DEVELOPMENTAL G E N E T I C S 12:50-53 (1991)

cDNA Sequence of Cyclophilin From Dictyostelium discoideum KARMELA BARISIC, STEFAN MOLLNER, ANGELIKA A. NOEGEL, GUENTHER GERISCH, AND JEFFREY E. SEGALL Max-Planck-Institut fuer Biochemie, Martinsried bei Muenchen (K.B., A.A.N., G.G., J.E.S.) and Physiologisch-Chemisches Institut der Universitaet Wuerzburg, Wuerzburg (S.M.), Federal Republic of Germany. A cDNA encoding a protein ABSTRACT homologous to cyclophilins from other species has been isolated from a Dictyostelium discoideum cDNA library. From the deduced amino acid sequence a protein with a molecular mass of 19 kD and 64% identity with human cyclophilin is predicted. Southern blot analysis indicates that there is one cyclophilin gene in the D. discoideum genome. The mRNA is present in all developmental stages.

MATERIALS AND METHODS Culture of D. discoideum Strain AX2-214 was used for the isolation of DNA and RNA. Cells were grown axenically a t 21"C, harvested during the exponential phase of growth, and washed free of nutrients by centrifugation in cold 17 mM Soerensen Na,HPO,/KH,PO, buffer, pH 6.0. For development, cells were dispensed onto nitrocellulose filters (type HABG, Millipore) at 21°C in the light.

Key words: Dictyostelium, pratei n f o Idin g , pepti-

cDNA Sequencing Clone 16-7 was isolated from a X g t l l cDNA library [Lacombe et al., 19861kindly provided by Dr. R. Kessin, Columbia University. The insert of this clone turned out to be a n artificial fusion product. Its 5' half apparently encoded a histone sequence, which reacted unexpectedly with one of the antibodies used for screening. The 3' half contained the cyclophilin coding region, which is the subject of this paper. The insert was subcloned into pUC19 [Yanisch-Perron et al., 19851. The restriction cleavage map and the sequencing strategy for the region containing the cyclophilin coding sequence are shown in Figure 1. Deletion clones of the subclone were produced by exonuclease IIUexonuclease S1 treatment (Promega Biotec). The sequence was determined by the chain termination method [Sanger et al., 19771 using pUC19-specific primers as well as primers derived from the sequence. Both strands were sequenced.

dyl-prolyl isomerase

INTRODUCTION Cyclophilins are specific, high affinity binding proteins for cyclosporin A [Harding and Handschumacher, 19881, a cyclic undecapeptide of fungal origin that is a n important immunosuppressive agent [Bennett and Norman, 19861. T cell-mediated immune reactions are inhibited by cyclosporin A. This inhibition is probably due to the specific and complete inhibition of lymphokine mRNA production in helper T cells [Kroenke et al., 19841. Recently, cyclophilin has been shown to be identical to a peptidyl-prolyl cis-trans isomerase which catalyzes the cis-trans isomerization of proline imidic peptide bonds and can accelerate the refolding of proteins in vitro [Fischer et al., 1989; Takahashi et al., 19891. Cyclosporin A inhibits these activities. Cyclophilins have been isolated from bovine thymus [Harding et al., 19861, human spleen [Harding et al., 19861, and Neurosporu crassa [Tropschug et al., 19881. The apparent molecular masses range from 17 kD to 20 kD. Bovine and human cyclophilins have 98% sequence identity [Haendler et al., 19871, while the N . crassa cyclophilin has roughly 60% identity to the human one [Tropschug et al., 19881. The ninaA gene from Drosophila melanogaster encodes a protein which has a region with more than 40% sequence identity to vertebrate cyclophilins [Shieh et al., 19891. The sequence conservation suggests that cyclophilin has a n important functional role in the cell. In this report we describe the sequence of a cDNA from Dictyostelium discoideum encoding a protein with high homology to cyclophilins of other species.

0 1991 WILEY-LISS, INC.

DNA and RNA Isolation and Hybridization Chromosomal DNA was isolated from purified D. discoideum nuclei [Noegel et al., 19851 and digested with EcoRI, HindIII, K p n l , PstI, SspI, or XbaI. The

Received for publication April 25, 1990. Address reprint requests to Karmela Barisic, Max-Planck-Institut fuer Biochemie, 8033 Martinsried bei Muenchen, FRG. Jeffrey E. Segall is now a t Department of Anatomy and Structural Biology, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461.

