Plant MolecularBiology12: 123-130, 1989 © 1989KluwerAcademicPublishers. Printedin the Netherlands

123

cDNA cloning of an mRNA encoding a sulfur-rich 10 kDa prolamin polypeptide in rice seeds Takehiro Masumura, Daisuke Shibata* Takashi Hibino, Tomohiko Kato, Koichi Kawabe, Go Takeba, Kunisuke Tanaka and Shoji Fujii

Department of Biochemistry, College of Agricultural Chemistry, Kyoto Prefectural University, Shimogamo, Kyoto 606, Japan (*authorfor correspondence) Received 10 June 1988;accepted in revised form 17 October 1988

Key words: rice, prolamin, storage protein, sulfur-rich polypeptide, cDNA cloning, DNA sequence Abstract Using a rice maturing seed pUC9 expression library, we isolated a cDNA clone corresponding to 10 kDa sulfurrich prolamin by immunoscreening. A longer cDNA clone was obtained from a kgtll library by plaque hybridization using this 32p-labeled cDNA as a probe. A polypeptide sequence composed of 134 amino acids was deduced from the nucleotide sequence. A 24 amino acid signal peptide was assigned by computer calculation for the membrane spanning region and Edman sequencing of the purified mature polypeptide. Remarkably, 20% of methionine and 10% of cysteine were found in the mature polypepfide as well as high contents of glutamine, and hydrophobic amino acids. Part of the amino acid sequence was homologous with a conserved cysteine-rich region found in other plant prolamins. Two repeats of amino acid sequence were found in the polypeptide.

Introduction Alcohol-soluble protein, prolamin, found in monocotyledonous seeds is the major storage protein in most cereals. By improving the extraction method of prolamin, we demonstrated that the content of prolamin in rice seeds is much higher than has been reported. When 5507o n-propanol was used for extraction, the level of prolamin extracted from rice seeds was about four times higher than when the seeds were extracted with 70°7o ethanol, which is often used to extract prolamins from various grains [32]. This indicates that rice prolamin as well as glutelin [38] are major seed proteins. Accumulation of prolamin in the protein body was shown in many cereal endosperms such as maize [3], wheat [26], and barley [4]. We demonstrated that

rice endosperm has two kinds of protein bodies, called PB-I and PB-II, in the same cell [34]. Only a single type of protein body has been reported in other cereals. Rice prolamin polypeptides of I0, 13 and 16 kDa, located in PB-I, form a spherical concentric ring structure 1 to 2/zm in diameter [21]. The other major storage protein, glutelin, exists in PB-II, and has an ovary shape, 3 to 4 #m in diameter, with no apparent internal organization [21, 31, 34]. Poor digestibility of. PB-I upon passage through the human digestive tract was shown as more than 30°70 of the proteinous particles of cooked rice was excreted in human feces [35]. Our in vitro digestion experiment with bovine pepsin showed that more than 20o7o (vat. japonica) or 30o7o (var. indica) of the protein bodies in polished rice is indigestible [16]. Therefore, an important objective is to enhance the

124 nutritionally available level of protein in rice. A goal to be achieved is to understand both the structures of the protein bodies and characteristics of the storage proteins. Rice prolamin genes have not been cloned whereas the genes of other cereal prolamins such as zein (maize) [20, 24, 25], gliadin (wheat) [22] and hordein (barley) [6] have been isolated and well characterized. High contents of glutamine, proline, and hydrophobic amino acids, and the complex polypeptide composition of rice prolamin as well as other prolamins have been reported [21, 37]. When poly(A) + RNA from developing rice seeds was used for in vitro protein synthesis in a wheat germ cell-free system, two prolamins (16 kDa) and 10 kDa) were labeled strongly with 35S-methionine although a major prolamin component, 13 kDa prolamin, was strongly labeled with 14C-leucine but weakly by 35S-methionine [37]. This implies that 16 kDa and 10 kDa prolamins are methionine-rich. In this study, we isolated a full-length cDNA encoding the 10 kDa prolamin and show an extremely high content of sulfur-rich amino acids. This is the first report of a complete cloning of a rice prolamin gene.

