. Nat Cell Biol 2008;10:1083–9. [47] Skoufias DA, Andreassen PR, Lacroix FB, Wilson L, Margolis RL. Mammalian mad2 and bub1/bubR1 recognize distinct spindleattachment and kinetochore-tension checkpoints. Proc Natl Acad Sci USA 2001;98:4492–7. [48] Brunet S, Verlhac MH. Positioning to get out of meiosis: the asymmetry of division. Hum Reprod Update 2011;17 :68–75. [49] Ducat D, Zheng Y. Aurora kinases in spindle assembly and chromosome segregation. Exp Cell Res 2004;301:60–7. [50] Gurden MD, Holland AJ, van Zon W, Tighe A, Vergnolle MA, Andres DA, et al. Cdc20 is required for the post-anaphase, KENdependent degradation of centromere protein F. J Cell Sci 2010; 123:321–30. [51] Homer H, Gui L, Carroll J. A spindle assembly checkpoint protein functions in prophase I arrest and prometaphase progression. Science 2009;326:991–4.