DICTYOSTELIUM DISCOIDEUM-CYCLOPHILIN EcoRV

ATG

BsrI

BsrI

BsrI Hind11

51

blots were then hybridized to nick-translated cDNA fragments a t 37°C in 50% formamide, ~ x S S C , 4 x Denhardt's solution, 4mM EDTA, 1% sarcosyl, 0.12 M sodium phosphate buffer, pH 6.8, and 0.1% SDS. The blots were washed a t 37°C with 50% formamide, ~ x S S C ,2 mM EDTA, 1% sarcosyl, 0.12 M sodium phosphate, pH 6.8, and 0.2% SDS.

x C

-

.A

TAA

t

Fig. 1. Sequencing strategy of the 3'portion of the D.discoideum cDNA clone 16-7. Cleavage sites for restriction enzymes and directions of sequencing are indicated. Sequence-specific oligonucleotide primers are represented by boxes.

restriction fragments were separated on 0.7% agarose gels and transferred onto nitrocellulose filters (type BA85, Schleicher and Schuell). Total cellular RNA was isolated and purified by several phenol/chloroform extractions [Noegel et al., 19851. RNA was separated by electrophoresis in 1.2% agarose gels in the presence of 7% formaldehyde [Maniatis et al., 19821 and transferred onto nitrocellulose. Southern and Northern 15

1

30

RESULTS The 3' portion of clone 16-7 from a D. discoideum cDNA library contained a sequence with one long open reading frame starting with ATG (Fig. 2). The codon usage is typical for D. discoideum genes [Warrick and Spudich, 19881. The sequence ends with a poly-A tail of 3 1 nucleotides. A polyadenylation signal (underlined in Fig. 2) is present 37 bases downstream from the TAA stop codon. The deduced amino acid sequence indicates a translation product of 179 residues with a calculated molecular mass of 19 kD. There does not appear to be a signal 45

60

ATG ACA ACT GTT AAA CCA ACC TCC CCA GAA AAC CCA CGT GTC TTC TTT GAT ATC ACC ATC Met Thr Thr Val Lys Pro Thr Ser Pro Glu Asn Pro Arg Val Phe Phe Asp I l e Thr I l e 75

90

105

120

GGT GGT GTT GAA GCC GGT AAA GTA GTT ATG GAA TTA TAT GCC AAC ACT GTC CCA AAG ACT Gly Gly Val Glu Ala Gly Lys Val Val Met Glu Leu Tyr Ala Asn Thr Val Pro Lys T h r 135

150

165

180

GCT GAA AAC TTC AGA GCT TTA TGT ACT GGT GAA AAA GGT ATC GGT AAA TCA GGC AAA CCA Ala Glu Asn Phe Arg Ala Leu Cys Thr Gly Glu Lys Gly I l e Gly Lys Ser Gly Lys Pro 195

210

225

240

TTA TCA TAC AAA GGA TCA TCT TTC CAT CGT GTT ATC ACC AAC TTT ATG TGT CAA GGT GGT Leu Ser Tyr Lys Gly Ser Ser Phe His Arg Val I l e Thr Asn Phe Met Cys Gln Gly Gly 255

270

285

300

GAC TTT ACC ATG GGT AAT GGT ACT GGT GGT GAA TCA ATC TAC GGT AAC AAA TTT GCT GAT Asp Phe Thr Met Gly Asn Gly Thr Gly Gly Glu Ser I l e Tyr Gly Asn Lys Phe Ala Asp 315 330 345 360 GAA AAC TTC AAA TTA AAA CAT TTC GGT CAA GGT ACA CTC TCA ATG GCC AAC GCT GGT GCC Glu Asn Phe Lys Leu Lys His Phe Gly Gln Gly T h r Leu Ser Met Ala Asn Ala Gly Ala 390

375

405

420

AAC ACC AAT GGT TCA CAA TTC TTT ATC TGT GTT GCT CCA ACT GAT TGG TTA GAC GGT AAA Asn Thr Asn Gly Ser Gln Phe Phe I l e Cys Val Ala Pro Thr Asp Trp Leu Asp Gly Lys 435 450 465 480 CAC GTT GTA TTC GGT TTT GTC ACT GAA GGT ATG GAT GTC GTT AAA AAG ATG GAA GCT GCT His Val Val Phe Gly Phe Val Thr Glu Gly Met Asp Val Val Lys Lys Met Glu Ala Ala 495

510

525

540

GGT TCA CAA TCA GGT AAA ACT ACC AAA CCA GTC GTC ATT GCC AAC TGT GGT CAA CTT TAA Gly Ser Gln Ser Gly Lys Thr Thr Lys Pro Val Val I l e Ala Asn Cys Gly Gln Leu ATTATCAACATATAGCTTTTTTATAATAATTAATAATAAT~G~TTGATTCAATTTTTTTTTGTACCTTTGTAAT

T

T

T

T

C

P

Fig. 2. Nucleotide sequence of the 3' portion of clone 16-7 and deduced amino acid sequence. A polyadenylation signal in the 3' non-coding region is underlined.