Materials and methods

Plant material Oryza sativa L. var. japonica cv. Nipponbare was cultured at the Rice Experiment Field of Kyoto Prefectural University from the beginning of June to the middle of September 1986. Plants flowered at the beginning of September and the ripening seeds were harvested on 10 September and used directly or stored in liquid nitrogen until used for RNA preparation.

Isolation of poly(A) + R N A Messenger RNA was isolated from the ripening rice seeds by several phenol extractions followed with oligo(dT)-cellulose chromatography as previously described [37].

Synthesis of cDNA and construction of cDNA library The cDNA was synthesized by the method of Gubler and Hoffman [7] with minor modifications developed by Dr R. Nichols of Purdue University, which has been used to construct soybean cDNA libraries [30]. Reaction mixtures (20 t~l) contained 50 mM Tris-HCl (pH 8.3 at 42°C), 140 mM KCI, 10 mM MgCI2, 30 mM dithiothreitol (DTT), 1.25 mM each of dGTP, dATP, dTTP, and dCTP, 0.1 mg/ml oligo(dT)12_ls, 1 mg/ml poly(A) + RNA, 2000 units/ml RNasin (Promega) and 2500 units/ml AMV reverse transcriptase (Life science). Incubation was carried out at 42°C for 90 min. The reaction mixture was diluted to a final volume of 100 ~tl containing 26 mM Tris-HC1 (pH 7.2 at 12°C), 108 mM KCI, 24 mM MgC12, 0.25 mM each of dGTP, dATP, dTTP, and dCTP, 6 mM DTT,0.05 mg/ml nuclease-free bovine serum albumin (BSA; PL-Biochemicals), 0.15 mM /3-NAD, 10 mM ammonium sulfate, 300 units/ml Escherichia coil DNA polymerase, and 10 units/ml E. coli RNase H. The reaction mixture was incubated for 1 hour at 12°C, and subsequently for 1 hour at 22°C. After phenol extraction, double-stranded cDNA was precipitated twice with ethanol in the presence of ammonium acetate to remove unincorporated dNTPs. An initial library containing 30000 independent recombinants was constructed by using oligo(dG)-tailed pUC9 (Pharmacia) as a vector after oligo(dC) tailing of the synthesized cDNAs [23] and transforming E. coli DH5e¢ with the method of Hanahan [9]. The second library was constructed by the method of Young and Davis [39] with kgtll as a vector. The double-stranded cDNA was methylated with Eco RI methylase, ligated to Eco RI linkers, digested with Eco RI, and fractionated to obtain cDNAs longer than 500 base pairs in 5°/o polyacrylamide gel. The DNA was eluted from the gel with an electroeluter (IBI) and ligated with dephosphorylated kgtll, Eco RI arms (Stratagene Cloning Systems). The k DNA was packaged by using the in vitro packaging mixture (Gigapack Gold, Stratagene Cloning Systems) according to the protocol of the supplier. Approximately 100000 recombinants were amplified and stored at 4°C.

125

Immunoscreening The pUC9-cDNA library was screened by using rabbit antibody raised against I0 kDa rice prolamin with the method of Helfman et al. [10].

Screening the hgtll library By using a 32p-labeled pHIB fragment (see Results), the ~gtll library was screened to obtain longer cDNAs by plaque hybridization [19]. Isolated ?~ phages were purified by using an immunoaffinity adsorbent (LambdaSorb, Promega). cDNA inserts were subcloned into pUCII9 (Takara Shuzou Co.) at the Eco RI site and mapped with restriction enzymes.