BARISIC ET AL.

52

1

Dd

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Nc Dm

. . . . . . . . . . . . . . . . . .

Dd

. . . . . . . . . .

H~ Nc Dm

VEAGK VMELY N T V P K T A E N F R A L C T . G E K G I G K S G K P L S Y K G S S F H R . . . . . . . K G S ~ F H R . . . . . . . . . . E~LGRVSFELF PNNKPTSEIKAQSGRINFTLYD VVPKTARNFKELCT.G NGFG . . . . . . . KGSSFHR . . . . . . . . ..K@VGRITFGLF KLA KTVANFRHICL GINGT . . . . . . . SYVGSRFHR

Dd Hs N C

Dm

. . . .

VLG

,9 . . . .

60)n

~~~~

KVPKTAENFRALHT.GEKGFG

Gd

~

140n

.1

l5Oy

#&6B

~

170

FIC APTD LDGKHVVFGF T..EGMDVVKKMEAAGSQSG.. FICTA T E L D G K H V V F G K V K . . E G M N I V E A M E FGSR G . . F V T v T S L D G ~ H V V F G ~ AED@ M K V V K A L E A T G S S S G A I Y V T V AK LDGKHT F G K V L . . E G M D T I Y A I E V K T D T D . .

Fig. 3. Alignment of the D. discoideum cyclophilin sequence deduced from clone 16-7 (Dd) with human cyclophilin (Hs) [Haendler et al., 19871, N . crassa mitochondria1 cyclophilin (Nc) [Tropschug et al., 19881 and the D. mehogaster ninaA gene product (Dm; the last 44 residues are not shown) [Shieh et al., 19891. Identical residues are boxed. The numbers follow the D. discoideum sequence.

sequence, and a hydropathy plot [Kyte and Doolittle, 19821 does not indicate any typical transmembrane regions. We conclude that the sequence encodes a cytosolic protein Computer searches a t the amino acid level revealed high homology with human and other cyclophilins. Figure 3 details the homology between the D . discoideum sequence and cyclophilins from other species. A comparison with human cyclophilin showed 64% identity with one gap introduced. Lower degrees of identity were found between the D. discoideum sequence and the cyclophilin from N . crassa (58%with 4 gaps) or the ninaA gene from D. melanogaster (40% with 4 gaps). Particularly conserved areas occur between amino acids 75 and 102, 113 and 134, and 136 and 147. Southern blot analysis was performed using enzymes that do not cut in the cyclophilin coding sequence of clone 16-7. Using as a probe the region of 16-7 shown in Figure 1, one band was detected in each digest (Fig. 4). The smallest one was 1.3 kb, suggesting the presence of only one gene for cyclophilin in D. discoideum. To determine whether there is developmental regulation of the expression of cyclophilin, RNA from dif-

ferent stages of development was analyzed (Fig. 5).Under high stringency conditions, a single 0.7 kb band was found. The expression of the transcript did not appear to be developmentally regulated.

DISCUSSION Our results indicate that D. discoideum contains a gene encoding a protein highly homologous to cyclophilins of other species. Comparison of the sequences from four species reveals several blocks of conserved sequences. Within one of these blocks is a tryptophan (Trp 136) that changes fluorescence upon binding of cyclosporin A [Handschumacher et al., 19841. The conservation of this region suggests that it is involved in carrying out the cellular function of cyclophilin. The sulfhydryl group modifier p(hydr0xymercuri)benzoate (pHMB) inactivates the isomerase activity of cyclophilin [Fischer et al., 19891. Cyclosporin A binding is sulfhydryl dependent and prevents this inactivation. The site of pHMB action may be cysteine residue 176, the only cysteine residue which is conserved among all four species. The D. discoideum sequence is distin-

DICTYOSTELIUM DISCOIDEUM-CY CLOPHILIN

1

2

3

4

5

53

6

0

3

6

9

12

18

21h kb

kb -0.7

23.1,

9.4 b

6.7

-

4.4,

2.3 m 2.0 *

Fig. 4. Southern blot analysis of D. discoideum genomic DNA. DNA was digested with EcoRI (l),Hind111 (2),KpnI (3),PstI (4), SspI (5), or XbaI (6), separated by gel electrophoresis and blotted onto nitrocellulose. The blot was probed with the nick-translated 16-7 cDNA fragment shown in Figure 1. Sizes in kilobases of lDNA Hind I I fragments are indicated.