Hybridization release translation Alkaline-denatured plasmid DNA containing the cDNA insert (20 ~g) was fixed on a nitrocellulose filter and used to select a single species of mRNA from 100/~g of poly(A) ÷ RNA prepared from the ripening rice seeds by the method of hybridization selection [19]. The recovered mRNA fraction was translated in a wheat germ cell-free system (Amersham) using (3H)-leucine [28]. The products were fractionated by SDS-PAGE and detected by fluorography [2].

directions. The internal portions of cDNAs were sequenced after subcloning into pUC9 or pUCll9. Computer analysis of nucleotide and amino acid sequence was carried out by using programs of IDEAS [13] which was provided by Dr. M. Kanehisa at The Calculation Center of Kyoto University. Calculation of the membrane-spanning region of the protein was done with ALOM [14] that is one of the programs of IDEAS.

Northern blot analysis Poly(A) +RNA (10#g) was denatured with methylmercuric hydroxide and spearated by electrophoresis in 1.5°70 agarose gel [19]. As size marker, rat globin RNA and BMV RNAs (kindly provided by Dr I. Furusawa, Kyoto University), were placed on the same gel. The RNA was transferred to nylon membrane (Hybond N, Amersham) by using 6× SSPE (0.9 M NaC1, 60 mM NaH2PO4, 6 mM EDTA, pH 7.4), immobilized by irradiation on a standard u.v. transilluminator for 5 min. Prehybridization was carried out in 50% formamide, 5× SSPE, 5× Denhardt's solution, 0.1% SDS, 100 tzg/ml denatured salmon sperm DNA at 42°C for 20 hours and then the 32P-labeled probe was added into the prehybridization solution. Hybridization was done at 42 °C for 20 hours. After washing in 1 × SSC (0.15 M NaC1, 0.015 M sodium citrate) containing 0.1% SDS at 42 °C, the filter was exposed with X-ray film.

DNA sequence analysis Protein purification and amino acid sequencing The sequences of double-stranded cDNA inserts on pUC9 or pUCII9 were determined from both directions with the "supercoil sequencing" method [5] with minor modification. Plasmid (5 tzg) was denatured in 20/A of 0.2 M NaOH and 0.2 mM EDTA at 56 °C for 10 min. The DNA was precipitated with 8 tA of 5 M ammonium acetate (pH 4.5) and 100 t~l of ethanol at -80 °C, rinsed with 70°7oethanol, dried in vacuo, and dissolved in 10/~1 of water. The DNA solution was immediately used for the dideoxy chain termination method [29] with synthetic primers for sequencing pUC plasmids to determine from both

Rice seeds (100 g) harvested 10 days after flowering were homogenized with an electrically driven coffee mill with 10 mM Tris-HC1, 1 mM EDTA, 1070(v/v) Triton X-100 (pH 7.5). The husks and large debris were removed by filtration through four layers of gauze. The filtrate was centrifuged at 200×g for 5 min to remove starch granules. The supernatant was further centrifuged at 8000 × g for 20 min to obtain a crude protein-body fraction. The fraction was fractionated by SDS-PAGE. Prolamin polypeptides in the gel were visualized by precipita-

126 tion with 1 M KCI [8]. A gel portion containing 10 kDa prolamin was excised and immersed in 1% (w/v) SDS solution to extract the protein. After dialysis with water, the protein was lyophylized. A m i n o acid sequencing was performed on an Applied Biosystems model 470A protein sequencer according to the manufacturer's protocols.

Results

Isolation of cDNAs Ten thousand colonies bearing recombinant plasmid containing e D N A for m R N A from ripening rice seeds were screened by using an anti-rabbit IgG raised against rice prolamin. One positive clone, pHIB, was isolated and characterized further by a hybridization release translation experiment. The in vitro translated product in wheat germ cell-free system showed the same size as the unprocessed 10 kDa prolamin precursor which was extracted by 60% npropanol from total products (Fig. 1). These results and the coincidence with the deduced and determined amino-terminal sequences as shown below indicate that p H I B encodes the 10 kDa prolamin. As p H I B lacks the 5' nucleotide sequence, we screened a ripening-seed Xgtll e D N A library to obtain longer cDNAs by using p H I B as a probe. Twenty positive clones were isolated. The longest e D N A (XRP10) a m o n g them was subcloned into p U C l l 9 at the Eco RI site and analyzed further.

Fig. 1. Identification of cloned eDNA using hybridization release translation. Lane a: 60°70 n-propanol extract from total translation products directed by poly(A)+ RNA from rice seeds (10 days after flowering). Lane b: total translation products. Lane c: Translation products of mRNA released from pHIB eDNA. Lane d: translation product of mRNA released from pUC9 DNA. The mRNA was translated in a wheat germ system and the 3H-labeled products were separated on a 13.5% SDSpolyacrylamidegel and fluorographed. The precursor of 10 kDa prolamin is marked by a star. The numbers refer to the positions of polypeptides appearing in the ripening rice endosperm.

Assignment of signal peptide and mature protein sequence The nucleotide sequence of XRP10 around the first AUG, A G C A A U G G C , which follows a long open

Nucleic acid sequence analysis The complete nucleotide sequence of both XRP10 and p H I B were determined for both coding and noncoding strands (Fig. 2 and 3). The sequence of p H I B (483 bp without poly(A) tail) was included in that of XRP10 (562 bp without poly(A) tail). As Northern blot analysis indicated that the e D N A clone hybridized to a single m R N A species of approximately 790 bases (Fig. 4), the length of the e D N A is close to the size of m R N A minus poly(A). A putative polyadenylation signal (AATAAA) was found 29 nucleotide upstream from the poly(A) tail.

5'

V//A

'

" >

'

t

'-i

~,pHIB >

~.RPIO '

100 bp i

Fig. 2. Restriction endonuclease map and sequence strategy of rice 10 kDa prolamin cDNAs. The boxed region encodes an open reading frame. The hatched region designatesthe sequencecoding for the signal peptide. The direction and extent of sequence determinations are shown by horizontal arrows.

127 I 51

CGTCTACACCATCTGGAATCTTGTTTAACACTAGTATTGTAGAATCAGCA ATG.GCA.GCA.TAC.ACC.AGC.AAG.ATC.TTT.GCC.CTG.TTT.GCC.TTA.ATT.GCT.CTT.TCT.GCA.AGT Met-Ala-Ala-Tyr-Thr-Ser-Lys-Ile-Phe-Ala-Leu-Phe-Ala-Leu-Ile-Ala-Leu-Ser-Ala-Ser

20

111GCC.ACT.ACT.GCA.ATC.ACC.ACT.ATG.CAG.TAT.TTC.CCA.CCA.ACA.TTA.GCC.ATG.GGC.ACC.ATG Ala-Thr-Thr-AlaAIle-Thr-Thr-Met-Gln-Tyr-Phe-Pro-Pro-Thr-Leu-Ala-Met-Gly-Thr-Met

40

171 G A T . C C G . T G T . A G G . C A G . T A C . A T G . A T G . C A A . A C G . T T G . G G C . A T G . G G T . A G C . T C C . A C A . G C C . A T G . T T C Asp-Pro-Cys-Arg-Gln-Tyr-Met-Met-Gln-Thr-Leu-Gly-Met-Gly-Ser-Ser-Thr-Ala-Met-Phe

60

231ATG.TCG.CAG.CCA.ATG.GCG.CTC.CTG.CAG.CAG.CAA.TGT.TGC.ATG.CAG.CTA.CAA.GGC.ATG.ATG Met-Ser-Gln-Pro-Met-Ala-Leu-Leu-Gln-Gln-Gln-Cys-Cys-Met-Gln-Leu-Gln-Gly-Met-Met

80

291 C C T . C A G . T G C . C A C . T G T . G G C . A C C . A G T . T G C . C A G . A T G . A T G . C A G . A G C . A T G . C A A . C A A . G T T . A T T . T G T Pro-Gln-Cys-His-Cys-Gly-Thr-Ser-Cys-Gln-Met-Met-Gln-Ser-Met-Gln-Gln-Val-Ile-Cys