guished from the others by a n insertion of six amino acids (residues 56-61). The observation that cyclosporin A affects gene regulation in T cells suggests that cyclophilin is involved in the control of signal transduction [Kroenke et al., 19841. The ninaA mutant has 10-fold reduced amounts of rhodopsin and is defective in visual signal transduction [Shieh et al., 19891. An exciting possibility is that the D. discoideum cyclophilin also affects signal transduction, particularly since the CAMP receptors controlling development and chemotaxis are rhodopsin-related protein [Klein et al., 19881. Experiments are under way to test this hypothesis.

ACKNOWLEDGMENTS We are grateful to U. Weinhart and B. Tiemann for help in cloning and sequencing. This work was supported by the Deutsche Forschungsgemeinschaft.

Fig. 5. Presence of cyclophilin mRNA in all developmental stages of D.discoideum. The RNA was isolated a t the times of development indicated in hours from cells starved on filters. Northern blots were probed with the same fragment as used in Figure 4. The 12 hour stage corresponds to aggregation, the 18 hour stage t o slug formation, and the 21 hour stage to culmination.

REFERENCES Bennett WM, Norman DJ (1986): Action and toxicity of cyclosporin. Annu Rev Med 37:215-224. Fischer G, Wittmann-Liebold B, Lang K, Kiefhaber T, Schmid FX (1989): Cyclophilin and peptidyl-prolyl cis-trans isomerase are probably identical proteins. Nature 337:476-478. Haendler B, Hofer-Warbinek R, Hofer E (1987): Complementary DNA for human T-cell cyclophilin. EMBO J 6:947-950. Handschumacher RE, Harding MW, Rice J, Drugge FLJ,Speicher DW (1984): Cyclophilin: A specific cytosolic binding protein for cyclosporin A. Science 226:544-547. Harding MW, Handschumacher RE (1988): Cyclosporin and its receptor, cyclophilin. Adv Inflammation Res 12:283-294. Harding MW, Handschumacher RE, Speicher DW (1986): Isolation and amino acid sequence of cyclophilin. J Biol Chem 261:85478555. Klein PS, Sun TJ, Saxe CL, 111, Kimmel AR, Johnson RL, Devreotes PN (1988): A chemoattractant receptor controls development in Dictyostelium discoideum. Science 241:1467-1472. Kroenke M, Leonard WJ, Depper JM, Arya SK, Wong-Staal F, Gallo RC, Waldmann TA, Greene WC (1984): Cyclosporin A inhibits Tcell growth factor gene expression a t the level of mRNA transcription. Proc Natl Acad Sci USA 81:5214-5218. Kyte J , Doolittle RF (1982): A simple method for displaying the hydropathic character of a protein. J Mol Biol 157:105-132. Lacombe M-L, Podgorski GJ, Franke J , Kessin RH (1986): Molecular cloning and developmental expression of the cyclic nucleotide phosphodiesterase gene of Dictyostelium discoideum. J Biol Chem 261: 16811-16817. Maniatis T, Fritsch EF, Sambrook J (19821: “Molecular cloning. A Laboratory Manual.” Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. Noegel A, Metz BA, Williams KL (1985): Developmentally regulated transcription of Dictyostelium discoideum plasmid Ddpl. EMBO J 4:3797-3803. Sanger F, Nicklen S, Coulson AR (1977):DNA sequencing with chainterminating inhibitors. Proc Natl Acad Sci USA 74:5463-5467. Shieh B-H, Stamnes MA, Seavello S, Harris GL, Zuker CS (1989):The ninaA gene required for visual transcription in Drosophila encodes a homologue of cyclosporin A-binding protein. Nature 338:67-70. Takahashi N, Hayano T, Suzuki M (1989): Peptidyl-prolyl cis-trans isomerase is the cyclosporin A-binding protein cyclophilin. Nature 337:473-475. Tropschug M, Nicholson DW, Hart1 F-U, Koehler H, Pfanner N, Wachter E, Neupert W (1988): Cyclosporin A-binding protein (cyclophilin) of Neurospora crussa. J Biol Chem 263:14433-14440. Warrick HM, Spudich J A (1988): Codon preference in Dictyostelzum discoideum.Nucleic Acids Res 16:6617-6635. Yanisch-Perron C, Vieira J, Messing J (1985): Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33:103-119.

cDNA sequence of cyclophilin from Dictyostelium discoideum.

A cDNA encoding a protein homologous to cyclophilins from other species has been isolated from a Dictyostelium discoideum cDNA library. From the deduc...
394KB Sizes 0 Downloads 0 Views