100

351 G C T . G G A . C T C . G G G . C A G . C A G . C A G . A T G . A T G . A A G . A T G . G C G . A T G . C A G . A T G . C C A . T A C . A T G . T G C . A A C Ala-Gly-Leu-Gly-Gln-Gln-Gln-Met-Met-Lys-Met-Ala-Met-Gln-Met-Pro-Tyr-Met-Cys-Asn

120

411 A T G . G C C . C C T . G T C . A A C . T T C . C A A . C T C . T C T . T C C . T G T . G G T . T G T . T G T . T G A T C A A A C G T T G G T T A C A T G T A M e t - A l a - P r o - V a l - A s n - p h e - G l n - L e u - S e r - S e r - C y s - G l y - C y s - C y s ***

134

476 CTCTAGTAATAAGGTGTTGCATACTATCGTGTGCAAACACTAGAAATAAGAACCATT~TATCAATCATTTTC 555 A G A C T T G C A A A A A A A A A A A A A A A A A A

Fig. 3. Nucleotide and deduced amino acid sequences of the rice 10 kDa prolamin cDNA. The nucleotide and the deduced amino acid sequences are indicated. The amino terminal segment of the mature rice 10 kDa prolamin is underlined. The stop codon is marked by asterisks. The putative pol~denylation signal is boxed. An arrowhead indicates the cleavage site of the signal sequence.

reading flame encoding 134 amino acids, is very similar to the consensus sequence surrounding the AUG initiation codon for plant, AACAAUGGC [18], rather than "eukaryotic" consensus sequence, ACCAUGG, proposed by Kozak [15]. We have assigned the first AUG as the initiation codon. We purified a 10 kDa prolamin polypeptide from the protein body, which was isolated from the ripening rice seeds, by polyacrylamide gel fractionation, and subjected tQ amino acid microsequencing. The amino-terminal sequence determined was Ile-ThrThr-Met, which was located from 25 to 28 in the deduced amino acid sequence. This indicated that the polypeptide was synthesized as a precursor with a signal peptide consisting of 24 amino acids. The amino acid sequence of the peptide was hydrophobic and homologous with the signal peptides of zein 19 kDa prolamin [20] (Fig. 5). Calculation of membrane spanning region of the prepolypeptide with computer by using a program, IDEAS [13], which is based on the discrimination analysis by using the hydropathy index of Kyte and Doolittle [17], indicated that the amino acid seouence from 5 to 24 was located in the membrane.

When the translation of an mRNA selected with pHIB cDNA was carried out in the presence of canine pancreatic microsomal membrane, the length of the removed peptide was close to that of the hydrophobic peptide (data not shown). These results indicated that the peptide was a signal peptide for secretion into the membrane.

Fig. 4. Northern blot analysis of rice seed mRNA with a cDNA probe. Poly(A) + RNAs (10/zg) from the ripening endosperm of rice seeds (10 days after flowering) were fractionated by an agarose gel and transferred to a nylon membrane. The blot was probed with a riP-labeled rice 10 kDa prolamin cDNA. The numbers refer to the oligomer length (nucleotides) as compared to the migration of bromo mosaic virus RNAs (2865, 2117, and 876 nucleotides) and rabbit/3-zlobin mRNA (710 nucleotides).

128

Rice Maize Rice

lMet Ala AlalTyr Thr Ser Lys Ile PheJAla[LeulPhe A1a

Ile

GlyJLeu Ser Ala Ser Ala'lAlajThr A~a~ISI: Ile Phe P r o ~ C y s AlaJLeu Ser Ala Ser AlalThrJThr Thr Thr Met Tyr

Fig. 5. Comparison of the homology of rice 10 kDa prolamin cDNA with the maize 19 kDa zein cDNA. Signal peptide sequences of the l0 kDa rice prolamin and the 19 kDa zein [25] are compared. The homologous amino acids are boxed. An arrowhead indicates the cleavage sites of the both polypeptides.

Amino acid sequence of the mature 10 kDa prolamin polypeptide The deduced amino acid sequence for the mature polypeptide indicated remarkably high contents of sulfur-containing amino acids, methionine (20°70) and cysteine (10%), as well as glutamine (16070) and proline (607o). A part of the amino acid sequence from 68 to 80 was homologous with sequences that are found in several prolamins of other cereals [6, 22, 24, 27] (Fig. 6). No other obvious homology was found among the prolamins including the zein 15 kDa prolamin which is sulfur-rich [24]. There are two regions of repeats of amino acid sequence (Fig. 7).

Discussion Prolamin is the major storage protein in rice seeds as well as glutelin 112, 32, 37, 38]. Prolamin genes from maize [20, 24, 25], wheat [22], and barley [6] have been cloned and well characterized. No cloning of rice prolamin genes, however, has been reported. TIlis study, to our knowledge, is the first report for

68 63 132 ~60

L Q Q Q C L~Q Q C L~Q Q Q C Q Q C L Q Q~C

C']M]Q J I"--"1 Q ,L G C Q QIQ M R C Q Q L--~* R C Q Q LiP Q C Q Q LJW Q

M M Q I I

M M V P P

80 75 143 172

Fig. 6. Conserved amino acid sequences among prolamins. Conserved regions for amino acid sequences of 15 kDa zein [24], 27 kDa zein 1271, B-hordein [6], and c~//~ gliadin [22] (line 2, 3, 4 and 5 respectively) are aligned with the l0 kDa rice prolamin (top line).

cDNA cloning of a rice prolamin gene. In this study, we focused on the cloning of a 10 kDa prolamin polypeptide which had been shown as sulfur-rich as a Brazil nut protein has II. I11. The findings shown in this study indicate that kPRI0 is a full-length cDNA clone for it. The molecular weight of the mature protein calculated from the deduced amino acid sequence is 12266. Although the molecular weight does not match the value, "10 kDa", which had been determined for the polypeptide by SDS-PAGE, the discrepancy might be due to an unusual amino acid composition of the polypeptide. We tentatively call the polypeptide a 10 kDa prolamin in this study. Using a computer program, IDEAS, we showed an exact location of a signal peptide which locates at an amino terminal of the deduced polypeptide sequence in addition to the other criteria as shown in Results. This indicates that the program can distinguish the membrane-spanning regions and hydrophobic amino acid clusters which exist through the prolamin polypeptide. We appreciated this program because of the correct prediction of the locations of signals in zeins and gliadins (data not shown). When we imporve the quality of prolamin and introduce it in a plant (see Introduction), the

(29) (45) (53) (92)

QYFPPTLAMG ( 3 8 ) 11 11 11 QYMMQTLGMG ( 5 4 ) MGSSTAMFMSQPMALLQQQCCMQLQGMMP ( 8 1 ) 1 1 1 111 11 MQSMQQVICAG---LGQQQMMKMAM-QMP ( 1 1 5 )

Fig. 7. Repeat of amino acid sequence in a rice l0 kDa prolamin polypeptide. Numbers in parenthesis refer to positions of the amino acids within the sequence of the prolamin polypeptide.

129 program is useful to learn whether the protein accumulates in the protein body. Two imperfect repeats of amino acid sequence was found in the polypeptide (Fig. 4); most of the other prolamin proteins have internal repeats. One of the repeats (53-81 and 92-116) is located in the conserved region found in other cereal prolamins (Fig. 7). It suggests an unknown biological significance of the repeat. Zein, a major storage protein in maize seeds, is synthesized by polysomes attached to the membrane of a protein body [3J. This protein accumulation mechanisms is quite similar to rice prolamin accumulation in a protein body, PB-I, as observed by electron microscopy [36]. We can infer that an identical or quite similar mechanism works during the biosynthesis, translocation and accumulation of prolamin polypeptides in the endosperm cells of both rice and maize. Rice prolamin polypeptides accumulate in PB-I of the endosperm cells, glutelin polypeptides in PBII of the same cells. There must be a mechanism for the segregation of them into two protein bodies in the same cell. One possible explanation for the specific targeting of prolamin polypeptides into PBI is the interaction of the signal peptides with a membrane which would be specific for PB-I. The homology between rice and maize prolamin signals (Fig. 6) supports this hypothesis. No strong homology between the signal peptides of the prolamin and glutelin [33] was found. Interaction among protein body membranes and in vitro synthesized prolamin signal peptide are under investigation in our laboratory.

Acknowledgements We are grateful to Dr Kozo Otsuki and Dr Makoto Kawabata for sequencing of the amino-terminal region of the mature rice 10 kDa prolamin and Atsunori Kitamura and Miki Tada for help with screening of a cDNA library. We are also grateful to Dr Rusty J. Mans for his careful reading of this manuscript. This work has been supported by grants from the Ministry of Education Science and Culture (Japan),

the Ministry of Agriculture, Forestry and Fisheries (Japan) and the Rockefeller Foundation.

References 1. Altenbach SB, Pearson KW, Leung FW, Sun SSM: Cloning and sequence analysis of a cDNA encoding a Brazil nut protein exceptionally rich in methionine. Plant Mol Biol 8: 239-250 (1987). 2. Bonner WM, Laskey RA: A film detection method for tritium-labelled proteins and nucleic acids in polyacrylamide gels. Eur J Biochem 46:83-88 (1974). 3. Burr B, Burr FA: Zein synthesis in maize endosperm by polyribosomes attached to protein bodies. Proc Natl Acad Sci USA 73:515-519 (1976). 4. Cameron-Mills V: The structure and composition of protein bodies purified from barley endosperm by silica sol density gradients. Carlsberg Res Commun 45:557-576 (1980). 5. Chen EY, Seeburg PH: Supercoil sequencing: A fast and simple method for sequencing plasmid DNA. DNA 4:165-170 (1985). 6. Forde BG, Kreis M, Williamson MS, Fry RP, Pywell J, Shewry PR, Bunce N, Miflin BJ: Short tandem repeats shared by B- and C-hordein cDNAs suggest a common evolutionary origin for two groups of cereal storage protein genes. EMBO J 4:9-15 (1985). 7. Gubler U, Hoffman BJ: A simple and very efficient method for generating cDNA libraries. Gene 25:263-269 (1983). 8. Hager DA, Burgess RR: Elution of proteins from sodium dodecyl sulfate-polyacrylamide gels, removal of sodium dodecyl sulfate, and renaturation of enzymatic activity: results with sigma subunit ofEscherichia coli RNA polymerase, wheat germ DNA topoisomerase, and other enzymes. Anal Biochem 109:76-86 (1980). 9. Hanahan D: Studies on transformation of Escherichia coli with plasmids. J Mol Biol 166:557-580 (1983). 10. Helfman DM, Feramisco JR, Fiddes JC, Thomas GP, Hughes SH: Identification of clones that encode chicken tropomyosin by direct immunological screening of a cDNA expression library. Proc Natl Acad Sci USA 80:31-35 (1983). 11. Hibino T, Kidzu K, Masumura T, Otsuki K, Tanaka K, Kawabata M, Fujii S: Amino acid compositions of rice prolarain polypeptides. Agric Biol Chem (1989) in press. 12. Houston DF: Rice chemistry and technology. American Association of Cereal Chemists, St. Paul, (1972). 13. Kanehisa M, Klein P, Greif P, DeLisa C: Computer analysis and structure prediction of nucleic acids and proteins. Nucl Acids Res 12:417-428 (1984). 14. Klein P, Kanehisa M, DeLisi C: The detection and classification of membrane-spanning proteins. Bioch Biophys Acta 815:468-476 (1985). 15. Kozak M: Points mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 44:283-292 (1986).

130 16. Kumamaru T, Satoh H, lwata N, Omura T, Ogawa M: Mutants for rice storage proteins. III. genetic analysis of mutants for storage proteins of protein bodies in the starchy endosperm. Jap J Genet 62:333-339 (1987). 17. Kyte J, Doolittle RF: A simple method for displaying the hydropathic character of a protein. J Mol Biol 157:105-132 (1982). 18. Lutcke HA, Chow KC, Mickel FS, Moss KA, Kern HF, Scheele GA: Selection of AUG initiation codons differs in plants and animals. EMBO J 6:43-48 (1987). 19. Maniatis T, Fritsch EF, Sambrook J: Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1982). 20. Marks MD, Larkins BA: Analysis of sequence microheterogeneity among zein messenger RNAs. J Biol Chem 257:9976-9983 (1982). 21. Ogawa M, Kumamaru T, Satoh H, Iwata N, Omura T, Kasai Z, Tanaka K: Purification of protein body-I of rice seed and its polypeptide composition. Plant Cell Physiol 28: 1517-1527 (1987). 22. Okita TW, Cheesbrough V, Reeves CD: Evolution and heterogeneity of the a-/~type and 3,-type gliadin DNA sequences. J Biol Chem 260:8203-8213 (1985). 23. Peacock SL, Mclver CM, Monahan J J: Transformation of E. coli using homopolymer-linked plasmid chimeras. Biocheim Biophys Acta 655:243-250 (1981). 24. Pedersen K, Argos P, Naravana SVL, Larkins BA: Sequence analysis and characterization of a maize gene encoding a high-sulfur zein protein of M r 15000. J Biol Chem 261: 6279-6284 (1986). 25. Pederson K, Devereux J, Wilson DR, Scheldon E, Larkins BA: Cloning and sequence analysis reveal structural variation among related zein genes in maize. Cell 29:1015-1026 (1982). 26. Pernollet JC, Mosse J: Structure and location of legume and cereal seed storage proteins. In: Daussant J, Mosse J, Vaughan J (eds) Seed Protein, pp. 155-191. Academic Press, New York (1983). 27. Prat S, Cortadas J, Puigdom~nech P, Palau J: Nucleic acid

28.

29.

30.

31.

32. 33.

34.

35.

36.

37. 38.

39.

(cDNA) and amino acid sequences of the maize endosperm protein glutelin-2. Nucleic Acids Res 13:1493-1504 (1985). Roberts BE, Paterson BM: Efficient translation of tobacco mosaic virus RNA and rabbit globin 9S RNA in a cell-free system from commercial wheat germ. Proc Natl Acad Sci USA 70:2330-2334 (1973). Sanger F, Nicklen S, Coulson AR: DNA sequencing with chainterminating inhibitors. Proc Natl Acad Sci USA 74: 5463-5467 (1977). Shibata D, Steczko J, Dixon JE, Hermodson M, Yazdanparast R, Axelrod B: Primary structure of soybean lipoxygenase-l. J Biol Chem 262:10080-10085 (1987). Sugimoto T, Tanaka K, Kazai Z: Molecular species in the protein body II (PB-II) of developing rice endosperm. Agric Biol Chem 50:3031-3035 (1986). Sugimoto T, Tanaka K, Kasai Z: Improved extraction of rice prolamin. Agric Biol Chem 50:2409-2411 (1986). Takaiwa F, Kikuchi S, Oono K: The structure of rice storage protein glutelin precursor deduced from cDNA. FEBS 206: 33-35 (1986). Tanaka K, Sugimoto T, Ogawa M, Kasai Z: Isolation and characterization of two types of protein bodies in the rice endosperm. Agric Biol Chem 44:1633-1639 (1980). Tanaka Y, Hayashida S, Hongo M: The relationship of the feces protein particles to rice protein bodies. Agric Biol Chem 39:515-518 (1975). Yamagata H, Tanaka K: The site of synthesis and accumulation of rice storage proteins. Plant Cell Physiol 27: 135-145 (1986). Yamagata H, Tamura K, Tanaka K, Kasai Z: Cell-free synthesis of rice prolamin. Plant Cell Physio127:1419-1422 (1986). Yamagata H, Sugimoto T, Tanaka K, Kasai Z: Biosynthesis of storage proteins in developing rice seeds. Plant Physio170: 1094-1100 (1982). Young RA, Davis RW: Efficient isolation of genes by using antibody probes. Proc Natl Acad Sci USA 80:1194-1198 (1983).